Lactobacillus reuteri zy18 and its use as a feed additive
By isolating and identifying Lactobacillus reuteri ZY18, the shortcomings of existing technologies in improving intestinal inflammation and damage and regulating intestinal flora of Lactobacillus reuteri ZY15 have been overcome, resulting in significant improvement in intestinal health and enhanced antioxidant capacity, thus promoting animal growth.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- FEED RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2025-04-22
- Publication Date
- 2026-07-03
AI Technical Summary
The existing Lactobacillus reuteri ZY15 is not very effective in improving intestinal inflammation and damage in animals, regulating the reduction of intestinal flora diversity, and there is still room for improvement in enhancing the antioxidant capacity of animals.
A strain of Lactobacillus reuteri ZY18 was isolated and identified. It has good acid production, acid and bile salt resistance, antibacterial ability and adhesion ability. It can be used to prepare feed additives to improve intestinal inflammation and damage, regulate intestinal flora and improve antioxidant capacity in animals.
Lactobacillus reuteri ZY18 significantly improves intestinal inflammation and damage in animals, enhances antioxidant capacity, regulates intestinal flora, promotes animal growth, reduces intestinal pathological inflammation scores, and improves animal health.
Smart Images

Figure CN120060080B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to Lactobacillus and its applications, and more particularly to a strain of Lactobacillus reuteri isolated from the feces of weaned piglets and its applications in inhibiting bacteria, promoting animal growth, improving intestinal inflammation and damage in animals, enhancing the antioxidant capacity of animals, and regulating the intestinal flora of animals. It belongs to the field of Lactobacillus reuteri and its applications. Background Technology
[0002] Lactobacillus reuteri ( Lactobacillus reuteri , L. reuteri It is a type of lactic acid bacteria (LAB). L. reuteri It is a heterologous fermenting strain that can ferment sugars to produce CO2, lactic acid, acetic acid, and ethanol, and can colonize the gastrointestinal tract of humans and animals. It has been reported that... L. reuteri It possesses many functional properties, such as antibacterial activity, immunomodulatory effects, maintenance of intestinal barrier function, and regulation of gut microbiota (Yu, Z.; Chen, J.; Liu, Y.; Meng, Q.; Liu, H.; Yao, Q.; Song, W.; Ren, X.; Chen, X. The Role of Potential Probiotic Strains Lactobacillus Reuteri in Various Intestinal Diseases: New Roles for an Old Player). Front. Microbiol. 2023, 14, 1095555). L. reuteri While colonizing the gastrointestinal tract, it can produce a variety of antimicrobial substances, such as reutericyclin, lactic acid, acetic acid, ethanol, etc., with reutericyclin being the most important of them. L. reuteri Glycerol is metabolized to 3-HPA via a coenzyme B12-dependent glycerol dehydratase-mediated reaction. 3-HPA interacts with intracellular thiol groups to produce antibacterial activity (Schaefer, L.; Auchtung, TA; Hermans, KE; Whitehead, D.; Borhan, B.; Britton, RA). The antimicrobial compound Reuterin (3-Hydroxypropionaldehyde) induces oxidative stress via interaction with thiol groups. Microbiology 2010, 156 (6), 1589–1599). L. reuteri It colonizes and survives in the gastrointestinal tract by utilizing its acid- and bile-salt-resistant properties and adhesion. Subsequently, it modulates the gut microbiota, enhances the intestinal mucosal barrier, regulates immune cells and inflammatory factors, produces tryptophan derivatives, secretes bioactive factors such as extracellular polysaccharides (EPS), increases the expression of tight junction proteins, regulates gene expression, enhances antioxidant activity, and further modulates the host's immune system (Luo, Z.; Chen, A.; Xie, A.; Liu, X.; Jiang, S.; Yu, R. Limosilactobacillus Reuteriin Immunomodulation: Molecular Mechanisms and Potential Applications). Front. Immunol. 2023, 14, 1228754).
[0003] Lactobacillus reuteri ZY15 (microbial preservation number: CGMCC No. 28937) disclosed in CN118460435A has functions such as antibacterial activity, promoting animal growth, reducing animal diarrhea rate, increasing animal hormone levels, and improving animal antioxidant capacity. However, its ability to improve animal intestinal inflammation and damage, alleviate the reduction of intestinal flora diversity, or regulate animal intestinal flora still needs improvement. Summary of the Invention
[0004] One of the objectives of this invention is to provide a strain of Lactobacillus reuteri isolated from animals.
[0005] The second objective of this invention is to apply the aforementioned Lactobacillus reuteri to antibacterial activities, promote animal growth, improve intestinal inflammation and damage in animals, enhance the antioxidant capacity of animals, and regulate the intestinal flora of animals.
[0006] To achieve the above objectives, the main technical solutions adopted by the present invention include:
[0007] This invention provides, in one aspect, a strain of Lactobacillus reuteri (… Lactobacillus reuteri ZY18, its microbial preservation number is CGMCC No. 28938; its classification name is: Lactobacillus reuteri Lactobacillus reuteri The deposit date is November 10, 2023; the depositary institution is the China General Microbiological Culture Collection Center; the depositary address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0008] The colony and cell morphology of Lactobacillus reuteri described in this invention are as follows: Lactobacillus reuteri ZY18 colonies on the culture medium are nearly round in shape, milky white in color, and glossy; after Gram staining, they can be observed under a microscope as rod-shaped Gram-positive bacteria.
[0009] The *Lactobacillus reuteri* ZY18 isolated in this invention exhibits the fastest growth rate after 3 hours, entering the logarithmic growth phase, followed by a slowdown in growth and a plateau phase after 13 hours. It demonstrates good acid-producing properties, tolerance to simulated gastrointestinal environments, and the ability to withstand acidic or bile salt environments while exhibiting bile salt hydrolytic enzyme activity. It shows no hemolytic ring, indicating γ-hemolysis and good safety. Furthermore, it possesses good hydrophobicity, self-aggregation ability, and adhesion. This *Lactobacillus reuteri* ZY18 also exhibits excellent antibacterial activity and the ability to promote animal growth, improve intestinal inflammation and damage, enhance antioxidant capacity, and regulate intestinal flora.
[0010] Another aspect of the present invention is to apply the aforementioned Lactobacillus reuteri to the preparation of feed additives or drugs that have antibacterial, growth-promoting, intestinal inflammation and damage-improving, antioxidant capacity-enhancing, and intestinal flora-regulating effects.
[0011] In a preferred embodiment of the present invention, the Lactobacillus reuteri ZY18 is used to prepare a feed additive or drug that inhibits bacteria.
[0012] In a preferred embodiment of the present invention, the bacteria include, but are not limited to, Escherichia coli, Staphylococcus aureus, or Salmonella.
[0013] In a preferred embodiment of the present invention, the Lactobacillus reuteri ZY18 is used to prepare a feed additive that promotes animal growth.
[0014] In a preferred embodiment of the present invention, the Lactobacillus reuteri ZY18 is used to prepare feed additives or drugs that improve intestinal inflammation and damage in animals.
[0015] In a preferred embodiment of the present invention, the improvement of intestinal inflammation in animals involves reducing the pathological inflammation scores of the jejunum, ileum, and colon; increasing the relative expression levels of genes related to anti-inflammatory cytokines; and decreasing the relative expression levels of genes related to pro-inflammatory cytokines.
[0016] In a preferred embodiment of the present invention, the improvement of intestinal damage in animals is achieved by increasing the expression level of intestinal barrier genes and increasing the height of ileal villi and the ratio of villi height to crypt depth.
[0017] In a preferred embodiment of the present invention, the Lactobacillus reuteri ZY18 is used to prepare a feed additive that enhances the antioxidant capacity of animals.
[0018] In a preferred embodiment of the present invention, the Lactobacillus reuteri ZY18 is used to prepare feed additives or drugs that regulate the intestinal flora of animals.
[0019] In a preferred embodiment of the present invention, the animal is a pig or a mouse.
[0020] This invention involves isolating and screening *Lactobacillus reuteri* ZY18 from the feces of weaned piglets, and identifying it through morphological and molecular biological methods. *Lactobacillus reuteri* ZY18 exhibits the fastest growth rate after 3 hours, entering the logarithmic growth phase, followed by a slowdown in growth after 13 hours, reaching a plateau phase. It demonstrates good acid-producing properties; tolerance to simulated gastrointestinal environments; tolerance to acidic or bile salt environments and bile salt hydrolytic enzyme activity; the absence of a surrounding hemolytic ring, indicating γ-hemolysis and good safety; and good hydrophobicity, self-aggregation ability, and adhesion.
[0021] Experiments have shown that *Lactobacillus reuteri* ZY18 possesses antibacterial properties, promotes animal growth, improves intestinal inflammation and damage, enhances antioxidant capacity, and regulates intestinal flora. Therefore, *Lactobacillus reuteri* ZY18 shows promise for application in the preparation of feed additives or pharmaceuticals. Attached Figure Description
[0022] Figure 1 Images show the colony and cell morphology of strain ZY18; among them, Figure 1 -A represents the colony morphology of strain ZY18; Figure 1 -B represents the cell morphology of strain ZY18 under a microscope (1000×).
[0023] Figure 2 The growth curves, pH changes, and lactic acid content of *Lactobacillus reuteri* ZY18 were analyzed; among them, Figure 2 -A represents the growth curve of Lactobacillus reuteri ZY18; Figure 2 -B represents the pH change of the bacterial culture of Lactobacillus reuteri ZY18; Figure 2 -C represents the lactic acid content of the bacterial culture of Lactobacillus reuteri ZY18.
[0024] Figure 3 To assess the tolerance of Lactobacillus reuteri ZY18 to simulated gastric / intestinal fluid; among which, Figure 3 -A represents the tolerance of Lactobacillus reuteri ZY18 to simulated gastric juice; Figure 3 -B represents the tolerance of Lactobacillus reuteri ZY18 to simulated intestinal fluid.
[0025] Figure 4 To assess the tolerance of Lactobacillus reuteri ZY18 to acidic environments and bile salts; among which, Figure 4 -A represents the tolerance of Lactobacillus reuteri ZY18 to acidic environments; Figure 4 -B represents the tolerance of Lactobacillus reuteri ZY18 to bile salts.
[0026] Figure 5 The bile salt hydrolase activity of Lactobacillus reuteri ZY18.
[0027] Figure 6 The antibacterial properties of Lactobacillus reuteri ZY18.
[0028] Figure 7 The hemolytic properties of Lactobacillus reuteri ZY18; among which, Figure 7 -A represents the hemolysis status of Escherichia coli K88 as a positive control; Figure 7 -B indicates the hemolysis status of Lactobacillus reuteri ZY18.
[0029] Figure 8 The surface hydrophobicity and self-polymerization ability of Lactobacillus reuteri ZY18; among which, Figure 8 -A represents the surface hydrophobicity of Lactobacillus reuteri ZY18; Figure 8 -B represents the self-polymerization ability of Lactobacillus reuteri ZY18.
[0030] Figure 9 The adhesion of Lactobacillus reuteri ZY18 to Caco-2 and IPEC-J2 cells.
[0031] Figure 10 The effects of Lactobacillus reuteri ZY18 on growth performance and fecal lactobacillus and Escherichia coli flora in mice were investigated; among them, Figure 10 -A represents the effect of Lactobacillus reuteri ZY18 on mouse body weight; Figure 10 -B represents the effect of Lactobacillus reuteri ZY18 on daily food intake in mice; Figure 10 -C represents the effect of Lactobacillus reuteri ZY18 on the lactobacillus and Escherichia coli flora in mouse feces on day 14 of the experiment; Figure 10 -D represents the effect of Lactobacillus reuteri ZY18 on the lactobacillus and Escherichia coli flora in mouse feces on day 21 of the experiment.
[0032] Figure 11 The effects of Lactobacillus reuteri ZY18 on the pathology, inflammation scores, and ileum mucoproteins of mice were investigated; among which, Figure 11-A shows hematoxylin-eosin stained pathological sections of the jejunum, ileum, and colon of mice in the Con, K88, ZY15-K88, and ZY18-K88 groups; light blue arrows indicate the mucosal epithelium, gold arrows indicate crypts, and yellow arrows indicate the submucosa; dark blue arrows indicate extensive neutrophil and mononuclear cell infiltration in the deep mucosa, and small vessel proliferation in the serosa and lamina propria; black arrows indicate scattered neutrophil and mononuclear cell infiltration, local crypt damage, and loss in the lamina propria; red arrows indicate angiogenesis in the lamina propria; green arrows indicate fibrous tissue proliferation in the lamina propria at sites of significant inflammation. Figure 11 -B represents the jejunal pathological inflammation score; Figure 11 -C represents the ileal pathological inflammation score; Figure 11 -D represents the colonic inflammation score; Figure 11 -E represents the gene expression level of ileal mucin Mcu2; Figure 11 -F represents the gene expression level of the ileal atresia small band protein ZO-1.
[0033] Figure 12 For differentially expressed genes analysis in the ileum; among them, Figure 12 -A represents the differential expression of specific mRNA genes in the Con group and K88 group samples; Figure 12 -B represents the differential expression of specific mRNA genes in samples from the K88 group and the ZY18-K88 group; Figure 12 -C represents the differential expression of specific mRNA genes in the ZY18-K88 and ZY15-K88 group samples.
[0034] Figure 13 The effects of Lactobacillus reuteri ZY18 on intestinal permeability and antioxidant capacity in mice; among which, Figure 13 -A represents the serum diamine oxidase (DAO) level; Figure 13 -B represents the fluorescence intensity of serum reactive oxygen species (ROS). Figure 13 -C represents the serum superoxide dismutase (SOD) level.
[0035] Figure 14 The effect of Lactobacillus reuteri ZY18 on the cecal flora of mice; among which, Figure 14 -A represents the effect of Lactobacillus reuteri ZY18 on the cecal bacterial phylum level in mice; Figure 14 -B represents the effect of Lactobacillus reuteri ZY18 on the level of bacterial families in the cecum of mice; Figure 14 -C represents the effect of Lactobacillus reuteri ZY18 on the level of bacteria in the cecum of mice. Detailed Implementation
[0036] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments described are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.
[0037] Example 1: Isolation, purification, and molecular biological identification of Lactobacillus reuteri ZY18
[0038] 1. Experimental Methods
[0039] 1.1 Isolation and purification of strain ZY18
[0040] Take 1 g of feces from a weaned piglet using sterile forceps, serially dilute it with sterile physiological saline buffer, and shake well. Take 100 μL of each diluted sample (10 times dilution). -5 10 -6 10 -7 The bacterial culture was spread onto MRS solid medium and incubated at 37°C for 24 h. Single colonies were picked for Gram staining and microscopic examination. Gram-positive single bacilli were selected and purified by streaking on MRS solid medium (Solarbio, Beijing, China, catalog number: M8330) at least three times. Colonies with larger size and stronger reproductive capacity were selected.
[0041] 1.2 Molecular biological identification of strain ZY18
[0042] Bacterial DNA was extracted according to the instructions (TianGen Co., Ltd., Beijing, China, Catalog No.: DP302), and then amplified using the universal primers 27F / 1492R for bacterial 16S rDNA. After PCR amplification, the DNA was identified by 2% agarose gel electrophoresis and then sequenced. The results were compared with the NCBI database.
[0043] 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 1);
[0044] 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO. 2).
[0045] 2. Experimental Results
[0046] The colony and cell morphology characteristics of strain ZY18 are as follows: Figure 1 As shown, the colonies of strain ZY18 on MRS solid medium are nearly round in shape, milky white in color, and glossy. Figure 1-A); after Gram staining, Gram-positive bacteria with a rod-shaped morphology can be observed under a microscope. Figure 1 -B).
[0047] PCR amplification was performed using universal primers for bacterial 16S rDNA, yielding a band approximately 1400 bp in length. The PCR product was sent for sequencing, and the 16S rDNA sequencing results were compared with similar sequences in the NCBI database (accession numbers: CP006011.1, MN537548.1, CP110802.1, MT707273.1, CP014786.1, KU754503.1). All sequences showed homology exceeding 99%, confirming that strain ZY18 is *Lactobacillus reuteri*. Lactobacillus reuteri ).
[0048] Experimental Example 1: Growth and acid production characteristics of Lactobacillus reuteri ZY18
[0049] 1. Experimental Methods
[0050] Two generations of activated Lactobacillus reuteri ZY18 bacterial culture were inoculated into 30 mL of MRS liquid medium at an inoculation rate of 1%, and incubated in a 37 ℃ incubator for 24 h. The absorbance (OD) was measured every h starting from 0 h. 600 The pH value was measured continuously for 26 hours; the pH value was measured once every 24 hours, and once at 24 hours and 48 hours; Lactobacillus reuteri ZY18 bacterial culture was selected after 14 hours of culture, and the lactic acid content (mmol / L) in the culture medium was determined according to the method of Nanjing Jiancheng Lactic Acid Kit.
[0051] 2. Experimental Results
[0052] The test results are as follows Figure 2 As shown, Lactobacillus reuteri ZY18 continued to grow after inoculation, with the fastest growth rate after 3 hours, entering the logarithmic growth phase. After 13 hours, the growth of the strain slowed down and entered the plateau phase. Figure 2 -A); The pH value of Lactobacillus reuteri ZY18 bacterial culture gradually decreased after inoculation, and after 24 hours the pH value of the bacterial culture tended to level off and basically stabilized at around 4.38. Figure 2 -B); The lactic acid concentration of Lactobacillus reuteri ZY18 culture after 14 h was 56.37 mmol / L ( Figure 2 -C).
[0053] Experimental Example 2: Tolerance of Lactobacillus reuteri ZY18 to a Simulated Gastrointestinal Environment
[0054] 1. Experimental Methods
[0055] One mL of activated Lactobacillus reuteri ZY18 culture was inoculated into simulated gastric and intestinal fluids filtered and sterilized through a 9 mL microporous membrane (0.22 μm). The cultures were incubated aerobically at 37°C for 3 h. The OD values of the cultures were measured at 0 h, 0.5 h, and 3 h, respectively. Simultaneously, plate colony counts were performed to calculate the survival rate.
[0056] 2. Experimental Results
[0057] The test results are as follows Figure 3 As shown, in a simulated gastric fluid environment, the survival rate of *Lactobacillus reuteri* ZY18 was 24.00% at 0.5 h and 18.37% at 3.0 h. Figure 3 -A); In a simulated intestinal fluid environment, the survival rate of Lactobacillus reuteri ZY18 was 46.00% at 0.5 h and 15.31% at 3.0 h. Figure 3 -B).
[0058] Experimental Example 3: Acid and bile salt tolerance test of Lactobacillus reuteri ZY18
[0059] 1. Experimental Methods
[0060] The pH of the MRS liquid medium was adjusted to 2.0, 3.0, 4.0, and 5.0 using 1 mol / L hydrochloric acid. The MRS media at different pH values were sterilized at 121℃ for 15 min and then cooled for later use. *Lactobacillus reuteri* ZY18 was inoculated into the MRS liquid medium at different pH values at a 1% (v / v) inoculation rate and cultured at 37℃ for 24 h. The OD values were then measured. 600 Lactobacillus reuteri ZY18 cultured in MRS without pH adjustment was used as a control CT. The survival rate and actual OD were calculated. 600 Value / Corresponding OD of CT 600 ×100%.
[0061] A certain amount of porcine bile salt was added to MRS liquid culture medium to adjust the final concentrations of porcine bile salt in the MRS medium to 0 (control), 0.15%, 0.30%, and 0.60%, respectively. The MRS cultures containing different concentrations of bile salt were sterilized at 121 °C for 15 min and then cooled for later use. *Lactobacillus reuteri* ZY18 was inoculated at a rate of 1% (v / v) into the MRS liquid culture media containing different concentrations of porcine bile salt, with a bile-free medium used as a control. The cultures were incubated at 37 °C for 24 h, and the OD was measured. 600 Values are used to assess bile salt tolerance effectiveness, and the survival rate is calculated using actual OD values. 600 Value / Corresponding OD of CT 600 ×100%.
[0062] 2. Experimental Results
[0063] The test results are as follows Figure 4 As shown, in a simulated acidic environment, the survival rate of *Lactobacillus reuteri* ZY18 was 11.61% at pH 2, 11.48% at pH 3, 54.85% at pH 4, and 85.04% at pH 5. Figure 4 -A); In simulated bile salt environments, the survival rate of *Lactobacillus reuteri* ZY18 was 2.85% in a 0.15% bile salt environment, 5.60% in a 0.30% bile salt environment, and 19.74% in a 0.60% bile salt environment. Figure 4 -B).
[0064] Experimental Example 4: Bile Salt Hydrolysin Activity Test of Lactobacillus reuteri ZY18
[0065] 1. Experimental Methods
[0066] Sterilized filter paper discs were gently pressed onto bile salt hydrolase solid medium (2.0 g ox bile salt, 2.0 g sodium thioglycolate, 3.7 g CaCl2, and 20.0 g agar powder dissolved in 1000 mL of medium MRS medium) using sterile forceps. 20 μL of activated Lactobacillus reuteri ZY18 bacterial suspension was added to the filter paper discs. The discs were then cultured anaerobically at 37 °C for 72 h. The filter paper discs were used as a control with added MRS liquid medium. The presence of white precipitate around the filter paper discs after culture was observed. If white precipitate was produced, it could be preliminarily confirmed that Lactobacillus reuteri ZY18 had bile salt hydrolase activity.
[0067] 2. Experimental Results
[0068] The test results are as follows Figure 5 As shown, lactic acid bacteria produce bile salt hydrolase (BSH), which can hydrolyze bound bile salts into unbound bile salts. These unbound bile salts can then react with calcium in the culture medium under acidic conditions. 2+ They combine to form a precipitate. Therefore, Lactobacillus reuteri ZY18 has strong BSH activity.
[0069] Experimental Example 5: Antibacterial Test of Lactobacillus reuteri ZY18
[0070] 1. Experimental Methods
[0071] Pathogenic bacteria (Escherichia coli K88, Escherichia coli K99, Staphylococcus aureus, and Salmonella) were inoculated separately into 50 mL LB liquid medium at a dose of 1 / 1000 (50 μL) and incubated at 37 °C for 12 h for activation. The LB solid medium was then cooled to approximately 50 °C. (The text abruptly ends here, so the translation stops as well.) 6 Add an inoculum of CFU / mL to the culture medium at a rate of 1 / 1000, mix thoroughly, and pour into a petri dish to cool. Place three sterilized Oxford cups evenly in the petri dish, then add 200 μL of Lactobacillus reuteri ZY18 culture medium and 200 μL of MRS liquid medium as controls to the Oxford cups respectively, and incubate at 37 ℃ for 24 h. Observe and measure the size of the inhibition zone and record the diameter of the inhibition zone.
[0072] 2. Experimental Results
[0073] The test results are as follows Figure 6 As shown, the inhibition zone diameter of Lactobacillus reuteri ZY18 against Escherichia coli K88 was 1.90 cm, against Escherichia coli K99 was 1.88 cm, against Staphylococcus aureus was 1.87 cm, and against Salmonella was 1.90 cm.
[0074] Experimental Example 6: Hemolysis test of Lactobacillus reuteri ZY18
[0075] 1. Experimental Methods
[0076] Two generations of activated Lactobacillus reuteri ZY18 was streaked onto Columbia blood agar medium (ThermoFisher Scientific, Waltham, USA, catalog number: CM0331B-A) and incubated at 37 °C for 48 h, with Escherichia coli K88 as the control strain.
[0077] 2. Experimental Results
[0078] The test results are as follows Figure 7 As shown, a clear hemolytic ring appears around E. coli K88, indicating β-hemolysis. Figure 7 -A); No hemolytic ring appeared around Lactobacillus reuteri ZY18, indicating gamma hemolysis, which is safe ( Figure 7 -B).
[0079] Test Example 7: Surface hydrophobicity and self-polymerization ability test of Lactobacillus reuteri ZY18
[0080] 1. Experimental Methods
[0081] Surface hydrophobicity was determined using a modified method based on microbial adhesion to carbon hydroxyl compounds. *Lactobacillus reuteri* ZY18 was cultured statically at 37 °C for 24 h, then centrifuged at 5000 rpm for 10 min at 4 °C. The supernatant was discarded, and the precipitate was collected. The bacterial cells were washed twice with sterile PBS buffer and then resuspended in sterile 0.1 M KNO3 solution to adjust the bacterial suspension concentration to 10. 7 ~10 8 CFU / mL, OD 600 The absorbance was 0.5 ± 0.2 (A0). 3 mL of bacterial suspension was taken and 1 mL of xylene was added. The mixture was vortexed for 3 min and allowed to stand at room temperature for 20 min. The aqueous phase was then sampled and its absorbance (A1) was measured at 600 nm. Surface hydrophobicity (%) = (1 - A1 / A0) × 100.
[0082] The method for determining self-polymerization ability was based on the reported method with appropriate modifications. Freshly cultured *Lactobacillus reuteri* ZY18 was centrifuged at 4 °C and 5000 rpm for 10 min, the supernatant was discarded, and the bacterial cells were collected. The bacterial cells were washed twice with sterile PBS buffer and resuspended in sterile PBS buffer to adjust the concentration of the *Lactobacillus reuteri* ZY18 suspension to 10. 7 ~10 8 CFU / mL, OD 600 Reaching 0.5 ± 0.2 (A) 0h 2 mL of cell suspension was vortexed for 10 s, incubated at 37 ℃ for 2 h, and 1 mL of the supernatant was collected and its absorbance at 600 nm was measured (A). 2h Self-aggregation ability (%) = 1 - (A) 2h / A 0h )×100.
[0083] 2. Experimental Results
[0084] Bacterial surface hydrophobicity is widely used in basic experiments to reflect bacterial adhesion. Self-aggregation ability plays a crucial role in bacterial biofilm formation and also influences the colonization of lactic acid bacteria in the gut. Experimental results are as follows... Figure 8 As shown, the surface hydrophobicity of Lactobacillus reuteri ZY18 is 81.81% ( Figure 8 -A), with a self-aggregation ability of 42.10% ( Figure 8 -B).
[0085] Experimental Example 8: Cell Adhesion Assay of Lactobacillus reuteri ZY18
[0086] 1. Experimental Methods
[0087] The adhesion ability of *Lactobacillus reuteri* ZY18 to Caco-2 and IPEC-J2 cells was detected by microscopic examination. Caco-2 / IPEC-J2 cells were seeded in 6-well plates and incubated at 37 ℃ in a 5% CO2 incubator. The culture medium was changed every other day. When the cells reached a monolayer and the degree of aggregation exceeded 80%, the culture medium was aspirated, and the cells were washed twice with sterile PBS buffer. 1 mL of a pre-adjusted concentration (10) was then added. 6 Lactobacillus reuteri (CFU / mL) or an equal volume of DMEM solution (Solarbio, Beijing, China, catalog number: 31600-20*500 mL) was used as a control and incubated in a 5% CO2 incubator at 37°C for 2 h. The cells were then washed twice with sterile PBS to remove any unattached Lactobacillus reuteri ZY18, fixed with methanol for 30 min, and Gram-stained (0.5% crystal violet). Twenty fields of view were randomly selected under an oil immersion microscope (1000×) to observe the adhesion of Lactobacillus reuteri ZY18 to Caco-2 cells / IPEC-J2 cells.
[0088] 2. Experimental Results
[0089] The test results are as follows Figure 9 As shown, Lactobacillus reuteri ZY18 has an intact morphology, and it was also found that Lactobacillus reuteri ZY18 has good adhesion ability around Caco-2 cells and IPEC-J2 cells.
[0090] Experimental Example 9: Application Experiment of Lactobacillus reuteri ZY18
[0091] 1. Experimental Design
[0092] The experiment employed a completely randomized design, using 80 four-week-old C5BL / 6 mice, randomly divided into four treatment groups of 20 mice each, with each mouse serving as a replicate. The pre-feeding period was one week, and the formal experimental period was 21 days. During the experiment, the diets of the control group and all experimental groups were identical. During the experiment, the ZY18-K88 group was administered *Lactobacillus reuteri* ZY18 (as described in this invention) via gavage daily, while the ZY15-K88 group was administered *Lactobacillus reuteri* ZY15 (microbial preservation number: CGMCC No. 28937) disclosed in CN118460435A via gavage daily. The gavage dose for both groups was 200 µL per mouse, and the bacterial concentration was 1.0 × 10⁻⁶. 9 CFU / mL; control group (Con) and K88 group mice were administered the same dose of MRS medium without Lactobacillus reuteri via gavage daily. On days 15, 17, 19, and 21 of the experiment, mice in the K88, ZY15-K88, and ZY18-K88 groups were challenged with enterotoxigenic Escherichia coli K88 via gavage at a dose of 200 µL / mouse, with a bacterial concentration of 1.0 × 10⁻⁶ CFU / mL; 9CFU / mL; Con group mice were administered the same dose of LB medium without enterotoxigenic Escherichia coli K88 via gavage daily. Mice had free access to food and water during the experiment and were housed in the same environment at 25°C with a 12-hour light / dark cycle. Mice were euthanized on day 22 after blood was collected from their eyes.
[0093] 2. Sample collection and index determination
[0094] 2.1 Growth performance
[0095] During the experiment, mice were weighed once a week, and their weight and food intake were recorded to calculate the average daily food intake.
[0096] 2.2 Detection of Lactobacillus and Escherichia coli in feces
[0097] Fecal samples were collected from mice in each group on days 14 and 21 of the experiment. 0.1 g of fecal sample was added to 1 mL of sterile saline. After homogenization using a 1 mm sterile steel ball, the mixture was serially diluted to 1.0 × 10⁻⁶. -6 100 μL of the sample was spread onto Eosin Methylene Blue Agar (EMB, Solarbio, Beijing, China, Catalog No.: LA2220) and MRS agar plates using sterile glass beads. After aerobic incubation at 37°C for approximately 18 h, the bacterial flora of Lactobacillus and Escherichia coli were counted.
[0098] 2.3 Intestinal pathology and inflammation score
[0099] After the experiment, mice were anesthetized with sevoflurane, blood was collected, and the mice were euthanized. The jejunum, ileum, and colon were separated, and a 1 cm segment of the intestine was fixed and preserved in 4% paraformaldehyde solution. Paraffin sections were prepared, stained with hematoxylin and eosin, and the intestinal morphology was measured and pathologically observed under a microscope. The pathological scoring criteria for tissue inflammation are shown in Table 1. For each sample of jejunum and ileum tissue, three typical locations were selected, and three complete crypt villi were selected from each location. The villi height and the depth of adjacent crypts were measured, and the ratio was calculated.
[0100] Table 1. Tissue Injury and Inflammation Scores
[0101]
[0102] 2.4 Ileal Transcriptome Sequencing Analysis
[0103] After the experiment, ileum tissue was harvested using sterile surgical scissors, rinsed with sterile saline, and stored in 2 mL cryovials at -80°C until analysis. Transcriptome sequencing was performed by the company. Total RNA was extracted from the ileum samples using an RNA extraction kit (Qiagen, Hilden, Germany), and RNA concentration and purity were determined using NanoDrop 2000. After cDNA library construction and quality testing, the libraries were sequenced on the Illumina Novaseq platform. Differential expression analysis between the two groups was performed using the DESeq2 R software package (v.1.20.0). Correction P Genes with a value <0.05 are differentially expressed genes.
[0104] 2.5 Real-time quantitative PCR detection
[0105] Total RNA was extracted from ileal samples using an RNA extraction kit. Total RNA concentration and quality were measured using a NanoDrop 2000 spectrophotometer; a high-quality absorbance ratio (260 / 280 nm) of 1.8–2.0 was observed. 1 μg of RNA was reverse transcribed into cDNA using the PrimeScript™ RTreagent kit. The resulting cDNA was diluted 5-fold and stored at -80°C for later use. GAPDH The gene is an internal reference gene, and SYBR is used. ® Premix Ex Taq TM Reagents and Applied Biosystems QuantStudio TM The relative expression levels of candidate genes were detected using a real-time PCR system. The nucleotide sequences of the real-time quantitative PCR primers are shown in Table 2. Amplification program: 95℃ for 30 s, 40 cycles: 95℃ for 5 s, 60℃ for 30 s, then 95℃ for 10 s, increasing the temperature by 0.5℃ per cycle until reaching 95℃ and holding for 15 s, followed by 65℃ for 15 s. All samples were performed in triplicate, using 2... −△△Ct The method calculates the relative expression levels of candidate genes.
[0106] Table 2 Primer Sequences for Real-Time Quantitative PCR
[0107]
[0108] 2.6 Intestinal permeability and serum antioxidant assay
[0109] On day 22 of the experiment, blood was collected from mice by enucleation and placed in centrifuge tubes. After standing at room temperature for 2 hours, the cells were centrifuged at 3000×g for 15 minutes at 4°C. The serum was then separated and aliquoted into 2 mL cryovials and stored at -80°C for later analysis. Serum antioxidant and intestinal permeability indicators were measured using ELISA and biochemical reagent kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China, DAO: ml002199, SOD: ml105860, ROS: ml092661) according to the manufacturer's instructions.
[0110] 2.7 Cecal Microbial Detection
[0111] Total genomic DNA was extracted from cecal chyme using a fecal DNA kit (TianGen Co., Ltd., Beijing, China, catalog number: DP328-02). The variable region V3-V4 of the 16S rRNA gene was amplified using universal primers 341F / 806R. All generated amplicons were homogenized and then purified using a kit (Qiagen, Duesseldorf, Germany). Sequencing libraries were constructed using the TruSeq® DNA PCR-Free Sample Preparation Kit according to the instructions. After assessing the quality of the sequencing libraries, they were sequenced using the Illumina NovaSeq platform. For previously obtained valid sequences, initial amplicon sequence variants (asv) were generated using QIIME2 software (v.QIIME2-202006) (default: DADA2), with asvs less than 5 abundance being filtered out. The Alpha diversity index was calculated using QIIME2 to analyze the diversity, richness, and evenness of the bacterial community in the sample.
[0112] The nucleotide sequence of the universal primer 341F / 806R is shown below:
[0113] 341F: CCTAYGGGRBGCASCAG (SEQ ID NO.9);
[0114] 806R: GGACTACNNNGGGTATCTAAT (SEQ ID NO. 10).
[0115] 2.8 Statistical Analysis
[0116] Data were statistically analyzed using SPSS 22.0 (IBM Corp., Armonk, NY, USA). One-way ANOVA was performed using the method of comparing means, and Duncan's method was used for multiple comparisons when there were significant differences between groups. GraphPad Prism (v.9.0, GraphPad Software, San Diego, CA, USA) was used for plotting. Data are expressed as mean ± standard error. P <0.05 is considered statistically significant, indicated by "*"; P <0.01 indicates a highly significant difference, indicated by "**".
[0117] 3. Experimental Results
[0118] 3.1 Growth performance
[0119] The test results of growth performance are as follows Figure 10 As shown. Compared with the Con group and K88 group, gavage administration of Lactobacillus reuteri ZY18 significantly increased the body weight of mice on day 14 of the experiment ( P ≤ 0.05) Figure 10 -A), significantly reduced the average daily food intake in mice ( P ≤0.05) Figure 10 -B); Although the body weight of mice in the Lactobacillus reuteri ZY15 group increased slightly after gavage, the increase was not significant. P ≥ 0.05) Figure 10 -A). Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly reduced the body weight of mice on day 21 of the experiment ( P ≤ 0.05) Figure 10 -A), reducing the average daily feed intake during the 14-21 day period ( P ≥ 0.05) Figure 10 -B); Compared with the K88 group, gavage administration of Lactobacillus reuteri ZY15 significantly increased the body weight of mice on day 21 of the experiment ( P ≤ 0.05) Figure 10 -A), oral administration of Lactobacillus reuteri ZY18 significantly increased the body weight of mice on day 21 of the experiment ( P ≤ 0.01) Figure 10 -A).
[0120] On day 14 of the experiment, gavage administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 significantly increased the number of lactic acid bacteria in mouse feces. P ≤ 0.05), had no significant effect on the number of fecal Escherichia coli. P ≥ 0.05) Figure 10-C). On day 21 of the experiment, gavage administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 significantly increased the number of lactic acid bacteria in mouse feces (C). P ≤ 0.01); Compared with the Con group, mice in the K88 group, ZY15-K88 group, or ZY18-K88 group showed a highly significant increase in the number of Escherichia coli in their feces ( P ≤ 0.01), but compared with the K88 group, gavage administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 significantly reduced the number of Escherichia coli in mouse feces ( P ≤ 0.01), there was no significant difference between the ZY15-K88 group and the ZY18-K88 group ( P ≥ 0.05) Figure 10 -D).
[0121] 3.2 Intestinal pathology and inflammation score
[0122] The test results are as follows Figure 11 As shown in the figure. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 induced neutrophil and mononuclear cell infiltration into the serosal layer of the deep mucosa of the ileum, colon, and jejunum, local mucosal erosion and crypt disappearance, angiogenesis of the lamina propria and proliferation of fibrous tissue in the lamina propria, leading to epithelial damage and local mucosal erosion. Oral administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 had a significant ameliorative effect. Figure 11 -A). Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly increased the pathological inflammation scores of the ileum, colon, and jejunum. P ≤ 0.01); compared with the K88 group, gavage administration of Lactobacillus reuteri ZY15 significantly reduced the pathological inflammation scores of the jejunum and ileum ( P ≤ 0.05), but the reduction in colonic function was not significant ( P ≥0.05); Gavage administration of Lactobacillus reuteri ZY18 significantly reduced the pathological inflammation scores of the jejunum, ileum, and colon ( P ≤ 0.01), the pathological inflammation scores of the ileum, colon, and jejunum in the ZY18-K88 group were significantly lower than those in the ZY15-K88 group ( P ≤ 0.01), but there was no significant difference between the group and the Con group ( P ≥ 0.05) Figure 11 -B, Figure 11 -C, Figure 11 -D). ZY18-K88 group mice ileum intestinal mucin Muc2 and tight junction proteins ZO-1 The relative expression levels of mRNA genes were significantly higher in the K88 group and the Con group than in the K88 group and the Con group, respectively. P ≤0.05), no significant changes were observed in the ZY15-K88 group mice ( P≥ 0.05) Figure 11 -E, Figure 11 -F). Based on the combined pathological scores of the ileum, colon, and jejunum and the expression levels of intestinal barrier genes, Lactobacillus reuteri ZY18 showed significantly better improvement in intestinal barrier damage and inflammation caused by enterotoxigenic Escherichia coli (ETEC) K88 than Lactobacillus reuteri ZY15.
[0123] 3.3 Observation of intestinal morphology
[0124] The observation results are shown in Table 3. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly reduced the ratio of jejunal villus height to crypt depth. P ≤ 0.01), there were no significant differences among the K88 group, ZY15-K88 group, and ZY18-K88 group. P ≥ 0.05). Compared with the Con group, the ileal villus height and the ratio of villus height to crypt depth were significantly decreased in the K88 and ZY15-K88 groups. P ≤ 0.01); Compared with the K88 group, the height of ileal villi and the ratio of villi height to crypt depth were significantly increased in the ZY15-K88 and ZY18-K88 groups. P ≤ 0.01), the depth of the ileal recess was significantly reduced ( P ≤0.01); The height of ileal villi and the ratio of villi height to crypt depth in the ZY18-K88 group mice were significantly higher than those in the ZY15-K88 group ( P ≤ 0.01), there was no significant difference in ileal recess depth between the two groups ( P ≥ 0.05); The height of ileal villi and the ratio of villi height to crypt depth in the ZY18-K88 group mice were numerically higher than those in the Con group, but there was no significant difference between the two groups. P ≥0.05). Based on the combined morphological measurements of the jejunum and ileum, Lactobacillus reuteri ZY18 showed a significantly better effect than Lactobacillus reuteri ZY15 in improving the small intestinal barrier and nutrient digestion and absorption function caused by enterotoxigenic Escherichia coli (ETEC) K88.
[0125] Table 3. Effects of Lactobacillus reuteri on the morphology of mouse jejunum and ileum.
[0126]
[0127] Note: The presence of the same letter or the absence of a letter in the data from the same peer indicates that the difference is not significant. P >0.05), different lowercase letters indicate significant differences ( P <0.05).
[0128] 3.4 Ileal Transcriptome Sequencing Analysis
[0129] The test results are as follows Figure 12 As shown. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly increased. IL- 1b , HIF , IL-17 , TNF-α , IL-6 , AKT , mTOR The relative expression level of genes ( P ≤ 0.05), significantly reduced EIF4 , iNOS , Muc2 , IL-22 The relative expression level of genes ( P ≤ 0.05) Figure 12 -A). Compared with the K88 group, gavage administration of Lactobacillus reuteri ZY18 significantly improved... IL-10 , IL-22 , IL-23 , cld1 , IL-10rb , Muc1 , IL-22ra The relative expression level of genes ( P ≥ 0.05), reduced IL-17a , IL-6 , IL-17rc The relative expression level of genes ( P ≥ 0.05) Figure 12 -B). Compared with the ZY15-K88 group, oral administration of Lactobacillus reuteri ZY18 significantly improved... Cldnd1 , IL-18 , IL-4 The relative expression level of genes ( P ≤ 0.05), significantly reduced IL-11 , Tnfaip2 , IL-6a , IL-17rc The relative expression level of genes ( P ≤0.05) Figure 12 -C). Compared with the K88 group and the ZY15-K88 group, gavage administration of Lactobacillus reuteri ZY18 significantly increased the relative expression level of anti-inflammatory cytokine-related genes and decreased the relative expression level of pro-inflammatory cytokine-related genes.
[0130] 3.5 Intestinal permeability and serum antioxidant capacity
[0131] The test results are as follows Figure 13 As shown. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly increased the levels of serum diamine oxidase (DAO) and reactive oxygen species (ROS) in mice. P≤ 0.01), significantly reduced serum superoxide dismutase (SOD) protein expression level ( P ≤ 0.01) Figure 13 -A, Figure 13 -B, Figure 13 -C); Serum ROS levels in mice in the ZY15-K88 and ZY18-K88 groups were significantly increased ( P ≤ 0.01), there was no significant difference between the ZY15-K88 group and the ZY18-K88 group ( P ≥0.05) Figure 13 -B). Compared with the K88 group, gavage administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 significantly reduced serum DAO levels ( P ≤ 0.01), significantly increasing serum SOD protein levels ( P ≤ 0.01), serum ROS levels in mice in the ZY18-K88 group were significantly reduced ( P ≤ 0.05), there was no significant difference between the ZY15-K88 group and the K88 group ( P ≥ 0.05) Figure 13 -A, Figure 13 -B, Figure 13 -C). In summary, oral administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 can reduce intestinal permeability and enhance the body's antioxidant capacity in mice.
[0132] 3.6 Cecal microbiota diversity
[0133] The experimental results are shown in Table 4. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly reduced the Shanon index of the cecal flora in mice. P ≤ 0.01), reduces Observe_species, Chao1, and Simpson indices ( P ≥0.05). The cecal microbiota observations, Chao1, and Shanon indices of mice in the ZY15-K88 and ZY18-K88 groups were higher than those in the K88 group. P ≥ 0.05), the Alpha diversity index of the cecal microbiota in the ZY18-K88 group was higher than that in the ZY15-K88 group ( P (≥0.05). In summary, oral administration of Lactobacillus reuteri ZY15 and ZY18 can alleviate the decrease in Alpha diversity of the intestinal flora in mice induced by enterotoxigenic Escherichia coli (ETEC) K88 to some extent, with Lactobacillus reuteri ZY18 showing a better alleviating effect.
[0134] Table 4. Effects of Lactobacillus reuteri on Alpha diversity of mouse cecal flora.
[0135]
[0136] Note: The presence of the same letter or the absence of a letter in the data from the same peer indicates that the difference is not significant. P >0.05), different lowercase letters indicate significant differences ( P <0.05).
[0137] 3.7 Cecal Microbiota
[0138] The test results are as follows Figure 14 As shown. At the bacterial phylum level ( Figure 14 -A), compared to the Con group, ETEC K88 improved virus attack performance. Bacteroidota (Bacteroidetes) and Proteobacteria The relative abundance of (Proteobacteria) increased by 17.25% and 75.91%, respectively, while decreasing... Firmicutes (Firmwallis) and Verrucomicrobiota The relative abundance of (verrucous microbes) decreased by 23.28% and 65.31%, respectively. Compared with the Con group and the K88 group, the ZY15-K88 group and the ZY18-K88 group... Verrucomicrobiota The relative abundance increased from 0.49% and 0.17% to 7.68% and 11.08%, respectively. Compared with the K88 group, the ZY15-K88 group... Proteobacteria The relative abundance increased from 9.12% to 11.19%, an increase of 22.70%, in the ZY18-K88 group. Proteobacteria The relative abundance decreased from 9.12% to 7.78%, a reduction of 14.69%, compared to the ZY15-K88 group. Proteobacteria The relative abundance decreased by 30.47%; ZY15-K88 group and ZY18-K88 group Bacteroidota The relative abundance decreased by 17.87% and 11.40%, respectively.
[0139] At the bacteriological level ( Figure 14 -B) and genus ( Figure 14 -C) level, with Verrucomicrobiota Correspondingly, compared to the Con group, the K88 group Akkermansiaceae and Akkermansia The relative abundance of Akkermansia decreased from 0.45% to 0.16%, a reduction of 64.44%; compared to the K88 group, the ZY18-K88 group and the ZY15-K88 group... Akkermansiacea e and Akkermansia The relative abundance increased from 0.16% to 7.68% and 11.02%, respectively; compared with the ZY15-K88 group, the ZY18-K88 group... Akkermansiacea e and AkkermansiaThe relative abundance increased by 43.38%. Compared with the Con group, the K88 group... Parabacteroides The level increased from 0.53% to 2.75% in the K88 group, ZY15-K88 group, and ZY18-K88 group. Muribaculaceae The levels decreased from 39.44% to 30.48%, 26.99%, and 28.71%, respectively, representing reductions of 22.71%, 31.54%, and 27.20%. Compared to the K88 group, the ZY18-K88 group and the ZY15-K88 group... Parabacteroides The levels increased by 133.81% and 19.27% respectively, compared to the ZY15-K88 group. Parabacteroides The level increased by 96.03%, indicating that oral administration of Lactobacillus reuteri ZY15 and ZY18 can increase the number of beneficial bacteria in the gut. Akkermansia and Parabacteroides The enrichment of *Lactobacillus reuteri* ZY18 was better. Proteobacteria Correspondingly, compared to the Con group, the K88 group Enterobacteriaceae and Escherichia-Shigella The relative abundance of Escherichia coli and Shigella spp. increased from 0.80% and 0.53% to 7.50% and 5.16%, respectively; compared with the K88 group, the ZY15-K88 group... Enterobacteriaceae and Escherichia-Shigella The relative abundance increased from 7.50% and 5.16% to 8.08% and 7.98%, respectively, representing increases of 7.73% and 54.65%; ZY18-K88 group Enterobacteriaceae and Escherichia-Shigella The relative abundance decreased to 0.78% and 0.60%, respectively; compared with the ZY15-K88 group, the ZY18-K88 group... Enterobacteriaceae and Escherichia-Shigella The relative abundance decreased from 8.08% and 7.98% to 0.78% and 0.60%, respectively. This indicates that oral administration of Lactobacillus reuteri ZY18 can significantly inhibit harmful bacteria. Enterobacteriaceae and Escherichia-Shigella The relative abundance of *Lactobacillus reuteri* ZY18 was observed after gavage. In summary, *Lactobacillus reuteri* ZY18 was enriched in the intestinal tract by gavage. Akkermansia and Parabacteroides and inhibition Escherichia-Shigella It is significantly superior to Lactobacillus reuteri ZY15 in this respect.
Claims
1. A strain of Lactobacillus reuteri ( Lactobacillus reuteri ZY18, characterized in that, Its microbial preservation number is CGMCC No. 28938.
2. The use of Lactobacillus reuteri ZY18 as described in claim 1 in the preparation of antibacterial feed additives or animal drugs; wherein the bacteria are Escherichia coli, Staphylococcus aureus, or Salmonella; and wherein the animals do not include humans.
3. The use of Lactobacillus reuteri ZY18 as described in claim 1 in the preparation of a feed additive that promotes animal growth; wherein the animals do not include humans.
4. The use of Lactobacillus reuteri ZY18 as described in claim 1 in the preparation of feed additives or drugs for improving intestinal inflammation and damage in animals; wherein the improvement of intestinal inflammation in animals is to reduce the pathological inflammation score of the jejunum, ileum or colon; or to increase the relative expression level of anti-inflammatory cytokine-related genes; or to reduce the relative expression level of pro-inflammatory cytokine-related genes; The improvement of intestinal damage in animals is achieved by increasing the expression level of intestinal barrier genes or by increasing the height of ileal villi and the ratio of villi height to crypt depth. The animals mentioned do not include humans.
5. The use of Lactobacillus reuteri ZY18 as described in claim 1 in the preparation of feed additives that enhance the antioxidant capacity of animals; wherein the animals do not include humans.
6. The use of Lactobacillus reuteri ZY18 as described in claim 1 in the preparation of feed additives or animal drugs for regulating animal intestinal flora; wherein the animals do not include humans.
7. Use according to any one of claims 2 to 6, characterized in that, The animal in question is either a pig or a mouse.
Citation Information
Patent Citations
Lactobacillus reuteri having probiotic effect and resisting ETEC (Enterotoxigenic Escherichia Coli) and application
CN108004179A
Lactobacillus reuteri and application thereof
CN112358999A
Lactobacillus reuteri and application thereof as feed additive
CN118460435A