Application of glucosyl modified quercetin derivative and composition containing glucosyl modified quercetin derivative

Abstract

The invention discloses application of a glucosyl modified quercetin derivative and a composition containing the glucosyl modified quercetin derivative. Specifically, the invention discloses an application of glucosyl modified quercetin as an anti-skin photoaging agent. According to the application disclosed by the invention, glucosyl modified quercetin, especially glucosyl modified isoquercitrin, has a remarkable effect in the aspect of resisting skin photoaging; cosmetics prepared from glucosyl modified quercetin have good anti-aging ability, and can significantly improve percutaneous water loss, skin elasticity and skin roughness.

Description

Technical Field

[0001] The present invention relates to the application of glucosyl-modified quercetin derivatives in anti-skin photoaging, and specifically relates to the application of a composition containing glucosyl-modified quercetin derivatives and the composition containing the same. Background Art

[0002] The skin is the largest organ of the body, which provides a barrier and plays an important role in protecting the body from destructive factors such as the external environment and ultraviolet radiation, infectious microorganisms, and harmful chemicals (Kim et al., 2018, Ha et al., 2021). The human skin consists of three layers: the epidermis, the dermis with appendages, and the subcutaneous tissue (Slominski et al., 2013). Human dermal fibroblasts (HDFa) cells located in the dermis of the skin are directly related to the synthesis of skin collagen and elastin, and their viability is closely related to skin wrinkles and skin elasticity (Liu et al., 2022).

[0003] The inducements of skin aging can be divided into two parts: endogenous and exogenous. The endogenous inducement is the inevitable generation of free radicals during cell metabolism, which attack cell organelles and genetic materials, resulting in potential cell damage. The exogenous inducement is caused by environmental factors such as ultraviolet rays, air pollution, life stress, and irregular work and rest (Bonete et al., 2019). Ultraviolet radiation is the most important factor in exogenous aging, which can cause skin damage, wrinkles, and hyperpigmentation, and is considered one of the most difficult risk factors to review (Rittie and Fisher, 2002). Ultraviolet rays can photoexcite a series of endogenous and exogenous molecules in the skin, leading to the formation of ROS (Sies et al., 2017), stimulating collagen degradation, resulting in fragmented and disordered collagen, inhibiting procollagen biosynthesis, and causing a loss of collagen content (Quan et al., 2009). The collagen content in the skin is closely related to skin aging (Krutmann et al., 2017). If the collagen content in adult skin decreases, the strength and stability of the collagen framework will decrease, and the skin elasticity will decline. When the collagen scaffold loses its strength and stability, the biological matrix of the skin begins to collapse [(Cole et al., 2018), and the external manifestations of skin aging are wrinkles caused by collagen loss, decreased skin elasticity, and increased transepidermal water loss caused by the weakening of the skin barrier (Dini and Laneri, 2021).

[0004] Flavonoids represented by quercetin and its derivatives are the main active components of many Chinese herbal medicines, and generally have various activities such as anti-inflammatory, antibacterial, antiviral, antioxidant, anti-tumor, anti-radiation and immunomodulation (Rayman, 2000; Kook et al., 2008; Boots et al., 2008). In addition, relevant studies on the resistance of rutin and isoquercitrin to skin aging have also been published (Lee et al., 2021; Jo et al., 2022; Martins et al., 2020). However, due to its very poor solubility in common solvent systems used in cosmetics, such as water, ethanol and oils, its application in the cosmetics field is limited. The solubility of enzymatically modified isoquercitrin (EMIQ) has been significantly improved compared with rutin and isoquercitrin. At present, there is no report on the research of enzymatically modified isoquercitrin in resisting skin aging caused by ultraviolet radiation. Summary of the Invention

[0005] The technical problem to be solved by the present invention is that the application fields of glucosyl-modified quercetin, especially enzymatically modified isoquercitrin (EMIQ) in the prior art are relatively single. Therefore, the present invention provides the application of glucosyl-modified quercetin and a composition containing the same. The present invention discovers that glucosyl-modified quercetin, especially enzymatically modified isoquercitrin, has a significant effect on anti-skin photoaging; the cosmetics prepared with glucosyl-modified quercetin have good anti-aging ability and can significantly improve transepidermal water loss, skin elasticity and skin roughness.

[0006] The present invention provides an application of a glucosyl-modified quercetin as an anti-skin photoaging agent.

[0007] In a preferred embodiment, the anti-skin photoaging agent is an anti-skin ultraviolet aging agent.

[0008] In a preferred embodiment, the anti-skin photoaging agent is an anti-aging agent related to the expression of MMP1 and / or Smad7 genes; preferably, the aging related to the expression of MMP1 and / or Smad7 genes is human dermal fibroblast aging.

[0009] In a preferred embodiment, the anti-skin photoaging agent is a cosmetics for anti-skin photoaging; preferably, it is a cosmetics for anti-skin ultraviolet aging.

[0010] In a preferred embodiment, the active ingredient or the only active ingredient in the glucose-modified quercetin is isoquercitrin (IQ), enzymatically modified isoquercitrin (EMIQ), or a mixture composed of isoquercitrin and enzymatically modified isoquercitrin; preferably, the active ingredient or the only active ingredient in the glucose-modified quercetin is enzymatically modified isoquercitrin.

[0011] In a preferred embodiment, the active ingredient or the only active ingredient in the glucose-modified quercetin contains enzymatically modified isoquercitrin.

[0012] In a preferred embodiment, the enzymatically modified isoquercitrin is the enzymatically modified isoquercitrin shown in Formula II,

[0013]

[0014] wherein n is selected from one or more of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11.

[0015] In a preferred embodiment, among the n in the enzymatically modified isoquercitrin shown in Formula II, the "more than one" refers to 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 (the "more than one" means a combination of 2 or more n. For example, when there are 3 n's, it can be any combination of three n's, including but not limited to the combination of n being 1, 2, and 3 respectively).

[0016] In a preferred embodiment, in the enzymatically modified isoquercitrin shown in Formula II, n is at least 3. For example, n is at least 1, 2, and 3; or, n is at least 1, 2, 3, 4, 5, and 6; or, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11.

[0017] In a preferred embodiment, the glucose-modified quercetin includes isoquercitrin and enzymatically modified isoquercitrin; in the glucose-modified quercetin, the sum of the mass percentages of isoquercitrin and enzymatically modified isoquercitrin is 20%-100%; for example, 50%-80%; or, 70%-80%; or, more specifically, 74%, 75%, or 78%.

[0018] In a preferred embodiment, the glucose-modified quercetin includes isoquercitrin and the enzymatically modified isoquercitrin shown in Formula II.

[0019] In a certain preferred embodiment, in the glucose group-modified quercetin (calculated with the total molar mass of isoquercitrin and the glucose group-modified isoquercitrin being 100%), the molar percentage of isoquercitrin is 0-30%, such as 10-30%; for another example, 20%, 22%, 25% or 26%.

[0020] In a certain preferred embodiment, in the glucose group-modified quercetin (calculated with the total molar mass of isoquercitrin and the glucose group-modified isoquercitrin being 100%), the molar percentage of the component with n = 1 is 10-25%; such as 17%, 18% or 19%;

[0021] In a certain preferred embodiment, in the glucose group-modified quercetin (calculated with the total molar mass of isoquercitrin and the glucose group-modified isoquercitrin being 100%), the molar percentage of the component with n = 2 is 10-25%; such as 14%, 15%, 17% or 19%.

[0022] In a certain preferred embodiment, in the glucose group-modified quercetin (calculated with the total molar mass of isoquercitrin and the glucose group-modified isoquercitrin being 100%), the molar percentage of the component with n = 3 is 10-25%; such as 11% or 12%.

[0023] In a certain preferred embodiment, the glucose group-modified quercetin includes the isoquercitrin and the glucose group-modified isoquercitrin shown in Formula II; wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11; in the glucose group-modified quercetin, the sum of the mass percentages of the isoquercitrin and the glucose group-modified isoquercitrin is 70%-80%;

[0024] Calculated with the total molar mass of isoquercitrin and the glucose group-modified isoquercitrin being 100%, in the glucose group-modified quercetin, the molar percentage of the isoquercitrin is 10-30%; the molar percentage of the component with n = 1 is 10-25%; the molar percentage of the component with n = 2 is 10-25%; the molar percentage of the component with n = 3 is 10-25%.

[0025] In a certain preferred embodiment, in the glucose group-modified quercetin, the average value of n is 2-6, such as 2.8.

[0026] In a certain preferred embodiment, the glucose group-modified isoquercitrin shown in Formula II is prepared by the following method, and the method includes the following steps:

[0027] Step (1): In water, perform an inclusion reaction on isoquercitrin and β-cyclodextrin, and then perform drying to obtain a β-cyclodextrin-isoquercitrin inclusion complex;

[0028] Step (2): In water, in the presence of an enzyme and calcium chloride, subject the β-cyclodextrin isoquercitrin inclusion complex obtained in step (1) to a glycosylation reaction with maltodextrin to obtain the glucose-modified isoquercitrin;

[0029] In step (1), the volume-mass ratio of the water to the isoquercitrin is (100 - 300) mL / g;

[0030] In step (1), the mass ratio of the β-cyclodextrin to the isoquercitrin is (2 - 4):1;

[0031] In step (1), the temperature of the inclusion reaction is 70°C - 85°C;

[0032] In step (2), the volume-mass ratio of the water to the isoquercitrin is (100 - 300) mL / g;

[0033] In step (2), the enzyme is cyclodextrin glycosyltransferase (CGTase) or α-amylase having cyclodextrin glycosyltransferase activity;

[0034] In step (2), the mass ratio of the enzyme to the isoquercitrin is (0.2 - 0.7):1,

[0035] In step (2), the mass ratio of the maltodextrin to the isoquercitrin is (1 - 3):1,

[0036] In step (2), the mass ratio of the calcium chloride to the isoquercitrin is (0.01 - 0.05):1;

[0037] In step (2), the temperature of the glycosylation reaction is 50°C - 60°C.

[0038] In a certain preferred embodiment, in step (1), the volume-mass ratio of the water to the isoquercitrin is 100 mL / g.

[0039] In a certain preferred embodiment, in step (1), the mass ratio of the β-cyclodextrin to the isoquercitrin is 2:1.

[0040] In a certain preferred embodiment, in step (1), the temperature of the inclusion reaction is 70°C or 80°C.

[0041] In a certain preferred embodiment, in step (1), the time of the inclusion reaction is 2 h - 30 h, such as 4 h - 20 h; for example, 4 h, 8 h or 16 h.

[0042] In a certain preferred embodiment, in step (1), the drying is vacuum drying, for example, drying with a rotary evaporator.

[0043] In a preferred embodiment, in step (1), the drying temperature is 30°C - 70°C, such as 50°C - 65°C; for another example, 55°C.

[0044] In a preferred embodiment, in step (2), the volume-to-mass ratio of water to isoquercetin is 100 mL / g.

[0045] In a preferred embodiment, in step (2), the α-amylase having cyclodextrin glucosyltransferase activity is α-amylase G "Amano" L.

[0046] In a preferred embodiment, in step (2), the mass ratio of cyclodextrin glucosyltransferase to isoquercetin is 0.2:1 or 0.5:1.

[0047] In a preferred embodiment, in step (2), the mass ratio of maltodextrin to isoquercetin is 1:1 or 2:1.

[0048] In a preferred embodiment, in step (2), the mass ratio of calcium chloride to isoquercetin is 0.02:1.

[0049] In a preferred embodiment, in step (2), the temperature of the glycosylation reaction is 55°C.

[0050] In a preferred embodiment, in step (2), the progress of the glycosylation reaction ends when there is no insoluble matter; preferably, the time of the glycosylation reaction is 12 - 20 h, such as 12 - 18 h, for another example, 15 h.

[0051] After the glycosylation reaction, a post-treatment step may further be included. Preferably, the post-treatment includes one or more of the following steps: decolorization, suction filtration, membrane filtration, concentration, and drying;

[0052] The decolorization may be decolorization by adsorption with activated carbon;

[0053] The temperature of the decolorization may be 30°C - 90°C, such as 50°C - 85°C; for another example, 60°C, 70°C, or 80°C;

[0054] The time of the decolorization may be 1 - 2 h, such as 1 h;

[0055] The membrane filtration may be ultrafiltration membrane filtration; for example, the cut-off molecular weight of the ultrafiltration membrane is 3000.

[0056] The present invention provides an application of the glucose-modified quercetin as described in any one of the present invention in the preparation of an MMP1 and / or Smad7 gene expression inhibitor.

[0057] The present invention provides an application of a glucosyl-modified quercetin as described in any one of the present invention in resisting skin aging related to the expression of MMP1 and / or Smad7 genes.

[0058] In a preferred embodiment, the skin aging related to the expression of MMP1 and / or Smad7 genes is the aging of human dermal fibroblasts.

[0059] The present invention provides a cosmetic for resisting skin photoaging, which comprises 0.05%-1% by mass of the glucosyl-modified quercetin as described in any one of the present invention, and the mass percentage is calculated based on the mass of the cosmetic being 100%.

[0060] In a preferred embodiment, in the cosmetic for resisting skin photoaging, the mass percentage of the glucosyl-modified quercetin is 0.05%, 0.1%, 0.35%, 0.5% or 1%.

[0061] In a preferred embodiment, in the cosmetic for resisting skin photoaging, the mass percentage of the glucosyl-modified quercetin is 0.1%-0.5%.

[0062] In a preferred embodiment, in the cosmetic, the cosmetic further comprises excipients or active ingredient B, and the active ingredient B is not the glucosyl-modified quercetin.

[0063] The excipients are conventional excipients in the cosmetic field. Preferably, the excipients are selected from one or more of solvents, thickeners, emulsifiers, co-emulsifiers, emollients, humectants, pH regulators, chelating agents and antioxidants; more preferably, the excipients are selected from the following Scheme 1, Scheme 2 or Scheme 3:

[0064] Scheme 1: The excipient is a solvent;

[0065] Scheme 2: The excipients are a solvent, a thickener, an emollient, an antioxidant, a humectant and a chelating agent;

[0066] Scheme 3: The excipients are a solvent, a thickener, an emollient, an antioxidant, a humectant, an emulsifier, a co-emulsifier and a pH regulator;

[0067] Scheme 4: The excipients are a solvent, a thickener, an emollient, an antioxidant, a humectant, an emulsifier, a co-emulsifier, a pH regulator and a chelating agent.

[0068] In a preferred embodiment, the solvent is water or a buffer solution, and the buffer solution can be a PBS buffer solution with a pH value of 7.4.

[0069] In a preferred embodiment, the thickener is selected from acrylic acids and / or acrylates and C 10-30One or more of alkanol acrylate cross - polymer, Sphingomonas ferment extract, isoeicosane, and polysorbate - 80. Preferably, the acrylic acid and / or acrylate and C 10-30 The alkanol acrylate cross - polymer is sodium acrylate / sodium acryloyldimethyl taurate copolymer;

[0070] More preferably, the thickener is selected from the following options:

[0071] Option 1: Composed of Sphingomonas ferment extract, sodium acrylate / sodium acryloyldimethyl taurate copolymer, isoeicosane, and polysorbate - 80; for example, composed of Kelco - Care TM Diet gum (KELCO - CARE(TM)DIUTANGUM) and Simulgel EG emulsifier; the mass ratio of Kelco - Care TM Diet gum and Simulgel EG emulsifier is 1:40;

[0072] Option 2: Composed of Sphingomonas ferment extract and sodium acrylate / sodium acryloyldimethyl taurate copolymer; for example, composed of Kelco - Care TM Diet gum and Ultrez 20 polymer (CARBOPOL ULTREZ20POLYMER); the mass ratio of Kelco - Care TM Diet gum and Ultrez 20 polymer can be 1:3.

[0073] Option 3: Sodium acrylate / sodium acryloyldimethyl taurate copolymer, for example Ultrez 20 polymer.

[0074] In a certain preferred option, the emollient is selected from one or more of polydimethylsiloxane, polydimethylsiloxanol, shea butter, squalane, cocoa seed butter, and caprylic / capric triglyceride. Preferably, the emollient is selected from the following options:

[0075] Option 1: Composed of shea butter, polydimethylsiloxane, and polydimethylsiloxanol; the polydimethylsiloxane and polydimethylsiloxanol can be SiCare 9243; the mass ratio of shea butter to SiCare 9243 can be 1:7.5.

[0076] Solution 2: It consists of squalane, shea butter, polydimethylsiloxane, and polydimethylsiloxanol; the polydimethylsiloxane and polydimethylsiloxanol can be SiCare 9243, and the mass ratio of squalane, shea butter, and SiCare 9243 can be 1:0.5:1.

[0077] Solution 3: It consists of shea fruit butter, caprylic / capric triglyceride, polydimethylsiloxane, and polydimethylsiloxanol; the polydimethylsiloxane and polydimethylsiloxanol can be composed of SiCare 9243 and XIAMETER PMX-200 Silicone Fluid 100cSt; the mass ratio of shea fruit butter, caprylic / capric triglyceride, SiCare 9243, and XIAMETER PMX-200 Silicone Fluid 100cSt can be 1:0.33:1:0.67.

[0078] In a certain preferred embodiment, the antioxidant is butylated hydroxytoluene and / or p-hydroxyacetophenone. Preferably, the antioxidant is selected from the following solutions:

[0079] Solution 1: It is p-hydroxyacetophenone.

[0080] Solution 2: It consists of butylated hydroxytoluene and p-hydroxyacetophenone.

[0081] In a certain preferred embodiment, the humectant is selected from one or more of glycerin, 1,2-hexanediol, and 1,3-propanediol. Preferably, the humectant is selected from the following solutions:

[0082] Solution 1: It consists of 1,2-hexanediol and glycerin.

[0083] Solution 2: It consists of 1,2-hexanediol and 1,3-propanediol.

[0084] In a certain preferred embodiment, the emulsifier is cetearyl olivate and / or sorbitan olivate; preferably, the emulsifier consists of cetearyl olivate and sorbitan olivate, such as Olivem1000.

[0085] In a certain preferred embodiment, the co-emulsifier is cetearyl alcohol.

[0086] In a certain preferred embodiment, the pH regulator is triethanolamine.

[0087] In a certain preferred embodiment, the chelating agent is disodium ethylenediaminetetraacetate (EDTA disodium) or citric acid.

[0088] In a preferred embodiment, the anti-skin photoaging cosmetic comprises a solvent and the glucosyl-modified quercetin as described above, and the mass percentage of the glucosyl-modified quercetin is 0.05% - 1%.

[0089] In a preferred embodiment, the anti-skin photoaging cosmetic comprises the following components in mass percentage: 70% - 98% of a solvent, 0.05% - 1% of glucosyl-modified quercetin, 0.05% - 0.5% of a thickener, 1% - 10% of an emollient, 0.1% - 1% of an antioxidant, 0.6% - 10% of a humectant, 0 - 0.1% of a chelating agent, 0 - 0.1% of a pH regulator, 0% - 3% of an emulsifier, and 0% - 5% of a co-emulsifier.

[0090] In a preferred embodiment, the weight percentage of the solvent is 75% - 90%, such as 77.75%, 84.7% or 89.81%.

[0091] In a preferred embodiment, the weight percentage of the thickener is 0.1% - 2.5%, such as 0.17%, 0.2% or 2.05%.

[0092] In a preferred embodiment, the weight percentage of the emollient is 1.7%, 5% or 9%.

[0093] In a preferred embodiment, the weight percentage of the antioxidant is 0.4% - 7%, such as 0.5% or 0.6%.

[0094] In a preferred embodiment, the weight percentage of the humectant is 0.4% - 7%, such as 5.5% or 5.6%.

[0095] In a preferred embodiment, the weight percentage of the chelating agent is 0.04% - 0.1%, such as 0.05% or 0.09%.

[0096] In a preferred embodiment, the weight percentage of the pH regulator is 0.04% - 0.1%, such as 0.05% or 0.08%.

[0097] In a preferred embodiment, the weight percentage of the emulsifier is 2% - 3%, such as 2.5%.

[0098] In a preferred embodiment, the weight percentage of the co-emulsifier is 1% - 5%, such as 1% or 4%.

[0099] In a preferred embodiment, the anti-skin photoaging cosmetic consists of the solvent and the glucosyl-modified quercetin shown in Formula I as described above, and the mass percentage of the glucosyl-modified quercetin is 0.05% - 1%.

[0100] In a preferred embodiment, the anti-skin photoaging cosmetic is composed of the following components by mass percentage: 70%-98% of a solvent, 0.05%-1% of the glucosyl-modified quercetin, 0.05%-0.5% of a thickener, 1%-10% of an emollient, 0.1%-1% of an antioxidant, 0.6%-10% of a humectant, and 0.04-0.1% of a chelating agent.

[0101] In a preferred embodiment, the anti-skin photoaging cosmetic is composed of the following components by mass percentage: 70%-98% of a solvent, 0.05%-1% of the glucosyl-modified quercetin, 0.05%-0.5% of a thickener, 1%-10% of an emollient, 0.1%-1% of an antioxidant, 0.6%-10% of a humectant, 0.04-0.1% of a pH regulator, 2%-3% of an emulsifier, and 1%-5% of a co-emulsifier.

[0102] In a preferred embodiment, the anti-skin photoaging cosmetic is composed of the following components by mass percentage: 70%-98% of a solvent, 0.05%-1% of the glucosyl-modified quercetin, 0.05%-0.5% of a thickener, 1%-10% of an emollient, 0.1%-1% of an antioxidant, 0.6%-10% of a humectant, 0.04-0.1% of a chelating agent, 0.04-0.1% of a pH regulator, 2%-3% of an emulsifier, and 1%-5% of a co-emulsifier.

[0103] In a preferred embodiment, the anti-skin photoaging cosmetic is selected from the following options:

[0104] Option A: Composed of the following components by mass percentage: 89.81% of water, 0.35% of the glucosyl-modified quercetin, 2.05% of a thickener, 1.7% of an emollient, 0.1%-1% of p-hydroxyacetophenone, 0.6%-10% of a humectant, and 0.04-0.1% of citric acid;

[0105] The thickener is composed of Sphingomonas ferment extract, sodium acrylate / sodium acryloyldimethyltaurate copolymer, isocetane, and polysorbate-80;

[0106] The emollient is composed of shea butter, polydimethylsiloxane, and polydimethylsiloxanol;

[0107] The humectant is composed of 1,2-hexanediol and glycerol;

[0108] Scheme B: It is composed of the following components by mass percentage: 90.11% of water, 0.05% of the glucose-modified quercetin, 2.05% of a thickening agent, 1.7% of an emollient, 0.1%-1% of p-hydroxyacetophenone, 0.6%-10% of a humectant, and 0.04-0.1% of citric acid;

[0109] The components of the thickening agent, the emollient, and the humectant are as described in Scheme A;

[0110] Scheme C: It is composed of the following components by mass percentage: 89.66% of water, 0.5% of the glucose-modified quercetin, 2.05% of a thickening agent, 1.7% of an emollient, 0.1%-1% of p-hydroxyacetophenone, 0.6%-10% of a humectant, and 0.04-0.1% of citric acid;

[0111] The components of the thickening agent, the emollient, and the humectant are as described in Scheme A;

[0112] Scheme D: It is composed of the following components by mass percentage: 84.7% of water, 0.35% of the glucose-modified quercetin, 0.2% of a thickening agent, 5% of an emollient, 0.6% of an antioxidant, 5.6% of a humectant, 0.05% of triethanolamine, 2.5% of an emulsifier, and 1% of cetearyl alcohol;

[0113] The thickening agent is composed of Sphingomonas ferment extract and sodium acrylate / sodium acryloyldimethyltaurate copolymer;

[0114] The emollient is composed of squalane, cocoa seed butter, polydimethylsiloxane, and polydimethylsiloxanol;

[0115] The antioxidant is composed of butylated hydroxytoluene and p-hydroxyacetophenone;

[0116] The humectant is composed of 1,2-hexanediol and 1,3-propanediol;

[0117] The emulsifier is composed of cetearyl olivate and sorbitan olivate;

[0118] Scheme E: It is composed of the following components by mass percentage: 85% of water, 0.05% of the glucose-modified quercetin, 0.2% of a thickening agent, 5% of an emollient, 0.6% of an antioxidant, 5.6% of a humectant, 0.05% of triethanolamine, 2.5% of an emulsifier, and 1% of cetearyl alcohol;

[0119] The components of the thickening agent, the emollient, the antioxidant, the humectant, and the emulsifier are as described in Scheme D;

[0120] Scheme F: It is composed of the following components by mass percentage: 84.55% of water, 0.5% of the glucosyl-modified quercetin, 0.2% of a thickener, 5% of an emollient, 0.6% of an antioxidant, 5.6% of a humectant, 0.05% of triethanolamine, 2.5% of an emulsifier, and 1% of cetearyl alcohol;

[0121] The components of the thickener, the emollient, the antioxidant, the humectant, and the emulsifier are as described in Scheme D;

[0122] Scheme G: It is composed of the following components by mass percentage: 77.55% of water, 0.35% of the glucosyl-modified quercetin, 0.17% of sodium acrylate / sodium acryloyldimethyltaurate copolymer, 9% of an emollient, 0.6% of an antioxidant, 5.5% of a humectant, 0.08% of triethanolamine, 2.5% of an emulsifier, 4% of cetearyl alcohol, and 0.05% of disodium edetate;

[0123] The emollient consists of shea butter, caprylic / capric triglyceride, polydimethylsiloxane, and polydimethylsiloxanol;

[0124] The antioxidant consists of butylated hydroxytoluene and hydroxyacetophenone;

[0125] The humectant consists of 1,2 - hexanediol and 1,3 - propanediol;

[0126] The emulsifier consists of cetearyl olivate and sorbitan olivate;

[0127] Scheme H: It is composed of the following components by mass percentage: 77.85% of water, 0.05% of the glucosyl-modified quercetin, 0.17% of acrylic acid and / or acrylates and C 10-30 alkyl acrylate cross-linked polymer, 9% of an emollient, 0.6% of an antioxidant, 5.5% of a humectant, 0.08% of triethanolamine, 2.5% of an emulsifier, 4% of cetearyl alcohol, and 0.05% of disodium edetate;

[0128] The components of the emollient, the antioxidant, the humectant, and the emulsifier are as described in Scheme G;

[0129] Scheme I: It is composed of the following components by mass percentage: 77.4% of water, 0.5% of the glucosyl-modified quercetin, 0.17% of acrylic acid and / or acrylates and C 10-30Alkyl alcohol acrylate cross-linked polymer, 9% emollient, 0.6% antioxidant, 5.5% humectant, 0.08% triethanolamine, 2.5% emulsifier, 4% cetearyl alcohol, and 0.05% disodium ethylenediaminetetraacetate;

[0130] The components of the emollient, the antioxidant, the humectant, and the emulsifier are as described in Scheme G.

[0131] In a certain preferred embodiment, the anti-skin photoaging cosmetic; the cosmetic is in liquid or paste form.

[0132] Unless otherwise specified, the terms in the present invention have the following meanings.

[0133]

[0134] On the basis of not violating the common knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred examples of the present invention.

[0135] The reagents and raw materials used in the present invention are all commercially available.

[0136] The positive and progressive effects of the present invention are as follows: The present invention demonstrates the high transdermal absorption rate of the glucose-modified quercetin derivative and its anti-photoaging effect on HFDa cells, specifically reflected in protecting cell viability, resisting ROS, protecting collagen, and at the same time comparing the resistance of the glucose-modified quercetin derivative to endogenous oxidative stress or endogenous aging caused by natural aging, and observing the outstanding role of the glucose-modified quercetin derivative in anti-photoaging.

[0137] On the other hand, the present invention provides three compositions containing glucose-modified quercetin derivatives. Using the method of human clinical trials, the effectiveness of the glucose-modified quercetin derivative in anti-aging is verified, the anti-photoaging effect of the glucose-modified quercetin derivative is corroborated, and the competitiveness and good application prospects of the glucose-modified quercetin derivative in the cosmetics market are proved. Description of the Drawings

[0138] Figure 1 : HPLC analysis chart of the glucose-modified quercetin derivative prepared in Example 1.

[0139] Figure 2 : HPLC analysis chart of the glucose-modified quercetin derivative prepared in Example 2.

[0140] Figure 3 : HPLC analysis chart of the glucose-modified quercetin derivative prepared in Example 3.

[0141] Figure 4: HPLC analysis chart of the glucose-modified quercetin derivative prepared in Example 4.

[0142] Figure 5 : Fluorescence display chart of the scavenging effect of the glucose-modified quercetin derivative on intracellular reactive oxygen species (ROS) in UVA-damaged HDFa cells. Detailed implementation manners

[0143] The present invention will be further illustrated by the following examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0144] The synthetic route of the glucose-modified quercetin derivative of the present invention is shown in the following formula:

[0145]

[0146] In the present invention, the molar yield of EMIQ (calculated based on the molar mass of isoquercitrin IQ) refers to detecting the absorbance of isoquercitrin IQ (including IQ itself and glycosylated IQ) in the solid powder obtained through dialysis purification and other operations in each example using an ultraviolet spectrophotometer under the condition of 360 nm, and then obtaining the number of moles of isoquercitrin IQ (including IQ itself and glycosylated IQ) in the solid powder according to the standard curve. The ratio of this number of moles to the number of moles of the fed IQ is the EMIQ molar yield (calculated based on IQ).

[0147] In the present invention, the purity of EMIQ refers to calculating the molar mass of different glycosylated IQs using the HPLC method, multiplying it by the corresponding molecular weight to obtain the mass of IQ itself and all EMIQs with different degrees of glycosylation. The ratio of the sum of this mass to the total mass of the product is the purity of EMIQ.

[0148] In the present invention, the ratio of IQ-n refers to calculating the molar mass of different glycosylated IQs using the HPLC method. The ratio of this molar mass to the sum of the molar masses of IQ itself and all EMIQs with different degrees of glycosylation is the ratio of IQ-n.

[0149] In the present invention, the yield of IQ-n refers to multiplying the ratio of IQ-n by the molar yield of EMIQ, that is, the molar yield of IQ-n. Multiplying the molar yield by the ratio of the molecular weight of IQ-n to the molecular weight of IQ is the ratio of the mass of IQ-n to the fed amount of IQ, which is the yield of IQ-n.

[0150] The sources of the raw materials in the present invention are as follows:

[0151] Isoquercitrin, purchased from Xi'an Shennong, with a content > 95%, batch number SN-20220618.

[0152] β-cyclodextrin, purchased from Shandong Xinda Biotechnology Co., Ltd., batch number F2206077.

[0153] Maltodextrin, purchased from Shanghai Senhang Industrial Co., Ltd., batch number 202302082.

[0154] α-Amylase G “Amano” L: α-amylase G “Amano” L, purchased from Amano Enzyme, batch number CGTV0252203SLK.

[0155] The sources of the components in the composition are shown in Table 1.

[0156] Table 1

[0157]

[0158]

[0159] In the performance test, the experimental instruments are: drug transdermal absorption instrument (Huanghai), Franz diffusion cell, high performance liquid chromatography (Shimadzu), vortex shaker (Dalong), analytical balance (OHAUS), pipette (Gilson), microplate reader (Tecan), cell culture incubator (Thermo), CFX96 TM RT-PCR instrument (Bio-Rad), inverted fluorescence microscope (Guangzhou Mingmei), CK Multi-Probe Skin Test System, Cutometer dual MPA580, Tewameter TM300, Antera 3D.

[0160] In the performance test, the materials and reagents are: EMIQ (Shanghai Huiwen), HPLC-grade water, methanol, acetonitrile (Beijing Wokai), quercetin (Sigma), resveratrol (Sigma), DMEM (Gibco), FBS (Gibco), 100× penicillin-streptomycin (Gibco), FluoroBrite TM DMEM (Gibco), 0.25% trypsin (Gibco). DCFH-DA detection kit (Beyotime), CCK8 cell viability detection kit (Beyotime). RNAprep FastPure Tissue&Cell Kit (Tsingke). PrimeScript TM RT Master Mix (TaKaRa), TB Premix Ex Taq TM II (TaKaRa).

[0161] Example 1: Preparation of EMIQ:

[0162] Weigh 1 g of isoquercitrin, add 100 mL of water, add 2 g of β-cyclodextrin, heat up to 80 °C with stirring, react for 8 h. After evaporating to dryness under reduced pressure using a rotary evaporator, add 100 ml of water, 1 g of maltodextrin, 0.2 g of α-Amylase G “Amano” L, 0.02 g of calcium chloride, and stir and react at 55 °C for 15 h. Add 0.02 g of activated carbon, keep warm and decolorize for 1 h, filter by suction. The filtrate is filtered through a ultrafiltration membrane with a molecular weight cut-off of 3000 under a pressure of 0.4 mPa. After removing macromolecules by membrane filtration, concentrate the permeate side and dry to obtain EMIQ. The absorbance of the EMIQ finished product is measured at 360 nm using a UV-visible spectrophotometer, and the yield is calculated to be 93% (calculated based on isoquercitrin). HPLC is used to analyze the purity and the content of each component of the prepared EMIQ, as shown in Table 2 and Figure 1 as follows.

[0163] Example 2: Preparation of EMIQ:

[0164] Weigh 1 g of isoquercitrin, add 100 mL of water, add 2 g of β-cyclodextrin, heat up to 60 °C with stirring, react for 16 h. After evaporating to dryness under reduced pressure using a rotary evaporator, add 100 ml of water, 1 g of maltodextrin, 0.2 g of α-Amylase G “Amano” L, 0.02 g of calcium chloride, and stir and react at 55 °C for 15 h. Add 0.02 g of activated carbon, keep warm and decolorize for 1 h, filter by suction. The filtrate is filtered through a ultrafiltration membrane with a molecular weight cut-off of 3000 under a pressure of 0.4 mPa. After removing macromolecules by membrane filtration, concentrate the permeate side and dry to obtain EMIQ. The absorbance of the EMIQ finished product is measured at 360 nm using a UV-visible spectrophotometer, and the yield is calculated to be 95% (calculated based on isoquercitrin). HPLC is used to analyze the purity and the content of each component of the prepared EMIQ, as shown in Table 2 and Figure 2 as follows.

[0165] Example 3: Preparation of EMIQ:

[0166] Weigh 1 g of isoquercitrin, add 100 mL of water, add 2 g of β-cyclodextrin, heat up to 80 °C with stirring, react for 8 h. After evaporating to dryness under reduced pressure using a rotary evaporator, add 100 ml of water, 1 g of maltodextrin, 0.5 g of α-Amylase G “Amano” L, 0.02 g of calcium chloride, and stir and react at 55 °C for 15 h. Add 0.02 g of activated carbon, keep warm and decolorize for 1 h, filter by suction. The filtrate is filtered through a ultrafiltration membrane with a molecular weight cut-off of 3000 under a pressure of 0.4 mPa. After removing macromolecules by membrane filtration, concentrate the permeate side and dry to obtain EMIQ. The absorbance of the EMIQ finished product is measured at 360 nm using a UV-visible spectrophotometer, and the yield is calculated to be 97% (calculated based on isoquercitrin). HPLC is used to analyze the purity and the content of each component of the prepared EMIQ, as shown in Table 2 andFigure 3 as shown

[0167] Example 4: Preparation of EMIQ:

[0168] Weigh 1 g of isoquercitrin, add 100 mL of water, add 2 g of β-cyclodextrin, heat to 80 °C with stirring, react for 8 h. After evaporating to dryness under reduced pressure using a rotary evaporator, add 100 ml of water, 2 g of maltodextrin, 0.2 g of α-Amylase G “Amano” L, 0.02 g of calcium chloride, and stir and react at 55 °C for 15 h. Add 0.02 g of activated carbon, keep warm for decolorization for 1 hour, filter by suction. The filtrate is filtered through a ultrafiltration membrane with a molecular weight cut-off of 3000 under a pressure of 0.4 mPa, and the macromolecules are removed. The permeate side is concentrated and dried to obtain EMIQ. The absorbance of the EMIQ finished product is measured at 360 nm using a UV-visible spectrophotometer, and the yield is calculated to be 94% (based on isoquercitrin). The purity and the content of each component of the prepared EMIQ are analyzed by HPLC, as shown in Table 2 and Figure 4 as shown

[0169] The data of the mass of EMIQ, the purity of EMIQ, and the content of the main components in EMIQ prepared in Examples 1-4 are shown in Table 2

[0170] Table 2

[0171]

[0172] IQ-1 is isoquercitrin, and QG-2-12 respectively correspond to glucosyl-modified isoquercitrin containing 1-11 glucose residues

[0173] Example 5: Preparation of EMIQ aqueous solution

[0174] Based on the total mass of the aqueous solution, EMIQ is contained at 10 mg / ml, 5 mg / ml, 1 mg / ml, and 0.5 mg / ml respectively, and PBS buffer is used as the solvent to make up the volume

[0175] Comparative Example 1:

[0176] Isoquercitrin aqueous solution, containing 1 mg / ml and 0.5 mg / ml of isoquercitrin respectively based on the total mass of the aqueous solution, and PBS buffer is used as the solvent to make up the volume

[0177] Example 6: Preparation of EMIQ essence

[0178] The ingredients are shown in Table 3

[0179] Table 3

[0180]

[0181]

[0182] The preparation process is as follows:

[0183] 1. Add phase A to the main pot in sequence, turn on the heating to 70 - 80 °C, turn on the stirring, and stir evenly without agglomeration;

[0184] 2. Pre - mix phase B, heat and dissolve it evenly at a temperature of 70 - 80 °C.

[0185] 3. Add phase B to the main pot of phase A, turn on the homogenization at 5500 rpm. After homogenizing for 3 - 5 minutes, start to cool down.

[0186] 4. Pre - mix and dissolve phase C for standby.

[0187] 5. When the temperature of the main pot drops to 60 - 65 °C, add phase C and stir evenly.

[0188] 7. After pre - mixing and dissolving phase E, add it to the main pot and stir evenly.

[0189] 8. After pre - mixing and dissolving phase F, add it to the main pot and stir evenly. Take samples for testing and then discharge the product.

[0190] Example 7: Preparation of the essence of EMIQ

[0191] Refer to the formula and preparation method in Example 6, where the content of EMIQ is adjusted to 0.5%, and the other components are the same as in Example 6, and water is added up to 100%.

[0192] Example 8: Preparation of the essence of EMIQ

[0193] Refer to the formula and preparation method in Example 6, where the content of EMIQ is adjusted to 0.05%, and the other components are the same as in Example 6, and water is added up to 100%.

[0194] Comparative Example 2: Preparation of the placebo group essence

[0195] Refer to the formula and preparation method in Example 6, replace EMIQ in Example 3 with 0.35% water, and the other components are the same as in Example 6.

[0196] Example 9: Preparation of the emulsion of EMIQ:

[0197] The ingredients are shown in Table 4:

[0198] Table 4

[0199]

[0200]

[0201] The preparation process is as follows:

[0202] 1. Add phase A to the main pot in sequence, turn on the heating to 70 - 80 °C, turn on the stirring, and stir evenly without agglomeration;

[0203] 2. Pre - mix phase B, heat and dissolve it evenly at a temperature of 70 - 80 °C;

[0204] 3. Add phase B to the main pot of phase A, turn on the homogenization at 5500 rpm, after homogenizing for 3 - 5 min, start to cool down;

[0205] 4. Pre - mix and dissolve phase C for standby;

[0206] 5. When the temperature of the main pot drops to 60 - 65 °C, add phase C and stir evenly;

[0207] 6. Pre - mix and dissolve phase D, when the temperature of the main pot drops to 40 - 45 °C, add phase D and stir evenly;

[0208] 7. Pre - mix and dissolve phase D, when the temperature of the main pot drops to 40 - 45 °C, add phase D and stir evenly. Take samples for testing and then discharge the product.

[0209] Example 10: Preparation of EMIQ emulsion:

[0210] Refer to the formula and preparation method in Example 9, where the EMIQ content is adjusted to 0.5%, and the other components are the same as in Example 9, and water is made up to 100%.

[0211] Example 11: Preparation of EMIQ emulsion:

[0212] Refer to the formula and preparation method in Example 9, where the EMIQ content is adjusted to 0.05% of water, and the other components are the same as in Example 9, and water is made up to 100%.

[0213] Comparative Example 3: Preparation of placebo group emulsion:

[0214] Refer to the formula and preparation method in Example 9, replace EMIQ in Example 7 with 0.35% of water, and the other components are the same as in Example 9.

[0215] Example 12: Preparation of EMIQ cream:

[0216] The ingredients are shown in Table 5:

[0217] Table 5

[0218]

[0219] The preparation process is as follows:

[0220] 1. Add phase A to the main pot in sequence, turn on the heating to 70 - 80 °C, turn on the stirring, and stir evenly without agglomeration;

[0221] 2. Pre-mix the B phase, heat and dissolve it evenly at a temperature of 70 - 80 °C;

[0222] 3. Add the B phase to the main pot of the A phase, start homogenization at 5500 rpm, and start cooling after homogenization for 3 - 5 minutes;

[0223] 4. Pre-mix and dissolve the C phase for standby;

[0224] 5. When the temperature of the main pot drops to 60 - 65 °C, add the C phase and stir evenly;

[0225] 6. Pre-mix and dissolve the D phase. When the temperature of the main pot drops to 40 - 45 °C, add the D phase and stir evenly;

[0226] 7. Pre-mix and dissolve the D phase. When the temperature of the main pot drops to 40 - 45 °C, add the D phase and stir evenly. Take a sample for detection and then discharge the product.

[0227] Example 13: Preparation of EMIQ cream:

[0228] Refer to the formula and preparation method in Example 12, where the EMIQ content is adjusted to 0.5%, and the other components are the same as in Example 12, with water supplemented to 100%.

[0229] Example 14: Preparation of EMIQ cream:

[0230] Refer to the formula and preparation method in Example 12, where the EMIQ content is adjusted to 0.05%, and the other components are the same as in Example 12, with water supplemented to 100%.

[0231] Comparative Example 4: Preparation of placebo group cream:

[0232] Refer to the formula and preparation method in Example 12, replace EMIQ in Example 9 with 0.35% water, and the other components are the same as in Example 12.

[0233] Effect Example Performance Test

[0234] Effect Example 1: Transdermal absorption experiment of EMIQ, rutin and isoquercitrin prepared in Example 1

[0235] 1. Preparation of ex vivo porcine skin

[0236] Take out the ex vivo porcine skin (purchased from Shanghai Zimeng Technology Co., Ltd., customized 3-month-old Bama miniature pig skin) from -80 °C, scrape off the subcutaneous fat with a scalpel, cut it into an appropriate size according to the dimensions of the Franz diffusion cell, wash it clean with PBS, and soak it in PBS buffer for standby.

[0237] 2. Assembly of Franz diffusion cell

[0238] Place a magnetic stir bar in the receptor cell of the Franz diffusion cell, fill it with PBS buffer solution, place the treated pig skin cuticle side up flat on the top of the receptor cell, place the upper cover of the receptor cell on the pig skin, clamp it with an elastic clip, and place it in the test hole of the transdermal absorption instrument. The temperature of the transdermal absorption instrument is 37 °C and the rotation speed is 400 rpm.

[0239] 3. Transdermal absorption

[0240] Uniformly apply 20 μl of the sample to be tested (5 mg / ml EMIQ prepared in Example 1, 5 mg / ml rutin, 5 mg / ml quercetin) on the surface of the pig skin. Set 3 parallel groups for each group, cover the top with a cover glass to prevent water evaporation, time for 5 h, and collect the liquid in the receptor cell. Wash the unabsorbed sample on the surface with PBS, cut the pig skin into pieces, and extract the sample in the pig skin with 50% methanol. Combine the liquid in the receptor cell and the methanol extract, and filter through a 0.22 μm filter membrane for testing.

[0241] 4. Result analysis

[0242] Perform HPLC detection using a high-performance liquid chromatograph. The HPLC detection is carried out on a Shimadzu LC-16 system using a Phenomenex Gemini R NX-C18 (250×4.6 mm, 5 μm) column. Standards of isoquercitrin, rutin, quercetin, and the EMIQ sample to be tested are all prepared in 50% methanol. According to the method of Shanghai Huiwen Biotechnology Co., Ltd., the mobile phase consists of phase A (0.4% phosphoric acid) and phase B (acetonitrile: methanol, 10:1 ratio). The detection wavelength is 360 nm, the column temperature is 35 °C, and the injection volume is 10 μL. The elution program is as follows (the proportion of mobile phase B in the mobile phase): 0.01 s - 5.5%, 2 min - 13.2%, 4 min - 18.7%, 30 min - 18.7%, 32 min - 19.3%, 34 min - 23.1%, 40 min - 29.3%, 41 min - 5.5%. After injecting standards of isoquercitrin, rutin, and quercetin respectively, measure the chromatographic peak area, and fit the standard curve based on the concentration and the chromatographic peak area. Quantify the concentrations of isoquercitrin, rutin, and quercetin in the sample to be tested according to the standard curve. Then calculate the cumulative transdermal amount of isoquercitrin, rutin, and quercetin using formula (I), and calculate the cumulative transdermal rate of isoquercitrin, rutin, and quercetin using formula (II): Cumulative transdermal amount = concentration of the substance in the extract × total volume of the extract (I), Cumulative transdermal rate = cumulative transdermal amount / total mass of the administered drug (II). The values are expressed as mean ± standard deviation. If there are differences between groups, use ANOVA to analyze the significance, α = 0.05. The results are shown in Table 6.

[0243] Table 6 Results of transdermal absorption experiments of water-soluble isoquercitrin, rutin, and quercetin

[0244]

[0245] Note: The difference in data was analyzed using one-way ANOVA, and the p-value obtained reflects whether there is statistical evidence that at least two group means are significantly different in this population. Generally, p < 0.05 is considered to have a significant difference, which is called a significant difference.

[0246] : p < 0.001, comparison between 2.5 h and 5 h of EMIQ.

[0247] ***: p < 0.001, comparison between rutin and quercetin at 2.5 h and EMIQ;

[0248] ΔΔΔ: p < 0.001, comparison between rutin and quercetin at 5 h and EMIQ.

[0249] After detection, the cumulative transdermal rates of 5 mg / ml EMIQ at 2.5 h and 5 h were both better than those of 5 mg / ml rutin and 5 mg / ml quercetin (p < 0.001). After 2.5 h of administration, the cumulative transdermal rates of EMIQ, rutin, and quercetin were 58.0%, 9.3%, and 3.7% respectively. The cumulative transdermal rate of EMIQ was 6.44 times that of rutin and 14.50 times that of quercetin; after 5 h of administration, the cumulative transdermal rates of EMIQ, rutin, and quercetin were 83.3%, 11.3%, and 5.3% respectively. The cumulative transdermal rate of EMIQ was 7.55 times that of rutin and 16.60 times that of quercetin.

[0250] Effect Example 2: Protective effect of EMIQ prepared in Example 1 on human dermal fibroblasts (HDFa, Gibco TM C0135C)

[0251] 1. HDFa cell culture and UVA-induced modeling

[0252] HDFa cells (purchased from Gibco TM , catalog number C0135C) were cultured and passaged using DMEM supplemented with 10% FBS and 1% penicillin-streptomycin antibody, and cultured in an incubator at 37 °C, 5.0% CO 2 , 95% RH. After the cell confluence rate reached 80%, they were digested with trypsin and counted, and inoculated into a 24-well plate at a concentration of 2 - 5×10 5 cells / ml, 500 μl per well, and at 37 °C, 5.0% CO 2, Cultivate in a 95% RH incubator for 24 h, then change to a medium containing different concentrations of EMIQ (the concentration is determined according to specific experiments) or a medium containing isoquercitrin (IQ), pretreat the cells for 2 h, then change to PBS. Additionally, set up a blank group and a UVA group, both of which do not contain any active substances. Except for the blank group, the other groups are irradiated with a UVA lamp, and the irradiation dose is 5 J / cm 2 . Then place the cells in an incubator at 37 °C and 5.0% CO 2 and cultivate for 24 h.

[0253] 2. Protective effect of EMIQ on the viability of UVA-damaged HDFa cells

[0254] Treat HDFa cells according to the UVA modeling method shown in step 1. Add 10% Cell Counting Kit-8 (Beyotime) to each well, incubate at 37 °C for 30 min, and use an enzyme-linked immunosorbent assay ( 200PRO, Tecan) to measure the absorbance at 450 nm. Taking the blank group as 100% reference, calculate the cell viability to evaluate the protective effect of EMIQ. The results are shown in Table 7.

[0255] Table 7 Protective effect of EMIQ on the viability of UVA-damaged HDFa cells

[0256]

[0257]

[0258] Note: ΔΔΔ: Compared with the Control group, p < 0.001; ***: Compared with the UVA group, p < 0.001; : Comparison between different control substances at 0.5 mg / ml and EMIQ at 0.5 mg / ml, p < 0.001, ##: Comparison between different control substances at 0.5 mg / ml and EMIQ at 0.5 mg / ml, p < 0.01.

[0259] After detection, compared with the blank group, UVA induction can significantly reduce the viability of keratinocytes (p < 0.001). Compared with the UVA model group, 10 mg / ml, 5 mg / ml, 1 mg / ml, and 0.5 mg / ml of EMIQ can all significantly increase the viability of keratinocytes (p < 0.001), indicating that EMIQ can alleviate the damage of UVB to keratinocytes and has a dose-dependent relationship. And at the same concentration, the effect of EMIQ in alleviating keratinocyte damage is significantly better than that of the isoquercitrin control.

[0260] 3. Scavenging effect of EMIQ on intracellular reactive oxygen species (ROS) in UVA-damaged HDFa cells

[0261] The HDFa cells were treated according to the UVA modeling method shown in Step 1. The cells were washed twice with PBS, and each well was replaced with DCFH-DA (Beyotime) probe diluted 1000-fold with FluoroBrite TM DMEM (Thermo). After incubation in the incubator for 20 min, the cells were washed three times with FluoroBrite TM DMEM. The readings were taken using a microplate reader under the detection conditions of an excitation wavelength of 495 nm and an emission wavelength of 545 nm. The blank group was used as the 100% reference to evaluate the scavenging effect of EMIQ on intracellular reactive oxygen species. The results are shown in Table 8 and Figure 5 as follows.

[0262] Table 8 Scavenging effect of EMIQ on intracellular reactive oxygen species (ROS) in UVA-damaged HDFa cells

[0263] Experimental grouping Fluorescence intensity (a.u.) Rate of change Blank group 2208±299 UVA <![CDATA[11021±166 ΔΔΔ > +399.0％ EMIQ 5mg / ml <![CDATA[3011±469 *** > -72.7％ EMIQ 1mg / ml <![CDATA[3781±557 *** > -65.7％ IQ 1mg / ml <![CDATA[7283±916 *** > -33.9％

[0264] Note: ΔΔΔ: compared with the Control group, p < 0.001; ***: compared with the UVA group, p < 0.001.

[0265] Intracellular ROS was labeled with green fluorescence. The stronger the green fluorescence, the more intracellular ROS and the more severe the damage.

[0266] After detection, compared with the blank group, UVA induction could significantly increase the intracellular ROS content (p < 0.001). Compared with the UVA model group, the 5 mg / ml and 1 mg / ml concentrations of EMIQ could significantly reduce the intracellular ROS content (p < 0.001), indicating that EMIQ could scavenge intracellular ROS induced by UVB and reduce the damage of ROS to cells.

[0267] 4. Effect of EMIQ on collagen synthesis-related genes in UVA-damaged HDFa cells

[0268] The HDFa cells were treated according to the UVA modeling method shown in Step 1. The cells were digested with trypsin and collected. The total RNA of the cells was extracted using the RNAprepFastPure Tissue&Cell Kit (Tsingke). Then, PrimeScript TM RTMaster Mix (TaKaRa) was used to reverse transcribe DNA, which was stored at -20 °C for later use. RT-PCR was performed using TB Premix ExTaq TM II (TaKaRa) to prepare the reaction system. The instrument used was the CFX96 TM Real-time System (Bio-Rad). The genes to be analyzed and the corresponding primers are as follows.

[0269] GAPDH (Forward (SEQ ID NO:1): ACCCACTCCTCCACCTTTGA, Reverse (SEQ ID NO:2): TGGTGGTCCAGGGGTCTTAC),

[0270] MMP1 (Forward (SEQ ID NO:3): CCCAAAAGCGTGTGACAGTAAG, Reverse (SEQ ID NO:4): CTTCCGGGTAGAAGGGATTTG),

[0271] TGFβR2 (Forward (SEQ ID NO:5): CAACCACCAGGGCATCCA, Reverse (SEQ ID NO:6): TCGTGGTCCCAGCACTCA),

[0272] Smad7 (Forward (SEQ ID NO:7): ATGCTGTGCCTTCCTCCGCT, Reverse (SEQ ID NO:8): CGTCCACGGCTGCTGCATAA),

[0273] COL1A1 (Forward (SEQ ID NO:9): ATGCTGTGCCTTCCTCCGCT, Reverse (SEQ ID NO:10): CGTCCACGGCTGCTGCATAA).

[0274] The results were calculated using Method 2 -ΔΔCq to calculate the expression levels of the genes relative to GADPH, and using the blank group as the 100% reference, calculate the expression levels of the corresponding genes in the experimental groups relative to the blank group. The results are shown in Table 9

[0275] Table 9 RT-PCR analysis results of collagen synthesis-related genes

[0276]

[0277] Note: ΔΔΔ: compared with the Control group, p < 0.001; ***: compared with the UVA group, p < 0.001; **: compared with the UVA group, p < 0.01; : comparison between IQ 1mg / ml and EMIQ 1mg / ml, p < 0.001; ##: comparison between IQ and EMIQ (1mg / ml), p < 0.01

[0278] After detection, compared with the blank group, UVA induction decreased the expression levels of COL1A1 (p<0.001) and TGFβR2 (p<0.001) genes, and increased the expression levels of MMP1 (p<0.001) and Smad7 (p<0.001) genes, which was manifested as a decrease in the synthesis and an increase in the decomposition of collagen in HDFa cells. After using 1mg / ml and 5mg / ml of EMIQ, the expression levels of COL1A1 (p<0.001) and TGFβR2 (p<0.001) genes could be increased, and the expression levels of MMP1 (p<0.001) and Smad7 (p<0.001) genes could be decreased, which was manifested as slowing down the decrease in the synthesis and the decomposition of collagen in HDFa cells induced by UVA, and had a protective effect on the content of collagen.

[0279] Effect Example 3: Protective effect of EMIQ on endogenous damage

[0280] 1. Establishment of a model of endogenous damage induced by hydrogen peroxide in HDFa cells

[0281] HDFa cells were seeded into 24-well plates at a concentration of 2-5×10 5 cells / ml, 500 μl per well, and cultured in an incubator at 37°C, 5.0% CO 2 , 95% RH for 24 h. Then the medium was replaced with a medium containing different concentrations of EMIQ (the concentration was determined according to specific experiments), and the cells were pretreated for 2 h. Except for the Control group, the final concentration of H 2 O 2 was added to the other groups at a concentration of 20 μmol / ml. Then the cells were placed in an incubator at 37°C, 5.0% CO 2 and cultured for 4 h.

[0282] 2. Experimental results

[0283] According to the method of establishing the model with H 2 O 2 as described above, 10% Cell Counting Kit-8 (Beyotime) was added to each well, and the cells were incubated at 37°C for 30 min. The absorbance was measured at 450 nm using a microplate reader ( 200PRO, Tecan). Taking the blank group as 100% reference, the cell viability was calculated to evaluate the protective effect of EMIQ. EMIQ still had a sufficient resistance effect on the endogenous damage induced by hydrogen peroxide, but the effect was not as good as that against photoaging caused by ultraviolet rays. The results are shown in Table 10.

[0284] Table 10

[0285] Experimental grouping Cell viability (%) Rate of change Control group 100.00±2.11 <![CDATA[H 2 O 2 > <![CDATA[68.23±2.93 ΔΔΔ > -31.8％ EMIQ 10mg / ml <![CDATA[74.45±1.28 *** > +9.1％ EMIQ 5mg / ml <![CDATA[91.70±2.43 *** > +34.4％ EMIQ 1mg / ml <![CDATA[85.89±3.46 *** > +25.9％ EMIQ 0.5mg / ml <![CDATA[80.10±2.74 *** > +17.4％ IQ 0.5mg / ml <![CDATA[70.47±2.73 *### > +3.3％

[0286] Note: ΔΔΔ: Compared with the Control group, p < 0.001; ***: Compared with the H 2 O 2 group, p < 0.001; #: Comparison between 0.5 mg / ml of different controls and 0.5 mg / ml of EMIQ, p < 0.05.

[0287] Effect Example 4: Anti-aging effect of EMIQ on naturally aging cells

[0288] Take the 4th and 10th generation HDFa cells respectively. The 4th generation cells are used as the Control group, and the 10th generation of naturally aging cells are used as the model to study the proliferation effect of EMIQ on naturally aging cells. The 4th and 10th generation HDFa cells are inoculated into a 24-well plate at a concentration of 2 - 5×10 5 cells / ml, 500 μl per well, and cultured in an incubator at 37°C, 5.0% CO 2 , 95% RH for 24 h. Then, the medium is replaced with a medium containing different concentrations of EMIQ (the concentration is determined according to specific experiments), and the cells are continuously cultured for 24 h. 10% Cell Counting Kit-8 (Beyotime) is added to each well and incubated at 37°C for 30 min. The absorbance value is measured at 450 nm using a microplate reader ( 200PRO, Tecan). Taking the blank group as 100% reference, the cell viability is calculated to evaluate the anti-aging effect of EMIQ on naturally aging cells. The results are shown in Table 11.

[0289] Table 11

[0290]

[0291] EMIQ still has a sufficient resistance effect on the endogenous damage of natural aging, but the effect is not as good as that against photoaging caused by ultraviolet rays.

[0292] Combined with Effect Examples 2, 3, and 4, a significant analysis was conducted on the change rates of the three groups of cell viability experiments. The specific results are shown in Table 12. p < 0.05 is regarded as having a significant difference. This table can prove that the anti-ultraviolet aging effect is better. We found that EMIQ has a particularly excellent effect against photoaging caused by ultraviolet rays.

[0293] Table 12

[0294]

[0295] Effect Example 5

[0296] The experiment is a one-month human clinical trial from June to July 2023, held at Huiwen Testing (Shanghai) Co., Ltd. The study protocol was reviewed and approved by Huiwen's Institutional Review Board, and the protocol number was designated: Huiwen Bio_20230603.

[0297] This experiment recruited 360 healthy volunteers and divided them into 12 groups: essence, lotion, and cream containing 0.5% EMIQ (Examples 7, 10, and 13); essence, lotion, and cream containing 0.35% EMIQ (Examples 6, 9, and 12); essence, lotion, and cream containing 0.05% EMIQ (Examples 8, 11, and 14); and placebo essence, lotion, and cream without any functional substance. All volunteers were from Shanghai, China, aged 30-60 years old.

[0298] After the subjects had their transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra baseline values ​​(day 0) tested by Huiwen Testing (Shanghai) Co., Ltd., they were asked to use the corresponding samples every morning and evening, and go to Huiwen Testing (Shanghai) Co., Ltd. again to test the corresponding indicators after 14 and 28 days of use. The subjects were tested in a constant temperature and humidity room at 20±1℃ and 50±10% RH. The testers used Cutometer dual MPA580 to test skin elasticity R2, Tewameter TM300 to test TWEL, and Antera 3D to test skin roughness Ra. The results are shown in Table 13.

[0299] Table 13 Change rate of human clinical detection indicators

[0300]

[0301]

[0302] Notes: ###: compared with day 0, p<0.001; ##: compared with day 0, p<0.01; #: compared with day 0, p<0.05.

[0303] After testing: For the essence dosage form: After 14 days and 28 days of using the essence containing 0.5% EMIQ, the volunteers can significantly improve the transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra. After 14 days of using the essence containing 0.05% EMIQ, the volunteers can significantly improve the skin elasticity R2 and skin roughness Ra. After 28 days of using the essence containing 0.05% EMIQ, the volunteers can significantly improve the transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra. After 14 days and 28 days of using the essence containing 0.35% EMIQ, the volunteers can significantly improve the transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra.

[0304] For the emulsion dosage form: After 14 days and 28 days of using the essence containing 0.5% EMIQ, the volunteers can significantly improve transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra. After 14 days of using the emulsion containing rutin, the volunteers can significantly improve skin elasticity R2 and skin roughness Ra. After 28 days of using the emulsion containing 0.05% EMIQ, the volunteers can significantly improve transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra. After 14 days and 28 days of using the emulsion containing 0.35% EMIQ, the volunteers can significantly improve transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra.

[0305] For the cream dosage form: After 14 days and 28 days of using the cream containing 0.5% EMIQ, the volunteers can significantly improve transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra. After 14 days of using the cream containing 0.05% EMIQ, the volunteers can significantly improve skin elasticity R2 and skin roughness Ra. After 28 days of using the cream containing rutin, the volunteers can significantly improve transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra. After 14 days and 28 days of using the cream containing 0.35% EMIQ, the volunteers can significantly improve transepidermal water loss (TWEL), skin elasticity R2, and skin roughness Ra.

[0306] Through Effect Example 5, we observed that when EMIQ is added to the essence, emulsion, and cream dosage forms at a concentration of 0.05% - 0.5%, it will have good anti-aging ability. And through Effect Examples 2 - 4, we observed that although EMIQ has a resistance effect on natural cell aging and endogenous oxidative stress, its effect on photoaging caused by UVA is particularly significant. Therefore, we believe that EMIQ has good application prospects in the aspect of anti-ultraviolet photoaging in cosmetics.

Claims

1. Use of glucosyl-modified quercetin as an anti-skin photoaging agent.

2. Use of the glucosyl-modified quercetin as claimed in claim 1 as an anti-skin photoaging agent, characterized in that it satisfies one or more of the following conditions: (1) The anti-skin photoaging agent is an anti-skin ultraviolet aging agent; (2) The anti-skin photoaging agent is an anti-aging agent related to the expression of MMP1 and / or Smad7 genes; preferably, the aging related to the expression of MMP1 and / or Smad7 genes is human dermal fibroblast aging; (3) The anti-skin photoaging agent is a cosmetic for anti-skin photoaging; preferably, it is a cosmetic for anti-skin ultraviolet aging; and (4) The glucosyl-modified quercetin is isoquercitrin, glucosyl-modified isoquercitrin or a mixture composed of isoquercitrin and glucosyl-modified isoquercitrin; preferably, the glucosyl-modified quercetin is glucosyl-modified isoquercitrin.

3. Use of the glucosyl-modified quercetin as claimed in claim 1 as an anti-skin photoaging agent, characterized in that the glucosyl-modified quercetin contains glucosyl-modified isoquercitrin.

4. Use of the glucosyl-modified quercetin as claimed in claim 2 or 3 as an anti-skin photoaging agent, characterized in that the glucosyl-modified isoquercitrin is the glucosyl-modified isoquercitrin shown in formula II, wherein, n is selected from one or more of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11; preferably, the plurality is 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11; more preferably, the n is at least 3, for example, the n is at least 1, 2 and 3; again for example, the n is at least 1, 2, 3, 4, 5 and 6; still again for example, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11.

5. Use of the glucosyl-modified quercetin as claimed in claim 3 as an anti-skin photoaging agent, characterized in that the glucosyl-modified quercetin includes the isoquercitrin and glucosyl-modified isoquercitrin; in the glucosyl-modified quercetin, the sum of the mass percentages of the isoquercitrin and glucosyl-modified isoquercitrin is 20%-100%; for example 50%-80%; again for example 70%-80%, still again for example 74%, 75% or 78%; preferably, the glucosyl-modified quercetin is the isoquercitrin and the glucosyl-modified isoquercitrin shown in formula II; more preferably, the glucosyl-modified quercetin satisfies one or more of the following conditions (calculated based on the total molar mass of isoquercitrin and glucosyl-modified isoquercitrin being 100%): (1) The molar percentage of the component with n being 1 is 10-25%; for example 17%, 18% or 19%; (2) The molar percentage of the component with n being 2 is 10-25%; for example 14%, 15%, 17% or 19%; (3) The molar percentage of the component with n being 3 is 10-25%; for example 11% or 12%; (4) The mole percentage of isoquercitrin is 0 - 30%, such as 10 - 30%; for another example, 20%, 22%, 25% or 26%; and (5) In the glucose-modified isoquercitrin represented by Formula II, the average value of n is 2 - 6, such as 2.8; Preferably, the glucose-modified quercetin includes the isoquercitrin and the glucose-modified isoquercitrin represented by Formula II; where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11; in the glucose-modified quercetin, the sum of the mass percentages of the isoquercitrin and the glucose-modified isoquercitrin is 70% - 80%; Calculated based on the total molar mass of isoquercitrin and glucose-modified isoquercitrin being 100%, in the glucose-modified quercetin, the mole percentage of isoquercitrin is 10 - 30%; the mole percentage of the component with n = 1 is 10 - 25%; the mole percentage of the component with n = 2 is 10 - 25%; the mole percentage of the component with n = 3 is 10 - 25%.

6. The use of the glucose-modified quercetin according to claim 4 as an anti-skin photoaging agent, characterized in that, the glucose-modified isoquercitrin represented by Formula II is prepared by the following method, and the preparation method of the glucose-modified isoquercitrin represented by Formula II includes the following steps: Step (1): In water, isoquercitrin and β-cyclodextrin are subjected to an inclusion reaction, and then dried to obtain a β-cyclodextrin-isoquercitrin inclusion complex; Step (2): In water, in the presence of an enzyme and calcium chloride, the β-cyclodextrin-isoquercitrin inclusion complex obtained in step (1) is subjected to a glycosylation reaction with maltodextrin to obtain the glucose-modified isoquercitrin; In step (1), the volume-mass ratio of water to isoquercitrin is (100 - 300) mL / g; In step (1), the mass ratio of β-cyclodextrin to isoquercitrin is (2 - 4):1; In step (1), the temperature of the inclusion reaction is 70°C - 85°C; In step (2), the volume-mass ratio of water to isoquercitrin is (100 - 300) mL / g; In step (2), the enzyme is cyclodextrin glycosyltransferase or α-amylase with cyclodextrin glycosyltransferase activity; In step (2), the mass ratio of the enzyme to isoquercitrin is (0.2 - 0.7):1, In step (2), the mass ratio of maltodextrin to isoquercitrin is (1 - 3):1, In step (2), the mass ratio of calcium chloride to isoquercitrin is (0.01 - 0.05):1; In step (2), the temperature of the glycosylation reaction is 50°C - 60°C; Preferably, the preparation method of the glucose-modified isoquercitrin represented by Formula II satisfies one or more of the following conditions: (1) In step (1), the volume-mass ratio of water to isoquercitrin is 100 mL / g; (2) In step (1), the mass ratio of β-cyclodextrin to isoquercitrin is 2:1; (3) In step (1), the temperature of the inclusion reaction is 70 °C or 80 °C; (4) In step (1), the drying is vacuum drying, for example, drying with a rotary evaporator; (5) In step (1), the temperature of the drying is 30 °C - 70 °C, for example, 50 °C - 65 °C; or for example, 55 °C; (6) In step (2), the volume-mass ratio of water to isoquercetin is 100 mL / g; (7) In step (2), the α-amylase with cyclodextrin glucosyltransferase activity is α-amylase G "Tianye" L; (8) In step (2), the mass ratio of cyclodextrin glucosyltransferase to isoquercetin is 0.2:1 or 0.5:1; (9) In step (2), the mass ratio of maltodextrin to isoquercetin is 1:1 or 2:1; (10) In step (2), the mass ratio of calcium chloride to isoquercetin is 0.02:1; (11) In step (2), the temperature of the glycosylation reaction is 55 °C; and (12) After the glycosylation reaction, there is also a post-treatment step, and the post-treatment includes one or more of the following steps: decolorization, suction filtration, membrane filtration, concentration, and drying; The decolorization can be decolorization by adsorption with activated carbon; The temperature of the decolorization can be 30 °C - 90 °C, for example, 50 °C - 85 °C; or for example, 60 °C, 70 °C, or 80 °C; The time of the decolorization can be 1 - 2 h, for example, 1 h; The membrane filtration can be ultrafiltration membrane filtration; for example, the cut-off molecular weight of the ultrafiltration membrane is 3000.

7. Use of the glucose-modified quercetin according to any one of claims 1 - 6 in the preparation of an MMP1 and / or Smad7 gene expression inhibitor.

8. Use of the glucose-modified quercetin according to any one of claims 1 - 6 in anti-skin aging related to MMP1 and / or Smad7 gene expression; the skin aging related to MMP1 and / or Smad7 gene expression can be the aging of human dermal fibroblasts.

9. A skin photoaging-resistant cosmetic, characterized in that: it comprises 0.05% - 1% by mass of the glucose-modified quercetin according to any one of claims 1 - 6.

10. The skin photoaging-resistant cosmetic according to claim 9, characterized in that, it satisfies one or both of the following conditions: (1) In the skin photoaging-resistant cosmetic, the mass percentage of the glucose-modified quercetin is 0.05%, 0.1%, 0.35%, 0.5%, or 1%; and (2) In the cosmetic, the cosmetic further comprises an auxiliary material or active ingredient B, and the active ingredient B is not the glucose-modified quercetin according to any one of claims 1 - 6.

Images