Gene ZmER2 for regulating and controlling activity of maize pollen and application of gene ZmER2

Abstract

The invention discloses a gene ZmER2 encoded by corn receptor kinase. The CDS (Coding Sequence) of the gene is as shown in SEQ ID No. 1. The invention also discloses corn mutants containing the gene ZmER2, the corn mutants are respectively named as a mutant Zmer2-D17 and a mutant Zmer2-I1, the CDS nucleotide sequence of the mutant Zmer2-D17 is shown as SEQ ID No.3, and the amino acid sequence of the gene is shown as SEQ ID No.4; the CDS nucleotide sequence of the mutant Zmer2-I1 is as shown in SEQ ID No. 5, and the amino acid sequence of the gene is as shown in SEQ ID No. 6. The invention also discloses a phenotype that tassels do not loosen pollen after the gene ZmER2 coded by the receptor kinase is mutated under the condition that yield traits such as plant height, ear height and ear row number are not influenced, and the phenotype is a precious material for researching pollen development, cytoplasm heredity, nucleocytoplasm interaction and the like. It is indicated that the ZmER2 gene has a good application prospect in hybrid seed production.

Description

Technical Field

[0001] The present invention belongs to the technical fields of plant bioengineering breeding and molecular biology. Specifically, it relates to a maize receptor-like kinase encoding gene ZmER2 and its application in pollen fertility. Background Art

[0002] Maize (Zea mays), as an important food and feed crop, is known as one of the world's "three major staple grains" together with rice and wheat. It is widely planted in northern China, the Huang-Huai-Hai region, and the southwestern region, with the cultivation area ranking first among the three major crops. The maize yield plays a crucial role in China's food security. Improving the maize yield will provide an important guarantee for China's food security and economic development. At present, due to the reduction of the population labor force and the increase in the cost of crop breeding, the use of its male sterility and female fertility characteristics for hybrid seed production is widely applied in the utilization of crop heterosis and population improvement, which can save labor and further reduce the cost of crop cultivation, providing a good guarantee for the development of maize hybrid seed production.

[0003] The transition from vegetative growth to reproductive growth is one of the most important developmental processes in plant life. Maize produces two morphologically distinct inflorescences during this process. The significant morphological difference between the two inflorescences is that there are unequal numbers of long branches at the base of the ear, and such long branches are absent in the female inflorescence. These two inflorescences first form a pair of short branches called spikelets, which are characterized by having external and internal glumes and enclosing unequal numbers of florets. The florets are divided into upper florets and lower florets, and each floret consists of a lemma and a palea, two lodicules, three stamens and a central pistil, which is composed of three fused carpels surrounding an ovule. When the pistil aborts during floret development, the tassel is produced. Similarly, when stamen development terminates, the ear is also produced, and the final result is monoecious, forming unique male and female inflorescences. During the inflorescence transition, the shoot apical meristem (SAM) transforms into the inflorescence meristem (IM) of the tassel and ultimately forms the tassel. The development of maize anthers begins with stamen primordia. The outer layer (L1) forms the epidermis, and the inner layer (L2) differentiates into primary parietal cells (PPCs) and archesporial cells (Ars). The PPCs divide peripherally to form endothecium (EN) and secondary parietal cells (SPCs) adjacent to the ARs. The SPCs generate the middle layer (ML) and the tapetum (T) through periclinal division. The most prominent cell layer of the anther is the tapetum, which is a layer of metabolically active cells that surrounds the developing pollen. Pollen development includes three main stages: (1) microsporogenesis (differentiation and meiosis of sporogenous cells); (2) development after microspore meiosis; and (3) microspore mitosis. Spore cells (pollen mother cells or meiocytes) are enclosed in a callose wall derived from the tapetum and form a tetrad of haploid microspores after meiosis. This callose layer is essential for the development and formation of the pollen wall scaffold, and then it decomposes, and the microspores are released into the anther chamber to start male gametophyte development, undergoing two cycles of mitosis to produce the final trinucleate pollen grains. The final mitosis occurs in the pollen tube. The anther filaments elongate rapidly, and then the flower and anthers open, enabling the effective release of pollen.

[0004] During the production process of maize hybrid seeds, using male sterility for seed production can not only save a large amount of labor but also avoid the reduction in yield caused by the incomplete emasculation of the female parent, which leads to a decrease in seed purity. After retrieval, there is no report on the receptor-like kinase gene ZmER2 and its application in regulating pollen activity. Summary of the Invention

[0005] In view of the current research status, the object of the present invention is to provide a maize receptor-like kinase encoding gene ZmER2 and its application in regulating pollen activity.

[0006] The maize receptor-like kinase gene ZmER2 of the present invention is characterized in that: the CDS nucleotide sequence of the gene ZmER2 is as shown in SEQ ID No.1, and its protein coding sequence is as shown in SEQ ID No.2, regardless of the gene cloning method.

[0007] In view of the fact that those skilled in the art can easily modify or mutate the nucleotide sequence of the gene described in this invention patent by methods such as directed optimization or point mutation, those nucleotide sequences that have been artificially modified and have a homology of ≧85% with the CDS sequence of the gene provided by the present invention and still have the function of this gene are all sequence derivatives of the gene described in the present invention, equivalent to the sequence described in the present invention, and belong to the protection scope of this patent.

[0008] The present invention also provides a recombinant expression vector containing the above gene ZmER2.

[0009] Among them: the receptor vector used for the recombinant expression vector is pk7FWG2-EGFP, and the recombinant expression vector contains the complete open reading frame (ORF) sequence as shown in SEQ ID No.1 above.

[0010] A preferred embodiment is: the expression vector containing the above maize receptor-like kinase encoding gene ZmER2 is pk7FWG2-35S-ER2-EGFP.

[0011] The application of the maize receptor-like kinase encoding gene ZmER2 of the present invention in pollen fertility research.

[0012] The present invention discloses maize mutants containing the above gene ZmER2, named mutant Zmer2-D17 and mutant Zmer2-I1 respectively. Their characteristics are: the CDS nucleotide sequence of the mutant Zmer2-D17 is as shown in SEQ ID No.3, and the amino acid sequence of this gene is as shown in SEQ ID No.4; the CDS nucleotide sequence of the mutant Zmer2-I1 is as shown in SEQ ID No.5, and the amino acid sequence of this gene is as shown in SEQ ID No.6.

[0013] Among them: in the mutants Zmer2-D17 and Zmer2-I1, there is a 17-base deletion and a T-base insertion in the LRR domain, resulting in premature termination of translation.

[0014] The application of the maize mutant of the gene ZmER2 of the present invention in regulating pollen activity and in breeding. The application is achieved by mutating the gene ZmER2 in the crop body.

[0015] The present invention provides two non-naturally occurring maize mutation sites within the ZmER2 gene, wherein the mutations are substitutions, insertions, deletions or transversions introduced using an editing system.

[0016] The present invention provides a method for generating / cultivating a genetically edited maize plant without transgenes, comprising: crossing the maize plant of the present invention with a wild-type maize plant so as to introduce the at least one non-natural mutation into the wild-type maize plant; and selecting progeny maize plants that contain the at least one non-natural mutation and are without transgenes, thereby generating a genetically edited maize plant without transgenes.

[0017] The present invention provides a maize plant that exhibits a phenotype of shriveled and inactive pollen, and discloses the application of the above-mentioned receptor-like kinase gene ZmER2 in regulating breeding. The function of the maize ZmER2 gene provided by the present invention has not been reported. This gene encodes a leucine-rich repeat receptor-like kinase (LRR-RLK), which has an extracellular LRR domain and an intracellular kinase domain. By detecting the ZmER2 function-deficient mutant, the applicant found that the mutant does not affect yield traits such as plant height, ear height and number of kernel rows per ear, but shows a phenotype of non-dispersing pollen in the tassel, and this phenotype has an important role in hybrid seed production. The main values and beneficial effects embodied in the present invention are:

[0018] 1) The maize receptor-like kinase-encoding gene ZmER2 was cloned using molecular biology techniques. The CDS sequence of this gene is shown in SEQ ID No.1. At the same time, mutants Zmer2-D17 and Zmer2-I1 with different mutation types of this gene were obtained, providing new candidate gene resources for genetic improvement of crop breeding.

[0019] 2) An expression vector pk7FWG2-35s-ZmER2-EGFP containing the above-mentioned maize receptor-like kinase-encoding gene ZmER2 was constructed. Transforming this vector into tobacco can prove that ZmER2 is localized in the cell membrane. Through the phenotypic analysis of Zmer2, it was found that the mutant does not affect yield phenotypes such as plant type and number of kernel rows per ear, but affects pollen dispersal in the tassel. By analyzing the activity and morphological observation of pollen, it was found that the pollen of the Zmer2 mutant has no activity and shows a shriveled phenotype, and this gene has great application prospects in crop fertility.

[0020] Of course, it is not necessary for any product implementing the present invention to achieve all the above-mentioned technical effects simultaneously. Description of the Drawings

[0021] Figure 1 : Schematic diagram of the structure of the plant expression vector pk7FWG2-35s-ZmER2-EGFP.

[0022] Figure 2 : PCR identification results of positive colonies obtained by transferring plasmid pk7FWG2-35s-ER2-EGFP into Agrobacterium

[0023] Among them, M: molecular weight marker DL2000; Lanes 1-8 are the PCR identification results of positive strains obtained by introducing the pk7FWG2-35s-ZmER2-EGFP plasmid into Agrobacterium. The upstream primer used is the primer on the vector, and the downstream primer is the primer on the gene

[0024] Figure 3 : Analysis of the expression pattern of ZmER2 in the present invention, for subcellular localization of ZmER2 in tobacco

[0025] Figure 4 : Structural diagram of maize ZmER2 protein in the present invention

[0026] Figure 5 : Mutation sites and allelic variation sites of mutant Zmer2 in the present invention, where Zmer2-D17 and Zmer2-I1 represent two types of variation respectively

[0027] Figure 6 : Phenotype of Zmer2-D17 mutant in the present invention; Among them, for the comparison of phenotypes of plants (A), female ears (B) and ear leaves at ear height (C), the left side of each picture is the wild type, and the right side is the mutant Zmer2-D17

[0028] Figure 7 : Comparison of tassel morphology in the present invention, A is the wild type; B is Zmer2-D17

[0029] Figure 8 : Comparison of pollen morphology in the present invention, A and B respectively represent scanning electron microscope images of the phenotypic difference parts of the wild type and mutant Zmer2-D17

[0030] Figure 9 : Difference in pollen viability in the present invention, A is the wild type; B is Zmer2-D17 Specific embodiments

[0031] The present invention will be further described below through specific examples. However, the following examples are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Any simple modification, equivalent change and modification made to the embodiments based on the technical essence of the present invention all fall within the scope of the technical solution of the present invention

[0032] Unless otherwise specified, the method content described in the following examples is all conventional experimental methods. Unless otherwise specified, the reagents, vectors, and strains involved are all obtained from well-known sales channels

[0033] Example 1: Identification of Mutant Genotype

[0034] Retrieve the genomic sequence of the gene from the MaizeGDB database (https: / / www.maizegdb.org / ) according to the sequence number Zm00001d018261 of the ZmER2 gene. After the maize germinates, extract the leaf DNA according to the following method:

[0035] 1) Take about 1 cm of young and fresh maize leaves and put them into a 2 mL centrifuge tube. Add 2 steel beads to the centrifuge tube. Set the sample grinder to 50 HZ for 1 min and sample twice;

[0036] 2) Operate in the fume hood and add 500 μL of DNA extraction solution to each tube;

[0037] 3) Then add 400 μL of phenol-chloroform (use the lower-layer chloroform after standing and separating) to each tube, shake and mix well, and place it on a shaker at 120 rpm to mix thoroughly;

[0038] 4) Centrifuge at 12000 rpm at room temperature for 10 min, and take 300 μL of the upper clear liquid and add it to a new 1.5 mL centrifuge tube;

[0039] 5) Add 30 μL of 3M sodium acetate (pH 5.2) solution and invert to mix well;

[0040] 6) Add 330 μL of isopropanol, slowly invert several times, mix well, and let it stand at room temperature for 5 min

[0041] 7) Centrifuge at 12000 rpm at room temperature for 5 min and discard the supernatant;

[0042] 8) Add 500 μL of 70% ethanol, invert several times, then centrifuge at 12000 rpm for 5 min and discard the supernatant.

[0043] 9) Repeat step (8).

[0044] 10) Place the centrifuge tube in a ventilated place and blow until the liquid completely evaporates.

[0045] 11) Add 50 μL of sterile water containing RNase or 1×TE. Place it in an oven at 60 °C for 30 min, and store it temporarily at 4 °C or store it at -20 °C.

[0046] Design primers at both ends of the knockout position, amplify, and design PCR amplification primers using DNAMAN software:

[0047] The upstream primer is 5'-ACTGGAGAAATCCCGTTCAA-3';

[0048] The downstream primer is 5'-TGTTGTTTGCAAGGTTCCTG-3'

[0049] The first-generation plants obtained by knockout were confirmed for base insertion and deletion through first-generation sequencing. Subsequently, dCAPs primers can be designed through the website (http: / /

[0050] / / indcaps.kieber.cloudapps.unc.edu / ) to identify genotypes. Select two different allelic mutants for planting, and subsequent generations can be identified by designing dCAPs primers.

[0051] Example 2: Cloning of the maize receptor-like kinase-encoding gene ZmER2

[0052] 1) Retrieve the cDNA sequence of this gene from the maize MaizeGDB database (https: / / www.maizegdb.org / ) according to the sequence number Zm00001d018261 of the ZmER2 gene for primer design and screening for the cloning of this gene.

[0053] 2) Based on the above sequence, use DNAMAN software to design PCR amplification primers.

[0054] Upstream primer

[0055] 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGGCCCGCCTCCTCCGG 3';

[0056] Downstream primer

[0057] 5'GGGGACCACTTTGTACAAGAAAGCTGGGTATTCCGTGCTCCGCGAGATC 3'.

[0058] 3) Take the leaves of maize B73 seedlings and the shoot apical meristem (SAM) of B73 planted for about 2 weeks and place them in a 1.5 mL centrifuge tube without RNase. Add 2 small steel beads to each tube. Quick-freeze the centrifuge tube in liquid nitrogen. Set the sample grinder to 35 HZ for 30 s and sample multiple times, freezing again in liquid nitrogen at intervals until the sample is pulverized. Extract RNA using the polysaccharide and polyphenol plant total RNA extraction kit (TIANGEN DP441), and perform reverse transcription according to the lll 1st Strand cDNA Synthesis Kit(+gDNAwiper)(Vazyme, R312-01 / 02) kit to obtain its cDNA template for the cloning of the ZmER2 gene. The reaction system is as follows:

[0059] The reaction system is shown as follows:

[0060] 1) Genomic DNA removal: Add the following components into an RNase-free PCR tube, gently pipette to mix well, and incubate at 42 °C for 2 min;

[0061]

[0062] 2) Add 4 μL of 5x HiScript III qRT SuperMix into the tube, and set up the PCR instrument according to the following program for reverse transcription reaction

[0063]

[0064] 3) The obtained cDNA can be stored in a -20 °C refrigerator for future use, or stored at -80 °C.

[0065] The recombinant expression vector is the recombinant plasmid pk7FWG2-35S-ER2-EGFP containing the receptor-like kinase gene ZmER2. Its construction method is as follows: Design gene amplification primers according to the Gateway instruction manual, amplify the insert fragment. Using the cDNA of the shoot apical meristem of B73 as a template, perform PCR according to the amplification system and amplification program of the P505 Novizan reagent instruction manual.

[0066] PCR reaction system:

[0067]

[0068] PCR reaction program: Pre-denature at 95 °C for 5 min; Denature at 95 °C for 15 s, anneal at 60 °C for 15 s, extend at 72 °C for 3 min, cycle 36 times; Extend at 72 °C for 10 min.

[0069] Purify the obtained PCR product using the D2500-02 Omega agarose gel recovery kit, and measure the concentration of the purified PCR product; After purification of the PCR product, perform the BP reaction according to ThermoFisher (11789100), and calculate the required amount of the PCR product according to the following formula:

[0070] Product ng = (X fmoles)(N)(660 fg / fmoles)(1 ng / 10 6 fg)

[0071] Transform competent cells. Perform colony PCR the next day. Label monoclonal colonies on the plate. Use a sterilized toothpick to pick half of the monoclonal colonies and perform colony PCR according to the following system and procedure. Pick the area on the plate where no colonies have grown and perform the same operation as a negative control. Then, use 1% agarose gel electrophoresis to select colonies with the correct band size. Pick the other half of the colonies for shaking culture. Send the bacterial solution for sequencing. After correct sequencing, extract the plasmid and perform the LR reaction using ThermoFisher (11791020). Also perform colony PCR identification and sequencing confirmation. Identify the vector in which the nucleotide sequence of SEQ ID No.1 is inserted in the forward direction into pk7FWG2-EGFP, which is the constructed recombinant plasmid pk7FWG2-35S-ER2-EGFP.

[0072] Example 3: Transformation of Agrobacterium tumefaciens GV3101 with maize pk7FWG2-35S-ER2-EGFP

[0073] Transform Agrobacterium competent cells: Take out Agrobacterium competent cells GV3101 from the -80°C refrigerator, melt them on ice. Add 2 μL of plasmid to 25 μL of competent cells, gently mix. Incubate in an ice-water bath for 10 min, quick-freeze in liquid nitrogen for 5 min, incubate at 37°C for 5 min, and then place on ice for 5 min. Under sterile conditions, add 1 ml of LB medium without resistance and culture in a 28°C incubator for 90 min. Centrifuge at 8000 rpm for 1 min, discard the supernatant, and leave 100 μL to coat the plate on the medium with resistance. Incubate inverted at 28°C for 2 - 3 days. Pick colonies after 2 days and perform colony PCR verification. Inoculate Agrobacterium single colonies into 5 mL of LB medium with resistance and culture in a 28°C incubator at 200 rpm for about 36 h, and verify the band size by colony PCR.

[0074] Example 4: Knockout of the ZmER2 gene by the CRISPR method

[0075] Confirm the gene transcript on the maizeGDB website. Design the target site through the website crisprP2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Select the snoRNA promoter as U6, the guide length as 20, select the maize genome, fill in the gene number Zm00001d018261, and submit. Screen again, select the guide sequence starting with G, and then select the one with a high On score and a low off score among all the given guide sequences. At the same time, select the position in the coding (CDS) region and preferably in the important functional domain region of 1 / 3 - 2 / 3 of the protein. The present invention found multiple gene editing types and selected two of them, Zmer2-D17 and Zmer2-I1, for phenotypic analysis.

[0076] The CDS nucleotide sequence of the above mutant Zmer2-D17 is shown in SEQ ID No. 3, and the amino acid sequence of this gene is shown in SEQ ID No. 4. The CDS nucleotide sequence of the mutant Zmer2-I1 is shown in SEQ ID No. 5, and the amino acid sequence of this gene is shown in SEQ ID No. 6.

[0077] Example 5: Observation of Maize Pollen Morphology by Scanning Electron Microscope

[0078] 1) Sampling: Take samples about 1 mm3 in size, cut with a sharp blade, and avoid pulling to prevent mechanical damage.

[0079] 2) Fixation: Quickly add 2.5% glutaraldehyde (prepared with 1X PBS) and fix in a 4°C refrigerator for 3 h (the time can be adjusted according to the sample size), then remove the supernatant. Then wash three times with 1X PBS, 15 min each time, remove the supernatant. If the plant sample floats, it can be solved by pumping.

[0080] 3) Dehydration: Dehydrate the samples with ethanol aqueous solutions at concentration gradients of 30%, 50%, 70%, 80%, and 90%, about 15 min for each step, discard the supernatant, and then dehydrate in 100% ethanol for 15 min, twice.

[0081] 4) Drying with a critical point dryer: Transfer the samples to a sample basket and dry them in a critical point dryer.

[0082] 5) After that, sputter the samples with gold using an ion sputtering instrument and then observe.

[0083] The present invention finds that under a scanning electron microscope, compared with the wild type, the pollen morphology of the mutant Zmer2 becomes shriveled.

[0084] Example 6: Determination of Pollen Viability Using Iodine-Potassium Iodide

[0085] First, prepare the iodine-potassium iodide solution: Dissolve 1.3 g of potassium iodide in water, then add 0.3 g of iodine crystals, and then make up the volume to 100 mL; Take a small amount of pollen and place it on a clean glass slide, drop 2 drops of iodine-potassium iodide solution, and observe under a microscope. Since most normal mature pollen grains of plants are spherical and accumulate more starch, the I2-KI solution can stain them dark blue. Underdeveloped pollen is often deformed and usually contains little or no starch, and the I2-KI solution stains it yellowish-brown. In the present invention, using iodine-potassium iodide staining, the wild-type pollen is in a normal state and can be stained dark blue by iodine-potassium iodide, while the pollen of the mutant is yellow, indicating that the pollen has no viability.

Claims

1. A maize receptor-like kinase encoding gene ZmER2, Characterized in that: The CDS nucleotide sequence of the gene ZmER2 is shown in SEQ ID No.1, and the amino acid sequence of this gene is shown in SEQ ID No.

2.

2. A recombinant expression vector containing the gene ZmER2 according to claim 1.

3. The recombinant expression vector according to claim 2, Characterized in that: The receptor vector used for the recombinant expression vector is pk7FWG2-EGFP, and the recombinant expression vector contains the complete open reading frame (ORF) sequence shown in SEQ ID No.1 in claim 1.

4. The recombinant expression vector according to claim 3, Characterized in that: The recombinant expression vector is the recombinant plasmid pk7FWG2-35S-ER2-EGFP containing the receptor-like kinase encoding gene ZmER2.

5. The application of the maize receptor-like kinase encoding gene ZmER2 according to claim 1 in pollen fertility.

6. A mutant Zmer2-D17, Zmer2-I1 containing the gene ZmER2 according to claim 1, Characterized in that: The crop is maize; the CDS nucleotide sequence of the mutant Zmer2-D17 is shown in SEQ ID No.3, the amino acid sequence of this gene is shown in SEQ ID No.4, the CDS nucleotide sequence of the mutant Zmer2-I1 is shown in SEQ ID No.5, and the amino acid sequence of this gene is shown in SEQ ID No.

6.

7. The application of the maize mutant containing the gene ZmER2 according to claim 6 in regulating pollen activity and in breeding.

Images