Gene ZmER1 for regulating and controlling corn plant height and meristem and application of gene ZmER1

Abstract

The invention discloses a gene ZmER1 coded by a corn receptor kinase. The CDS (Coding Sequence) of the gene is shown as SEQ ID No.1. The invention also discloses a preparation method of the gene ZmER1. The CDS nucleotide sequence of the gene mutant Zmer1-I1 is as shown in SEQ ID No.3, the amino acid sequence of the gene is as shown in SEQ ID No.4, the CDS nucleotide sequence of the mutant Zmer1-D8 is as shown in SEQ ID No.5, and the amino acid sequence of the gene is as shown in SEQ ID No.6. The invention further discloses a preparation method of the gene. The invention also discloses phenotypes in the aspects of reducing the height of stem tip meristem and increasing the size of female ear inflorescence meristem after mutation of the receptor kinase coded gene ZmER1, which indicate that the ZmER1 gene has a good application prospect in the aspects of cultivating a new semi-dwarf variety resistant to close planting and increasing the row number of corn ears.

Description

Technical Field

[0001] The present invention belongs to the technical fields of plant bioengineering breeding and molecular biology. Specifically, it relates to the role of a receptor-like kinase gene ZmER1 in regulating maize plant height and meristem, as well as its application in cultivating semi-dwarf new varieties resistant to high planting density and increasing the number of kernel rows. Background Art

[0002] Maize (Zea mays), as an important food and feed crop and one of the three major crops, with the growth of the world's population and economy, the reduction of arable land area and the limitation of crop structure adjustment and other factors, improving the yield per unit area of maize is the fundamental way to ensure maize production in China. In the past few decades, maize yield has shown a linear growth and an increasing trend. The increase in maize yield is largely due to the cultivation of high-density hybrids. However, high-density planting may intensify the competition for resources (such as light, water, and nutrients) among plants, thereby reducing the resistance of maize to biotic and abiotic stresses and increasing the risk of severe lodging. More and more studies have shown that plant height is a key factor. In rice and wheat breeding, the SD1 and Rht1 genes that promoted the "Green Revolution" have been widely applied. Therefore, in the maize crop architecture that affects plant density, the genetic improvement of plant height is one of the important contents that breeders should pay attention to in modern breeding.

[0003] In addition, the development of the maize inflorescence meristem is closely related to yield traits. The key regulatory genes in its development pathway are important targets for the genetic improvement of yield traits. Rational molecular design of them can cultivate new high-yield varieties.

[0004] The meristem of plants has stem cell activity and is the basis for the formation of all organs. The above-ground part of the maize plant originates from the shoot apical meristem (SAM) of maize. The shoot apical meristem promotes the vertical growth of maize and forms axillary meristems and leaf primordia. During the transition of maize from the vegetative stage to the reproductive stage, the shoot apical meristem and axillary meristems are respectively transformed into the male and female inflorescence meristems (IM) of maize, and the latter is the basis for the formation of maize ears. The female inflorescence meristem differentiates into a multi-row, neatly arranged pair of spikelet pair meristems (SPM). Each pair of spikelet meristems further differentiates into two spikelet meristems (SM). Each spikelet meristem finally undergoes the differentiation of floral meristems (FM) and floral organs to form female florets, which develop into grains after fertilization. Figure 1A). Research shows that the maize inflorescence meristem is the basis for the formation of the maize ear, and its size is significantly positively correlated with the number of kernel rows on the maize ear ( Figure 1 B). As one of the important factors affecting maize yield formation, the number of kernel rows directly affects the yield formation of maize. The development of gene editing technology provides the possibility for rapid and effective molecular design of developmental regulatory genes, showing broad application prospects in improving crop yield traits. The latest research published online in Nature Plants shows that by regulating the promoter region of the small peptide gene ZmCLE7 in the development of the inflorescence meristem through CRISPR gene editing, the activity of the inflorescence meristem and the number of kernel rows on the maize ear can be increased, achieving an increase in maize yield. After retrieval, there is no report on the maize receptor kinase gene ZmER1 and its application in regulating maize plant type and the size of the meristem. Summary of the Invention

[0005] In view of the current research status, the object of the present invention is to provide a receptor-like kinase gene ZmER1 and its application in regulating plant height and the size of the meristem.

[0006] The maize receptor-like kinase gene ZmER1 of the present invention is located on chromosome 6. There is no relevant report on the function of the maize ZmER1 gene. This gene encodes a leucine-rich repeat receptor-like kinase (LRR-RLK), which has an extracellular LRR domain, an intracellular kinase domain, a single transmembrane structure, and an intracellular kinase domain. It is characterized in that: the CDS nucleotide sequence of the gene ZmER1 is shown in SEQ ID No.1, and its protein coding sequence is shown in SEQ ID No.2, regardless of the gene cloning method.

[0007] In view of the fact that those skilled in the art can easily modify or mutate the nucleotide sequence of the gene described in this invention patent through methods such as directed optimization or point mutation, those nucleotide sequences that have a homology of ≧85% with the CDS sequence of the gene provided by the present invention and still have the function of this gene after artificial modification are all sequence derivatives of the gene described in the present invention, equivalent to the sequence described in the present invention, and belong to the protection scope of this patent.

[0008] The present invention discloses two mutants of the receptor-like kinase gene ZmER1, including mutants Zmer1-I1 and Zmer1-D8, with an insertion of a T base in exon 12 and a deletion of 8 bases in exon 25, resulting in premature termination of translation. The CDS nucleotide sequence of the Zmer1-I1 mutation is shown in SEQ ID No.3, and the amino acid sequence of this gene is shown in SEQ ID No.4. The CDS nucleotide sequence of the Zmer1-D8 mutation is shown in SEQ ID No.5, and the amino acid sequence of this gene is shown in SEQ ID No.6.

[0009] The present invention also discloses an expression vector containing the above-mentioned receptor-like kinase gene ZmER1.

[0010] Among them: the receptor vector used for the expression vector is pk7FWG2-EGFP, and the recombinant expression vector contains the complete open reading frame (ORF) sequence shown in SEQ ID No.1 above.

[0011] The present invention provides two non-naturally occurring maize mutation sites within the ZmER1 gene, where the mutations are substitutions, insertions, deletions or transversions introduced using an editing system.

[0012] The present invention provides a method for generating / cultivating an edited maize plant without transgenes, including: crossing the maize plant of the present invention with a wild-type maize plant to introduce the at least one non-natural mutation into the wild-type maize plant; and selecting the progeny maize plants containing the at least one non-natural mutation and without transgenes, thereby generating an edited maize plant without transgenes.

[0013] The present invention provides a maize plant showing reduced plant height and larger meristems, and discloses the application of the above-mentioned receptor-like kinase gene ZmER1 in controlling plant height and regulating meristems.

[0014] Compared with the prior art, the present invention can achieve the following technical effects:

[0015] 1) The present invention cloned a new gene ZmER1 encoding a receptor-like protein that regulates maize plant height and meristem size, and simultaneously obtained mutants Zmer1-I1 and Zmer1-D8 with different mutation types of this gene. It was clarified that different types of variations in the ZmER1 gene would lead to reduced plant height and flattened female inflorescences, and this gene can be used for crop plant type improvement.

[0016] 2) The present invention analyzed the changes in the agronomic characteristics of wild-type plants and mutants: phenotypes such as plant height, ear height, ear leaf size, internode length, ear meristem size, and ear row number.

[0017] 3) The present invention has identified the receptor-like kinase ZmER1 gene in maize. Genome-wide association analysis has found that the ZmER1 gene has an obvious correlation with traits such as the number of kernel rows and the diameter of the female ear in maize. Detecting the expression patterns of genes in the ZmER1 family in different regions of the shoot apical meristem (SAM) lays a foundation for revealing the molecular mechanism of the ZmER1 gene in the development of stem cell tissues.

[0018] 4) Identify the function of the receptor-like kinase ERECTA family gene ZmER1 in maize in plant height control and meristem development, thereby revealing a new genetic basis for the formation of maize yield-related traits. At the same time, it also provides a theoretical basis and genetic targets for enhancing the plant's tolerance to high density and lodging resistance and increasing the number of kernel rows.

[0019] Of course, it is not necessary for any product implementing the present invention to achieve all the above-mentioned technical effects simultaneously. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : The development of the maize meristem in the background technology can regulate the development of the number of kernel rows. Among them, A is the development process of the inflorescence meristem; B shows the relationship between the size of the maize inflorescence meristem and the number of kernel rows in maize.

[0021] Figure 2 : Association analysis of the number of kernel rows and the diameter of the female ear of maize ZmER1.

[0022] Figure 3 : Protein structure diagram of maize ZmER1 in the present invention.

[0023] Figure 4 : Sequencing of the mutant Zmer1 variation site and its allelic variation site in the present invention. Among them, A represents the sequencing result of Zmer1-I1; B represents the sequencing result of Zmer1-D8.

[0024] Figure 5 : Is the phenotype of the Zmer1 mutant in the present invention; among them, the phenotypes of the plant (A), the ear height (B) and the ear leaf (C) are compared. The left side of each picture is the wild type, and the right side is the mutant Zmer1-I1; D represents the comparison of internode length, and the asterisk indicates a statistically significant difference between the wild type and the mutant, ****P < 0.0001.

[0025] Figure 6 : Is the comparison of the size of the shoot apical meristem in the present invention. A is the wild type; B is Zmer1-I1, and the asterisk indicates a statistically significant difference between the wild type and the mutant, **P < 0.01.

[0026] Figure 7: Comparison of the sizes of inflorescence meristems in the present invention. A is the wild type; B is Zmer1-I1. C and D are scanning electron microscope images of the phenotypic difference parts between the wild type and the mutant, respectively. Asterisks indicate a statistically significant difference between the wild type and the mutant, **P < 0.05.

[0027] Figure 8 : Comparison of the number of kernel rows in immature ears in the present invention. A is the wild type; B is Zmer1-I1. Asterisks indicate a statistically significant difference between the wild type and the mutant, *P < 0.05.

[0028] Figure 9 : Schematic diagram of the plant expression vector pk7FWG2-35S-ER1-EGFP of the present invention.

[0029] Figure 10 : Colony PCR identification result after the ZmER1 ORF sequence of the present invention is ligated into the pk7FWG2-EGFP plasmid;

[0030] Among them, M: molecular weight marker DL5000; Lanes 1 and 2 are positive Escherichia coli in which the ZmER1 ORF sequence has been ligated into the pk7FWG2-EGFP plasmid.

[0031] Figure 11 : Analysis of the ZmER1 expression pattern in the present invention. A is the subcellular localization of ZmER1 in tobacco; B is the expression pattern of ZmER1 in all meristems in the present invention. C is the in-situ expression of ZmER1 in the present invention, showing the expression detection in the shoot apical meristem. Detailed implementation methods

[0032] The present invention will be further described below through specific examples. However, the following examples are only the preferred implementation methods of the present invention, and do not limit the present invention in any form. Any simple modification, equivalent change and modification made to the implementation method according to the technical essence of the present invention all fall within the scope of the technical solution of the present invention.

[0033] Unless otherwise specified, the method content in the following examples is all conventional experimental methods. Unless otherwise specified, the reagents, vectors, and strains involved are all obtained from well-known sales channels.

[0034] Example 1: Genotype identification of mutants

[0035] Retrieve the genomic sequence of this gene from the MaizeGDB database (https: / / www.maizegdb.org / ) according to the sequence number Zm00001d037114 of the ZmER1 gene. After the maize germinates, extract the leaf DNA, design primers at both ends of the knockout position, amplify, and use the DNAMAN software to design two pairs of PCR amplification primers:

[0036] Primer 1:

[0037] The upstream primer is 5'ATGCATTCTTTGCCACTCCT 3';

[0038] The downstream primer is 5'TAACCTGTTGCCTTGCATGT 3'

[0039] Primer 2:

[0040] The upstream primer is 5'CCAAGCTGGTGATCCTTCAT 3';

[0041] The downstream primer is 5'CCTTCGCCAAAACATCAACT 3'

[0042] The first-generation plants obtained by knockout are confirmed for base insertion and deletion through first-generation sequencing. Subsequently, dCAPs primers can be designed through the website (http: / / indcaps.kieber.cloudapps.unc.edu / ) to identify genotypes. Select 2 different alleles for planting. In subsequent generations, genotypes can be identified by designing dCAPs primers.

[0043] Example 2: Cloning of the maize receptor-like kinase gene ZmER1

[0044] Retrieve the cDNA sequence of this gene from the MaizeGDB database (https: / / www.maizegdb.org / ) according to the sequence number of the ZmER1 gene for primer design and screening for the cloning of this gene.

[0045] The recombinant expression vector is the recombinant plasmid pk7FWG2-35S-ER1-EGFP containing the receptor-like kinase gene ZmER1. Its construction method is: design gene amplification primers according to the Gateway instruction manual, amplify the inserted fragment, use the cDNA of the shoot apical meristem of B73 as the template, and perform PCR according to the amplification system and amplification procedure of the P505 Novazyme reagent instruction manual.

[0046] PCR reaction system:

[0047]

[0048]

[0049] PCR reaction procedure: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 3 min, with 36 cycles; extension at 72°C for 10 min.

[0050] The obtained PCR products were purified using the D2500-02 Omega agarose gel recovery kit, and the concentration of the purified PCR products was measured; after purification, the PCR products were subjected to BP reaction according to ThermoFisher (11789100), and the amount of the required PCR products was calculated according to the following formula:

[0051] Product ng = (X fmoles)(N)(660 fg / fmoles)(1 ng / 10 6 fg)

[0052] Transform competent cells, perform colony PCR the next day, label monoclonal colonies on the plate, pick half of the monoclonal colonies with a sterilized toothpick and perform colony PCR according to the following system and procedure, pick the uncolony-growing part on the plate and perform the same operation as a negative control. Then, use 1% agarose gel electrophoresis to select colonies with the correct band size, pick the other half of the colonies for shaking culture, send the bacterial solution for sequencing, extract the plasmid after correct sequencing, perform LR reaction according to ThermoFisher (11791020), and perform colony PCR identification and sequencing confirmation in the same way. It was identified that the vector with the forward connection of the nucleotide sequence of SEQ ID No.1 into pk7FWG2-EGFP was the constructed recombinant plasmid pk7FWG2-35S-ER1-EGFP. Among them,

[0053] Forward primer:

[0054] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGCCTGTGCGCAGCTCAGT-3',

[0055] Reverse primer:

[0056] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTACACCATGTTCTGCGAGATGGC-3'

[0057] The above plant expression vector is characterized in that the vector for exogenous gene expression contains the complete open reading frame (ORF) sequence of the ZmER1 gene.

[0058] Example 3: Agrobacterium-mediated infection of tobacco leaves

[0059] Agrobacterium activation: Add the bacterial solution stored at -80℃ to the LB medium containing resistance and culture it at 28℃, 200rpm for 12 hours. The activated bacterial solution is expanded in the induction medium with resistance and cultured at 28℃, 200rpm until OD=0.6-0.8. Transfer the bacterial solution to a 50mL sterilized centrifuge tube and centrifuge at 3200g for 10min. Discard the supernatant, take 10mL of the permeate to vortex the precipitate, adjust the injection concentration to OD=0.2 with the permeate, and use a 1mL syringe to draw the bacterial solution of OD=0.2 from the back of the tobacco leaf and inject it. After the injection is completed, cover it with a black plastic bag to avoid light and keep it moist. After one night, uncover the plastic bag. Wait for 48h to 72h to observe the subcellular localization using a laser confocal microscope. Using the tobacco transient expression experiment, it was found that ZmER1 is mainly expressed on the cell membrane.

[0060] Example 4: In situ hybridization to detect the expression site of ZmER1 in the shoot apical meristem

[0061] 1) Take the plant material to be hybridized, cut the plant tissue into small pieces of appropriate size, and immediately put it into a glass bottle containing 4-5ml of freshly prepared 4% paraformaldehyde fixative. Vacuum the material so that it is immersed in it (repeatedly vacuum and non-vacuum state, and make sure that the fixative does not boil). When the tissue sinks into the vial, replace it with new pre-cooled fixative and fix it on a shaker at 4℃ overnight, no more than 16h;

[0062] 2) Dehydrate the tissue through a graded alcohol series and embed in wax. All steps are performed in glass vials;

[0063] 3) Rinse the tissue block twice with 1X PBS buffer (pH 7.0) at 4°C, 30 min each time;

[0064] 4) Dehydration with gradient ethanol and xylene under inversion: 30%, 40%, 50%, 60%, 70% (can be saved in this step), 80%, 95%, 100% ethanol, 25% xylene + 75% anhydrous ethanol, 50% xylene + 50% anhydrous ethanol, 75% xylene + 25% anhydrous ethanol, 100% xylene twice, 30 min / time;

[0065] 5) Add paraffin wax gradually to the above materials and incubate at 37°C overnight;

[0066] 6) Melt the wax at 60°C, replace the mixture with the freshly melted wax, and incubate at 60°C. Replace the wax again at night.

[0067] 7) Replace the wax in the morning and evening for two consecutive days. Finally, embed the material for later use.

[0068] 8) Use a microtome to slice into 8um thickness. Bake the slices at 42℃ overnight the day before the experiment;

[0069] Retrieve the cDNA sequence of the ZmER1 gene from the MaizeGDB database (https: / / www.maizegdb.org / ) according to the gene's serial number, and select three sequences with good specificity as probes for ZmER1 synthesis. As follows:

[0070] Primer 1:

[0071] The upstream primer is 5'GCTCCTGGCGCGGCGTCCTG 3';

[0072] The downstream primer is 5'CGCTGTCCTAGATCTGAGTT 3'

[0073] Primer 2:

[0074] The upstream primer is 5'TACAAGTGGCTACACTATCC 3';

[0075] The downstream primer is 5'CTGTGGATATTGGCTTGGTT 3'

[0076] Primer 3:

[0077] The upstream primer is 5'CACATGACAGCTTTTTAGGT 3';

[0078] The downstream primer is 5'AGCCAGTGGACAACGAGTGC 3'

[0079] Designed and synthesized RNA-specific probes, where the anti-sense probe is used to show gene-specific expression, and the sense probe is used as a negative control.

[0080] First, perform tissue pretreatment. Place the slides in a slide rack and proceed through the following steps:

[0081] 1) Immerse the baked slides in 100% xylene twice for dewaxing, 1 min each time:

[0082] 2) Rehydrate with gradient ethanol: 100% twice, 95%, 85%, 70%, 60%, 30%, and water twice, 3 min for each step.

[0083] 3) Wash the slides rehydrated with gradient ethanol in 2xSSC for 15 - 20 min;

[0084] 4) Prepare the proteinase K solution and preheat it at 37°C;

[0085] 5) Place the slides into the Proteinase K solution and digest at 37 °C for 30 min, then terminate the reaction with 1xPBS solution containing 2% glycine for 2 min (room temperature);

[0086] 6) Wash twice with 1xPBS at room temperature for 2 min each time;

[0087] 7) Re-fix with 4% paraformaldehyde at room temperature for 10 min;

[0088] 8) Wash twice with 1xPBS at room temperature for 5 min each time;

[0089] 9) Treat with 0.1 M triethanolamine containing 0.5% acetic anhydride (98.3 ml RNase free H20, 1.3 ml triethanolamine, 0.4 ml concentrated hydrochloric acid, 500 μl acetic anhydride, pH 8.0) for 10 min to remove the positive charges on the protein;

[0090] Return to 100% ethanol through the ethanol series.

[0091] Prepare hybridization buffer (160 μl / slide)

[0092] 140 μl of 10x hybridization salt solution, 560 μl of deionized formamide, 280 μl of 50% dextran sulfate, 28 μl of 50x Dehardts, 14 μl of 100 mg / ml tRNA, 98 μl of Rnase free H20, calculate the required probe (final reaction concentration 1 ng / μl), 40 μl of probe and 160 μl of hybridization solution are needed for each slide. Dilute the probe with water and 50% deionized formamide, denature at 80 °C for 2 min, immediately place on ice for pre-cooling, then add the hybridization buffer, place in a wet box containing the hybridization buffer, and hybridize overnight at 50 °C.

[0093] Post-hybridization treatment

[0094] 1) Prepare 0.2xSSC and NTE solutions and preheat them at 55 °C and 37 °C respectively;

[0095] 2) Gently separate the slides in the 0.2xSSC solution, immediately place them into the preheated 0.2xSSC solution, gently shake at 55 °C for 60 min, and repeat once;

[0096] 3) Gently shake and rinse twice in NTE (2.5 M NaCl, 50 mM Tris pH 8.0, 5 mM EDTA) at 37 °C;

[0097] 4) Add 20 μg / ml RNase to NTE and digest RNA at 37 °C for 30 min;

[0098] 5) Repeat step 3;

[0099] 6) Rinse gently in 0.2x SSC at 55 °C for 1 h with shaking. During this period, prepare blocking buffer (100 mM Tris pH 7.5, 150 mM NaCl, add 1% blocking agent, dissolve at 60 °C) and BSA (100 mM Tris pH 7.5, 150 mM NaCl, 0.3% Triton X-100, add 1% BSA);

[0100] 7) Wash with 1x PBS at room temperature for 5 min;

[0101] 8) Wash with blocking buffer at room temperature for 4 min;

[0102] 9) Wash with BSA at room temperature for 45 min;

[0103] 10) Prepare digoxin antibody (1:1250) with BSA. First, wash the coverslips once with 100 μl of the antibody, then gently sandwich the two coverslips together with a double layer of sealing film in between, add 400 μl of the antibody, place it in a humid chamber, and incubate at room temperature for two hours or overnight at 4 °C;

[0104] Color development after hybridization

[0105] 1) First, blot the antibody with absorbent paper, then wash the coverslips with BSA 4 times at room temperature, 15 min each time;

[0106] 2) Wash with TN solution (100 mM Tris pH 9.5, 100 mM NaCl, 50 mM MgCl2) 3 times at room temperature, 10 min each time;

[0107] 3) Prepare the chromogenic solution NBT / BCIP. Gently sandwich the two coverslips together with a double layer of sealing film in between, add the chromogenic solution between the two coverslips, and develop color in the dark in a humid chamber at room temperature until the signal is clear (color development time is 1 day);

[0108] Observation can be carried out through a microscope later.

[0109] Observed the specific expression pattern of ZmER1 in different meristems. Through in situ hybridization experiments, it was observed that ZmER1 was expressed in the entire shoot apical meristem, and the expression level was the highest in the L1 layer cells. In the RNA transcriptome analysis, the expression level of ZmER1 in the SAM was higher than that in the IM, SM, and SPM.

[0110] Example 5: Analysis of the SAM size of the maize Zmer1-I1 mutant

[0111] By backcrossing ZmER1 CRISPR transgenic plants with wild-type corn B73 three times, the seeds obtained by self-pollination of heterozygous plants were planted, and corn seeds with full grains were selected and planted in pots filled with soil. After the plants germinated, DNA was extracted and genotypes were detected using dCAPs primers. After the genotype results were obtained, wild-type and mutant plants were selected. After 14 days after germination, the plant apical meristems were sampled, fixed with FAA (10% formalin, 5% acetic acid and 45% ethanol) overnight, dehydrated with gradient ethanol, and transparentized with methyl salicylate, and then the SAM size was measured under a microscope. There were about 10 SAMs for each genotype in the experiment. The width and height of the shoot apical meristem (SAM) of the Zmer1-I1 mutant were measured by differential interference microscopy. The results showed that compared with the wild type, the SAM width of the mutant Zmer1-I1 did not change, but the height became shorter, and the ratio of SAM height to width also became smaller. The Zmer1-I1 mutant plants do show a shorter height phenotype when they grow up.

[0112] Example 6: Phenotypic Analysis of Maize Zmer1 Mutants

[0113] In the present invention, the Zmer1 mutant plant height is shorter than the wild type, the ear height is also lower than the wild type, and the internode length is also shorter than the wild type, which is similar to the erecta mutant plant height shortening and the fruit clip length shortening in Arabidopsis, but one of the traits regulating yield, the number of ear rows, increases, indicating that the ZmER1 gene plays an important role in regulating plant height and stem node length.

[0114] In addition, by sampling the inflorescence meristem of plants after 50 days of growth and observing the size of IM under a stereomicroscope, we found that the inflorescence meristem of Zmer1 appeared flattened. Based on the above results, we concluded that ZmER1 in the receptor kinase family plays an important role in regulating plant height, stem node length and meristem development.

[0115] In summary, the present invention identified and cloned the receptor kinase family gene ZmER1, and showed that it affected plant height by affecting internode length of maize, and ear height was reduced. ZmER1 is mainly expressed in the cell membrane, and is also widely expressed in the stem apical meristem and inflorescence meristem, affecting the height of the stem apical meristem and the flattening of the inflorescence meristem, resulting in reduced plant height and increased ear row number. In general, ZmER1 provides a good genetic target for the improvement of maize plant height and the improvement of yield traits such as increased ear row number.

[0116] The foregoing description has shown and described several preferred embodiments of the invention. However, as previously mentioned, it should be understood that the invention is not limited to the forms disclosed herein, should not be regarded as excluding other embodiments, but can be used in various other combinations, modifications, and environments, and can be altered within the scope of the inventive concept described herein through the above teachings or the skills or knowledge in the relevant field. Any alterations and changes made by those skilled in the art that do not depart from the spirit and scope of the invention shall fall within the protection scope of the appended claims of the invention.

Claims

1. A maize receptor-like kinase encoding gene ZmER1, Characterized in that: The CDS nucleotide sequence of the gene ZmER1 is shown in SEQ ID No.1, and the amino acid sequence of this gene is shown in SEQ ID No.

2.

2. A recombinant expression vector containing the gene ZmER1 as claimed in claim 1.

3. The recombinant expression vector as claimed in claim 2, Characterized in that: The receptor vector used for the recombinant expression vector is pk7FWG2-EGFP, and the recombinant expression vector contains the complete open reading frame (ORF) sequence shown in SEQ ID No.1 in claim 1.

4. The recombinant expression vector as claimed in claim 3, Characterized in that: The recombinant expression vector is the recombinant plasmid pk7FWG2-35S-ER1-EGFP containing the receptor-like kinase encoding gene ZmER1.

5. Application of the maize receptor-like kinase encoding gene ZmER1 as claimed in claim 1 in improving maize plant height and increasing the inflorescence meristem to increase the number of kernel rows per ear.

6. Application of the maize receptor-like kinase encoding gene ZmER1 as claimed in claim 1 in increasing the number of kernel rows per ear of maize.

7. A mutant Zmer1-I1, Zmer1-D8 containing the gene ZmER1 as claimed in claim 1, Characterized in that: The crop is maize. The CDS nucleotide sequence of the mutant Zmer1-I1 is shown in SEQ ID No.3, and the amino acid sequence of this gene is shown in SEQ ID No.

4. The CDS nucleotide sequence of the mutant Zmer1-D8 is shown in SEQ ID No.5, and the amino acid sequence of this gene is shown in SEQ ID No.

6.

8. Application of the maize mutant as claimed in claim 7 in causing reduction of maize plant height and increase of the number of kernel rows per ear.

Images