Anti-human PSGL-1 protein rabbit antibody and antibody conjugate and application thereof

Abstract

The invention belongs to the technical field of antibody preparation, and particularly relates to an anti-human PSGL-1 protein rabbit-derived antibody, an antibody conjugate and application of the anti-human PSGL-1 protein rabbit-derived antibody and the antibody conjugate. The amino acid sequences of CDR1-3 on a light chain variable region of the antibody are respectively shown as SEQ ID NO.3-5, and the amino acid sequences of CDR1-3 on a heavy chain variable region of the antibody are respectively shown as SEQ ID NO.8-10. The antibody strain provided by the invention can specifically and sensitively recognize the PSGL-1 protein on the human cell / tissue surface, has no cross reaction on other antigen components, provides an ideal tool for immunodetection of the human PSGL-1 level, is suitable for multi-scenario application, is especially suitable for application scenarios such as immunoblotting, immunofluorescence and flow cytometry, and has broad application prospects. The method has good market application potential in clinical diagnosis and scientific research detection of human PSGL-1 protein expression abnormality diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and particularly to a rabbit-derived antibody against human PSGL-1 protein, an antibody conjugate and their applications. Background Art

[0002] Leukocyte migration is a core process of the inflammatory response, which helps leukocytes quickly reach the inflammatory site, play a phagocytic and immune role, thereby clearing pathogens and damaged cells, and promoting tissue repair and regeneration. Selectins and their ligands play a key role in the process of leukocytes rolling out of the blood and attaching to vascular endothelial cells. Selectins are a class of calcium-dependent cell surface receptors, mainly expressed on endothelial cells and platelets, including P, E, and L-selectins; they mediate the rolling and attachment of leukocytes on the blood vessel wall by interacting with ligands on the surface of leukocytes.

[0003] P-selectin glycoprotein ligand 1 (P-selectin glycoprotein ligand 1, abbreviated as PSGL-1), also known as SELPLG or CD162, is a single-channel transmembrane sialomucin with a homodimeric structure on the surface of leukocytes and is one of the main ligands of selectins. The molecular weight of human PSGL-1 is about 140 kDa, among which the amino acid sequence at positions 20-711 is the extracellular domain, the amino acid sequence at positions 712-729 is the transmembrane domain, and the amino acid sequence at positions 730-1115 is the cytoplasmic domain. The extracellular domain contains an LPS / core 1 glycosyltransferase domain and multiple leucine-rich repeats (LRRs), and these domains are crucial for its high-affinity binding to selectins. PSGL-1 is mainly expressed on granulocytes, monocytes, lymphocytes, platelets, and also on macrophages in the intestinal mucosa and dendritic cells in lymph nodes.

[0004] The expression level of PSGL-1 rapidly increases under inflammatory conditions. During the occurrence of an inflammatory response, vascular endothelial cells will be activated and express selectins. PSGL-1 interacts with selectins, promoting the tight connection between leukocytes and vascular endothelial cells and prompting leukocytes to cross the vascular wall to the inflammatory site, playing a key role in the initial stage of the inflammatory response. The dysregulation of the PSGL-1 protein is related to inflammatory diseases and impaired immune responses, and has certain diagnostic value. In autoimmune diseases or immune deficiency states, the expression or function of PSGL-1 changes; for example, in systemic lupus erythematosus, leukocytes act on vascular endothelial cells through PSGL-1 and may be involved in the lesions of organs such as the skin and kidneys; therefore, detecting PSGL-1 helps to identify these immune abnormal states. In addition, in many solid tumors, PSGL-1 is also of great significance for tumor metastasis; PSGL-1 derived from tumor cells promotes tumor cell metastasis by binding to selectins on the surface of vascular endothelium, platelets, and leukocytes; therefore, an increase in the expression of this protein may indicate that tumor cells have a higher metastatic potential.

[0005] Currently, in clinical practice, the changes in the level of PSGL-1 protein on the surface of pathological cells / tissues are often detected by immunoblotting, flow cytometry, etc. The core of the aforementioned methods lies in the specific binding between antibodies and antigens. When the specificity of the antibody is poor, it will lead to the inability to effectively recognize the antigen, or may cross-react with many other antigens in the cells / tissues, thereby causing false negative / positive results. Therefore, the quality of the antibody directly determines the accuracy and reliability of the detection results. Most of the existing PSGL-1 antibodies on the market (companies such as BD, R&D, and Abcam) are murine antibodies, and their specificity needs to be improved. In addition, due to the complex subtype classification of murine antibodies and the preparation of tumor cells, there are large differences in antibody batches, which may affect consistency and stability. Therefore, developing anti-human PSGL-1 protein antibodies with good specificity, strong anti-interference ability, and easy preparation for cell / tissue detection has important market prospects. Summary of the Invention

[0006] Aiming at the problems in the prior art that anti-human PSGL-1 protein antibodies have poor specificity and anti-interference ability and are difficult to be used for immunodetection of cells / tissues, the present invention provides rabbit-derived antibodies and antibody conjugates against human PSGL-1 protein, and further provides the application of the rabbit-derived antibodies and antibody conjugates in the preparation of an immunodetection kit for human PSGL-1 protein and related immunodetection kits. To achieve the aforementioned objectives, the present invention is specifically realized through the following technical solutions:

[0007] The first aspect of the present invention provides a rabbit-derived antibody against human PSGL-1 protein, which includes a light chain variable region and a heavy chain variable region. The amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region are shown as SEQ ID NO.3-5 respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8-10 respectively.

[0008] Further, the amino acid sequence of the light chain variable region is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.7.

[0009] Further, the amino acid sequence of the antibody light chain is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.6.

[0010] Further, the antibody is a full-length antibody or its antigen-binding region; the antigen-binding region is selected from at least one of Fab fragment, F(ab) 2 fragment, Fv fragment, (Fv) 2 fragment, scFv fragment, and sc(Fv) 2 fragment.

[0011] The second aspect of the present invention provides an antibody conjugate, which includes the rabbit-derived antibody against human PSGL-1 protein as described above and a detection label connected to the antibody.

[0012] The third aspect of the present invention provides a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule, or a host cell containing the nucleic acid molecule, and the nucleic acid molecule encodes the rabbit-derived antibody against human PSGL-1 protein as described above.

[0013] Further, the nucleic acid sequence of the antibody light chain variable region is shown as SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.14 or a sequence complementary thereto.

[0014] Furthermore, the nucleic acid sequence of the antibody light chain is shown as SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.13 or a sequence complementary thereto.

[0015] The fourth aspect of the present invention provides the application of the rabbit-derived antibody against human PSGL-1 protein or the antibody conjugate as described above in the preparation of a human PSGL-1 protein immunoassay kit.

[0016] Further, the immunoassay kit is selected from an enzyme-linked immunosorbent assay kit, an enzyme-linked immunospot assay kit, an immunohistochemistry kit, an immunofluorescence kit, an immunoblot kit or a flow cytometry kit.

[0017] In the fifth aspect of the present invention, a human PSGL-1 protein immunoassay kit is provided, and the kit includes the rabbit-derived antibody or antibody conjugate against human PSGL-1 protein as described above.

[0018] The advantages and positive effects of the present invention are as follows:

[0019] 1. The antibody strain provided by the present invention can specifically and sensitively recognize the PSGL-1 protein on the surface of human cells / tissues, and has no cross-reaction with other antigen components, providing an ideal tool for immunoassay of human PSGL-1 level, being applicable to multi-scene applications, especially applicable to application scenarios such as immunoblotting, immunofluorescence and flow cytometry analysis, and having good market application potential in the clinical diagnosis and scientific research detection of diseases with abnormal expression of human PSGL-1 protein.

[0020] 2. The rabbit anti-structure provided by the present invention is simpler and relatively more stable than the mouse anti-structure, and the antibody preparation process is simple with low cost. Moreover, the antibody products obtained based on recombinant expression have good batch stability and high consistency. Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for description in the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0022] Figure 1 It is a detection result graph of the immune serum titer after immunizing a white rabbit with human PSGL-1 protein in Example 1 of the present invention;

[0023] Figure 2 It is a flow cytometry detection result graph of the immune serum binding positive cell samples after immunizing a white rabbit with human PSGL-1 protein in Example 1 of the present invention;

[0024] Figure 3 It is a pRB322 vector map for constructing a rabbit-derived antibody expression vector against human PSGL-1 protein in Example 1 of the present invention. From left to right are the vectors pre-carried with the constant region of the antibody light chain and the constant region of the heavy chain;

[0025] Figure 4 It is a flow cytometry detection result graph of the rabbit-derived antibody against human PSGL-1 protein binding positive cells and negative cells in Example 2 of the present invention;

[0026] Figure 5 This is the immunoblot detection result graph of the rabbit - derived antibody against human PSGL - 1 protein binding to positive cells / tissues and negative cells / tissues in Example 2 of the present invention;

[0027] Figure 6 This is the immunofluorescence detection result graph of the rabbit - derived antibody against human PSGL - 1 protein binding to positive cells in Example 2 of the present invention. Detailed implementation manners

[0028] In order to make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] Based on the information included in the present invention, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for illustrative purposes of specific aspects of the present invention. In fact, various changes that can be made by those skilled in the art in the relevant field to the embodiments of the present invention are all covered by the scope of the appended claims.

[0030] In order to better understand the present invention rather than limit its scope, all numbers representing amounts, percentages and other numerical values used in the present invention should be understood as being modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to different desired properties. Each numerical parameter should be regarded as being obtained at least according to the reported significant figures and by the conventional rounding method.

[0031] In addition, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of the present invention should have the meanings commonly understood by those of ordinary skill in the art.

[0032] The meanings of terms such as "comprise", "include", "contain", "have" and the like are non - restrictive, that is, other steps and other components can be added without affecting the results.

[0033] The term "and / or" should be regarded as a specific disclosure of each of two specified features or components with or without the other. For example, "A and / or B" is regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.

[0034] The terms "rabbit monoclonal antibody", "monoclonal antibody", "rabbit-derived antibody", "rabbit mAb" and similar terms have the same meaning, and unless otherwise specified, all refer to antibodies that specifically bind to human P-selectin glycoprotein ligand 1 (PSGL-1, CD162). The terms "PSGL-1", "CD162", "PSGL-1 / CD162", "P-selectin glycoprotein ligand 1", "P-Selectinglycoprotein ligand-1", "SELPLG", etc. have the same meaning. The modifier "rabbit" indicates that the complementarity-determining regions (CDRs) of the antibody are derived from rabbit immunoglobulin sequences.

[0035] An antibody is an immunoglobulin molecule that can specifically bind to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, as long as they exhibit the desired antigen-binding activity. An antibody fragment can be one or more parts or fragments of a full-length antibody that retain the ability of the antibody to specifically bind to the target antigen.

[0036] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). The light chains can be divided into two types, namely κ chains and λ chains; the heavy chains can be classified into five types, namely μ, δ, γ, α, and ε chains, and the antibodies are defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of the heavy and light chains vary greatly, while the amino acid sequences of other parts are relatively constant. The regions with relatively large amino acid sequence variations near the N-terminus in the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and the variable regions of the light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable regions are also called complementarity-determining regions (CDR), which are loop structures. The CDRs of the heavy chain and the CDRs of the light chain are closely juxtaposed and cooperate with each other through the FR regions to jointly form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the specificity of the antibody and being the site where the antibody recognizes and binds to the antigen. The FR regions are the more conserved parts of VH and VL. They generally adopt a β-sheet conformation and are connected by three CDRs that form linker loops. Each VH and VL usually consists of three CDRs and four FRs, arranged in the following order from the amino-terminus to the carboxyl-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0037] The CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, the cumulative of the Kabat definition and the Chothia definition, the AbM definition, the contact definition, the IMGT unique numbering definition, and / or the conformational definition or any CDR determination method well-known in the art. As used in the present invention, they are defined by the Kabat numbering system.

[0038] The constant regions of the light chain (CL) and the constant regions of the heavy chain (CH) do not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as participating in antibody-dependent cell cytotoxicity. The lengths of the CLs of different Ig types (κ or λ) are basically the same, but the lengths of the CHs of different Ig classes are different. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the constant regions of the antibody heavy and light chains are well-known in the art and can be obtained by querying the IMGT database.

[0039] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "intact antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0040] Antibody fragments are one or more parts or segments of a full-length antibody, which substantially retain the same biological function or activity as the full-length form. Specifically, antibody fragments at least include the same CDR regions as the full-length antibody, and more preferably have the same variable regions, thereby retaining a complete antigen recognition and binding site, and being able to bind to the same antigen as the full-length antibody, especially binding to the same epitope. In a typical example, antibody fragments include: Fab, F(ab) 2 ', Fab', F(ab') 2 ', Fv, (Fv) 2 ', scFv, sc(Fv) 2 , and these antibody fragments can be obtained by conventional techniques in the art.

[0041] (i) Fab: The antigen-binding fragment (Fab) is a monovalent fragment composed of a complete light chain (variable region and constant region) and a partial heavy chain (variable region and the first constant region). By protease digestion of the full-length antibody, fragments such as Fab, F(ab') 2 ', Fab' can be obtained. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab') 2 fragment and one pFc' fragment. The F(ab') 2 fragment is further reduced to form two Fab' fragments. Since Fab has an antigen-binding region and a partial constant region, it not only has the same antibody-antigen affinity as scFv, excellent tissue penetration, etc., but also has a more stable structure.

[0042] (ii) F(ab) 2 : A bivalent fragment containing two Fabs linked by a hinge region disulfide bridge.

[0043] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment and only contains the variable region, and is composed of the variable regions of one light chain and one heavy chain. It is a non-covalent dimer of a VH and a VL (VH-VL dimer). The 3 CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, and have the ability to recognize and bind antigens, although the affinity is lower than that of the full-length antibody.

[0044] (iv) (Fv) 2: It is composed of two Fv fragments covalently linked together.

[0045] (v) scFv: Single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, which is formed by connecting a heavy-chain variable region (VH) and a light-chain variable region (VL) through a flexible linker (usually composed of 10 - 25 amino acids). It retains the binding specificity of the original antibody to the antigen. In the present invention, the linker as long as it does not interfere with the expression of the antibody variable regions connected at both ends is acceptable and is not particularly limited. Compared with the full-length antibody, scFv has the characteristics of small molecular weight, so it has higher penetrability and lower immune side reactions.

[0046] (vi) sc(Fv) 2 fragment, which is formed by connecting two heavy-chain variable regions and two light-chain variable regions through a linker or the like.

[0047] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include the CDR regions and FR regions from rabbit immunoglobulin sequences. In other embodiments, the antibody may contain amino acid residues encoded by non-rabbit immunoglobulin sequences, such as humanized antibodies, chimeric antibodies, etc., to reduce the body rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to a part of the antibody derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody with the CDR regions of a non-human antibody such as a rabbit antibody and the FR regions from a human. In some cases, the variable region of a non-human antibody binds to the constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR regions of a non-human antibody bind to the FR regions and constant regions derived from human antibody sequences, that is, the CDR regions of a non-human antibody are grafted onto the human antibody framework (FR) sequence, and this framework sequence is derived from the FR sequences of a single or multiple other human antibody variable regions. In the present invention, the CDR regions in the chimeric antibody or humanized antibody are derived from rabbit CDR regions.

[0048] The terms "monoclonal antibody" or "mAb" and similar terms are used interchangeably and refer to a homogeneous population of antibodies, i.e., each antibody constituting the population is identical except for minor mutations and / or post-translational modifications (such as isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially the same epitope on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous population of antibodies and should not be construed as limiting the source or method of preparation of the antibody. The antibody can be prepared by a variety of methods, including but not limited to the hybridoma method, phage display method, yeast display method, recombinant DNA method, single cell screening or single cell sequencing method.

[0049] The term "specific binding" is a well-known term in the art. A molecule exhibits "specific binding" if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity with a particular target antigen or epitope than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding. To make the above objects, features, and advantages of the present invention more apparent and understandable, the following detailed description of the specific embodiments of the present invention will be made with reference to the accompanying drawings.

[0050] An embodiment of the present invention provides a rabbit-derived antibody against human PSGL-1 protein, which includes a light chain variable region and a heavy chain variable region. Both the light chain variable region and the heavy chain variable region include 3 complementarity determining regions (CDRs), named CDR1, CDR2, and CDR3 respectively. Among them, the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region are shown as SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10 respectively.

[0051] The present invention immunizes a New Zealand white rabbit with the antigen PSGL-1 protein, and then through B cell labeling and sorting technology, enriches and isolates B cells that can recognize PSGL-1 from the spleen of the immunized rabbit, cultures them in the form of single cells, and directly obtains monoclonal antibodies, eliminating the complex process of preparing mouse anti-hybridomas. Finally, the monoclonal antibody gene is expressed through genetic engineering recombinant expression technology to scale up the production of the target antibody strain. The antibody preparation process is simple and low-cost; moreover, the antibody products obtained based on recombinant expression have good batch stability and high consistency.

[0052] The antibody strain provided by the present invention can specifically recognize and bind to human PSGL-1 protein, providing an ideal tool for immunoassay of human PSGL-1 level, suitable for multi-scenario applications, especially for application scenarios such as immunoblotting, immunofluorescence, and flow cytometry analysis. Using the antibody of the present invention as the primary antibody to capture the target antigen, and constructing the above-mentioned detection systems by color development with fluorescently labeled secondary antibody, the results show that the antibody of the present invention can specifically and sensitively recognize the PSGL-1 protein on the surface of human cells / tissues, has no cross-reaction with other antigen components, has excellent anti-interference ability, ensures the specificity, reliability and high credibility of the detection results, and has no false positive and false negative results, and has good market application potential in the clinical diagnosis of human PSGL-1 protein expression abnormal diseases and scientific research detection.

[0053] Optionally, both the light chain variable region and the heavy chain variable region include 4 framework regions (FRs), and the 4 FRs and 3 CDRs are arranged alternately in sequence to form the variable region. The amino acid sequence of the light chain variable region (VL) of the antibody of the present invention is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7.

[0054] Optionally, the antibody of the present invention further includes a light chain constant region (CL) and a heavy chain constant region (CH), and CL and VL form a complete light chain (FL), and CH and VH form a complete heavy chain (FH). The constant region of the antibody can usually be obtained by public query, such as: by searching the IMGT online database (www.imgt.org) to obtain CH by searching for rabbit IgG gamma C reign, and obtaining CL by searching for rabbit IgGKappa C reign.

[0055] Specifically, the amino acid sequence of the light chain of the antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6.

[0056] It should be noted that the monoclonal antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or an antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length form. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining the complete antigen recognition and binding site, and being able to bind to the same antigen as the full-length antibody, especially binding to the same epitope. Optionally, the antigen-binding region is selected from Fab, F(ab) 2 、Fab’、F(ab’) 2 、Fv、(Fv) 2 、scFv and sc(Fv) 2at least one of these. These antigen-binding regions can be obtained by conventional techniques in the art.

[0057] Another embodiment of the present invention provides an antibody conjugate, comprising a rabbit antibody against human PSGL-1 protein as described above and a detection label linked to the antibody.

[0058] The detection label is used to generate a recognizable signal change to identify the antibody of the present invention according to the signal change, and then to identify the expression of PSGL-1 antigen in the sample to be detected through the specific reaction of antigen and antibody. The detection label includes but is not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0059] It should be emphasized that the antibody of the present invention can be used alone or linked to a detection label (covalently or non-covalently) to form an antibody conjugate. In some embodiments, the antibody of the present invention is used as an antigen-binding (or capture) antibody, which specifically recognizes and binds the PSGL-1 protein in the sample to be detected, and then qualitatively or quantitatively detects PSGL-1 by analyzing the signal of the detection label linked thereto; in other embodiments, the antibody against PSGL-1 protein is not labeled (as a primary antibody or capture antibody), but the detection label is conjugated to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the anti-PSGL-1 antibody is a rabbit IgG antibody, then the secondary antibody can be an anti-rabbit IgG antibody. Thus, qualitative or quantitative detection of PSGL-1 is achieved by analyzing the signal change of the detection label generated after the secondary antibody specifically binds to the antibody of the present invention, such as the multiple detection systems established in Example 2 below of the present invention.

[0060] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule or a host cell containing the nucleic acid molecule, and the nucleic acid molecule encodes a rabbit antibody against human PSGL-1 protein as described above.

[0061] The nucleic acid molecule can be in the form of DNA (such as cDNA or genomic DNA or synthetic DNA) or RNA (such as mRNA or synthetic RNA). The DNA can be single-stranded or double-stranded, and can also be a coding strand or a non-coding strand.

[0062] The sequence of the nucleic acid molecule can be obtained by conventional means such as codon encoding rules based on the antibody AA sequence. The full-length sequence or fragment of the nucleic acid molecule can usually be obtained by PCR amplification, recombination or artificial synthesis methods.

[0063] Exemplarily, the nucleic acid sequence of the variable region of the antibody light chain is as shown in SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the variable region of the heavy chain is as shown in SEQ ID NO.14 or a sequence complementary thereto.

[0064] Exemplarily, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a sequence complementary thereto.

[0065] The original vectors for constructing the recombinant vectors are various conventional vectors in the art, as long as they can accommodate the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, phages (such as λgt4λB, λ-Charon, λΔz1 and M13), cosmids and minichromosomes. The vector can be a cloning vector (i.e., used to transfer the nucleic acid molecule into a host and multiply it in the host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or an expression vector carrying the nucleic acid molecule, and then introduced into a host cell and cultured under specific conditions to express and obtain the antibody. This is a well-known technique in the art and will not be described in detail here.

[0066] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors respectively, which can be introduced into the same or different host cells. When the heavy chain and the light chain are expressed in different host cells, each chain can be separated from the host cell expressing it, and the separated heavy chain and light chain are mixed and incubated under suitable conditions to form an antibody. In some other embodiments, the nucleic acid molecules of the antibodies FL and FH can also be cloned into one vector, and each nucleic acid sequence is linked downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy chain and the light chain can be operably linked to different promoters, or the nucleic acid sequences encoding the heavy chain and the light chain can be operably linked to a single promoter such that both the heavy chain and the light chain can be expressed by the same promoter. The choice of the expression vector / promoter depends on the type of host cell used to produce the antibody.

[0067] The transfection or transformation of the recombinant vector into the host cell is carried out by conventional techniques. When the host is a prokaryote such as Escherichia coli, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl 2 method or MgCl2 Treatment; it can also be achieved by microinjection, electroporation, liposome packaging, etc. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co - precipitation method, microinjection method, electroporation method, liposome packaging or gene gun bombardment, etc. to achieve gene introduction.

[0068] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include, but are not limited to, Escherichia coli (such as DH5α, JM109, BL21, W3110), Bacillus spp. (such as Bacillus subtilis, Bacillus thuringiensis), Enterobacteriaceae strains (such as Salmonella typhimurium, Serratia marcescens) and Pseudomonas spp. Examples of eukaryotic host cells that can be transformed include, but are not limited to, yeast, insect cells and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO - S, COS - 7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK and HEK293 cell lines. After obtaining the host cell transfected or transformed with the recombinant vector as described above, culturing under suitable conditions can express the antibody, and then separating it to obtain the purified antibody.

[0069] In a typical embodiment, the method for preparing the antibody includes ligating the heavy - chain gene and light - chain gene of the antibody in series with a signal peptide, respectively loading them on the expression vector pBR322, co - transfecting human renal epithelial cells (293F), culturing the 293F cells, collecting the cell culture supernatant, and purifying to obtain the target antibody strain. The selection of the signal peptide is designed according to the host cell, and the present invention has no special limitation in this regard.

[0070] Another embodiment of the present invention provides the use of the rabbit - derived antibody or antibody conjugate against human PSGL - 1 protein as described above in the preparation of a human PSGL - 1 protein immunoassay kit.

[0071] The advantages of the use of the rabbit - derived antibody or antibody conjugate against human PSGL - 1 protein in the preparation of a human PSGL - 1 protein immunoassay kit are the same as the advantages of the rabbit - derived antibody against human PSGL - 1 protein as described above over the prior art, and will not be elaborated here.

[0072] Based on the same inventive concept, an embodiment of the present invention also provides a human PSGL - 1 protein immunoassay kit, which includes the rabbit - derived antibody or antibody conjugate against human PSGL - 1 protein as described above.

[0073] The above-mentioned immunoassay methods include, but are not limited to: Enzyme linked immunosorbent assay (ELISA), Enzyme-linked Immunospot (ELISPOT), Immunohistochemistry (IHC), Immunofluorescence (IF), Western blot (WB), Immunoprecipitation (IP), and Flow Cytometry (FC). The kit can be an enzyme-linked immunosorbent kit, an enzyme-linked immunospot kit, an immunohistochemistry kit, an immunofluorescence kit, a western blot kit, or a flow cytometry kit.

[0074] Preferably, the kit is a western blot kit, a flow cytometry kit, or an immunofluorescence kit.

[0075] The present invention will be further described below in conjunction with specific embodiments. For the experimental methods without specific conditions noted in the following embodiments, they are generally carried out under conventional conditions, such as those described in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" published by Cold Spring Harbor Laboratory, or generally according to the conditions recommended by the manufacturer.

[0076] Example 1 Preparation of Rabbit Antibody Against Human PSGL-1 / CD162 Protein

[0077] Immunize a New Zealand white rabbit with human PSGL-1 / CD162 protein. Then, based on single B cell labeling and sorting technology, directly enrich and sort out B cells that can recognize the target antigen from the spleen of the rabbit immunized with human PSGL-1 / CD162 protein. Culture the isolated B cells in single cell form to obtain monoclonal antibody 1E5. Finally, through genetic engineering recombinant expression technology, first amplify the genes of the naturally paired antibody light chain (VL) and heavy chain variable region (VH) from the B cells secreting the monoclonal antibody by PCR, and insert them in series with the light chain (CL) and heavy chain constant region (CH) into the expression vector to mass-produce monoclonal antibody 1E5 by recombinant expression of the antibody gene. The antibody sequencing work was completed by Wuhan Kingcare Biotechnology Co., Ltd. The amino acid (AA) and nucleotide (DNA) sequences of the antibody are shown in Table 1. In the table, LCDR1-3 represent the complementarity-determining regions CDR1-3 on the light chain, and HCDR1-3 represent the complementarity-determining regions CDR1-3 on the heavy chain.

[0078] Table 1 Sequence Information of Rabbit Antibody 1E5 in this Example

[0079]

[0080]

[0081]

[0082] 1.1. Antigen preparation: The immunogen for preparing rabbit monoclonal antibodies is human PSGL-1 / CD162 protein. The amino acid sequence can be found in NCBI accession number NP_002997.2 or Uniprot number Q14242, and the gene sequence can be found in NCBI accession number NM_003006.4. The full-length gene sequence was constructed into the pYURK-Chis vector and expressed in 293F cells through a eukaryotic expression system to obtain recombinant human PSGL-1 / CD162 protein. The purity of the recombinant protein was detected to be greater than 90%.

[0083] 1.2. Animal immunization: Four New Zealand white rabbits were immunized with 200 μg / rabbit of recombinant human PSGL-1 / CD162 protein. Before the first immunization, the antigen was mixed with an equal amount of complete Freund's adjuvant (purchased from Sigma) to make an emulsifier, and injected subcutaneously at multiple points on the abdomen and back of the rabbits; every 3 weeks after the first immunization, 100 μg of immunogen was mixed with an equal amount of incomplete Freund's adjuvant (purchased from Sigma) to make an emulsifier, and injected subcutaneously at multiple points on the abdomen and back of the rabbits for two booster immunizations. After three immunizations, rabbit serum samples were collected, and the titer against human PSGL-1 protein was measured by enzyme-linked immunosorbent assay (ELISA), and the recognition specificity and binding affinity of the serum to endogenous samples (positive cells Jurkat expressing PSGL-1 protein) were detected by flow cytometry (FC).

[0084] The results of ELISA for measuring serum titer are shown in Figure 1 , where WA-64146D is the project number, and N17651 and N17652 are the rabbit numbers. The results of FC for detecting the binding ability of serum to PSGL-1 protein on the surface of positive cells Jurkat are shown in Figure 2 , where the abscissa represents relative fluorescence intensity, the ordinate represents relative cell number, the red curve is the blank control, the blue curve is the isotype control, and the yellow curve is the serum to be tested. The serum dilution ratios from left to right are 1:500 and 1:2000. It can be seen from Figure 1-2 that antibodies capable of specifically recognizing PSGL-1 / CD162 protein have been produced in the rabbits after immunization. The rabbit with the highest serum titer and the best endogenous detection was selected, and immunized with 200 μg of immunogen by subcutaneous multi-point injection for a booster immunization. Three days later, the animal was sacrificed and the spleen was taken.

[0085] 1.3. Isolation of B cells in the spleen and sorting of antigen-specific B cells: For related methods, refer to the publicly disclosed patent "Method for efficiently isolating single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: July 16, 2019)" and the patent "An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: August 11, 2020)".

[0086] 1.4. Cloning of genes encoding rabbit monoclonal antibodies: The supernatant of the cultured B cells was identified for positive clones using antigen-coated ELISA. After collecting and lysing the cells of the positive clones, RNA was extracted using the Quick-RNA TM Micro Prep kit (purchased from ZYMO, product number R1051) and reverse transcribed into cDNA. Using the aforementioned cDNA as a template, the naturally paired variable light chain (VL) and variable heavy chain (VH) of rabbit antibodies were amplified by PCR and sequenced. The PCR reaction system includes: 4 μL of cDNA, 1 μL of forward primer (10 mM), 1 μL of reverse primer (10 mM), 12.5 μL of 2×Gloria HiFi (from ABclonal, product number RK20717) and 6.5 μL of H 2 O; The PCR amplification program includes: pre-denaturation at 98°C for 30 s, followed by 40 cycles under the conditions of 98°C for 10 s, 64°C for 30 s, and 72°C for 30 s, and finally holding at 72°C for 5 min. The obtained reaction solution was stored at 4°C. The primer sequences (5'-3') for amplifying VL and VH genes are shown below, where F and R represent the forward primer and the reverse primer respectively.

[0087] VL-F: 5'-tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC-3' (SEQ ID NO.15);

[0088] VL-R: 5'-cacacacacgatggtgactgTTCCAGTTGCCACCTGATCAG-3' (SEQ ID NO.16);

[0089] VH-F: 5'-tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG-3' (SEQ ID NO.17);

[0090] VH-R: 5'-gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG-3' (SEQ ID NO.18).

[0091] The amplified DNA products were sequenced to obtain the VL sequence shown in SEQ ID NO.2 and the VH sequence shown in SEQ ID NO.7; then the sequence of the constant region was obtained by querying the IMGT online database (www.imgt.org), and the antibody 1E5 with the complete light chain (FL) shown in SEQ ID NO.1 and the complete heavy chain (FH) shown in SEQ ID NO.6 was obtained.

[0092] 1.5 Expression and large-scale production of rabbit antibody 1E5: The obtained heavy and light chain genes of the antibody were respectively loaded onto expression vectors. In this example, the light chain constant region (CL) and the heavy chain constant region gene (CH) were pre-inserted into the mammalian expression vector pBR322, and its expression map is shown in Figure 3 , in the figure, pBR322 origin and f1 origin are replication promoters, Ampcillin is a resistance gene, CMV promoter is a transcription promoter, SV40 PA terminator is a polyadenylation signal, Lightchain constant is the nucleic acid sequence of CL (left figure), and Heavy chain constant is the nucleic acid sequence of CH (right figure). Then the amplified VL and VH genes were ligated to the expression vector pBR322 carrying the CL and CH genes, which were linearized with the restriction enzymes XbaI (955bp) and NheI (949bp) respectively, by homologous recombination to obtain the expression vectors of the complete light chain (FL) and heavy chain (FH) genes. The successful construction of the vectors was verified by sequencing.

[0093] To purify the antibody more conveniently, the antibody is secreted and expressed by adding a signal peptide upstream of the VL and VH genes. The signal peptide can be a commonly used antibody expression signal peptide in the art. For example, in the patent "Rabbit monoclonal antibody against human interferon α2 and its application (Publication No.: CN116063487A, Publication Date: May 5, 2023)" and the patent "High-affinity Human IL-5 rabbit monoclonal antibody and its application (Publication No.: CN115819578A, Publication Date: March 21, 2023)", there is a signal peptide "MDTRAPTQLLGLLLLWLPGARC (the encoding gene in this example is atggacacgagggcccccac tcagctgctgggcctgttgctcctctggctccccggcgcccgctgt)" upstream of VL, and a signal peptide "METGLRWLLLVA VLKGVQC (the encoding gene in this example is atggagactgggctgcgctggcttctcctggtggcagtgctgaaaggagtgcagtgc)" upstream of VH. Of course, those skilled in the art can also replace other signal peptides for antibody expression after obtaining the antibody sequence of the present invention. Therefore, the signal peptide sequence is not reflected in the antibody sequence in Table 1 of this example.

[0094] The successfully constructed FL and FH expression vectors were co-transfected into 293F cells. After transfection, the cells were cultured for 72 - 96 h to obtain an antibody that recognizes the human PSGL-1 / CD162 protein in the culture supernatant. The target antibody was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, product number SA015100). The purity of the antibody was verified to be ≥95% using 12% polyacrylamide gel electrophoresis (SDS-PAGE). The purified antibody was aliquoted and stored at -20 °C for later use.

[0095] Example 2 Establishment of an immunodetection method for a rabbit-derived antibody against human PSGL-1 / CD162 protein

[0096] 1. Establishment of the flow cytometry (FC) detection method for antibody 1E5

[0097] The FC detection includes the following steps: 1) Disinfect the laminar flow hood with ultraviolet light for 15 - 20 min, turn on the blower for 5 min, and prepare for sterile work; 2) Collect and wash the cells (Jurkat cells or MCF7 cells), measure the total number of cells, and check that the cell viability is 90% - 95%; 3) Resuspend the cells with 1×PBS solution to about 3×10 6 -5×10 6Cells / mL. Distribute the cells into a 96-well V-bottom plate at 100 μL / well and wash once with 1×PBS. 4) Stain with the Live / Dead staining solution (Zombie NIR, L / D staining solution) from the Zombie NIR Fixable Viability Kit (Cat. No. 423105) of Biolegend. Dilute the L / D staining solution with 1×PBS at a ratio of 1:1500 and distribute the diluted L / D staining solution into the wells at 100 μL / well to resuspend the cells in the wells. 5) Wrap with aluminum foil and gently mix on a microplate shaker for 15 min, then centrifuge at 400 g for 5 min, discard the supernatant, and wash twice with FACS buffer. 6) Distribute the primary antibody 1E5 diluted with FACS buffer (final concentration of the primary antibody is 2 μg / mL) into the wells at 100 μL / well to resuspend the cells in the wells. 7) Repeat step 5). 8) Distribute the fluorescent secondary antibody Alexa 647 AffiniPure F(ab')2 Fragment Goat Anti-Rabbit IgG, Fc fragment specific (purchased from jackson, Cat. No. 111-606-046) into the wells at 100 μL / well to resuspend the cells in the wells. 9) Repeat step 5). 10) Resuspend the cells in each well with 200 μL of FACS buffer and store in the dark.

[0098] Analyze according to the operation of the Beckman cytoflex flow cytometer Use and Maintenance SOP-105-AND-CA-008. The FC detection diagram of the monoclonal antibody 1E5 against human PSGL-1 / CD162 protein is shown in Figure 4, where the left figure shows the FC detection results of human T lymphocyte leukemia cells (Jurkat) expressing the PSGL-1 / CD162 protein, and the right figure shows the FC detection results of human breast cancer cells (MCF7) not expressing the PSGL-1 / CD162 protein. The abscissa in the figure represents the relative fluorescence intensity, and the ordinate represents the relative number of cells. The red curve is the negative control, the blue curve is the isotype control (used to eliminate background staining caused by non-specific binding of the antibody to cells), and the yellow curve is antibody 1E5. The results show that there is an obvious signal transition difference between antibody 1E5 on positive and negative samples, indicating specific binding on positive cells Jurkat and no non-specific binding on negative cells MCF7, confirming that it can specifically recognize PSGL-1 / CD162 expressed in human cells and has good anti-cell component interference ability, without cross-reaction with other complex antigen components on cells, which is beneficial to improving the specificity and accuracy of PSGL-1 / CD162 protein detection.

[0099] 2. Establishment of the immunoblotting (Western blot, WB) detection method for antibody 1E5

[0100] Positive cell / tissue samples expressing the PSGL-1 / CD162 protein and negative cell / tissue samples not expressing the PSGL-1 / CD162 protein were lysed respectively to obtain protein lysates, and 6% SDS-PAGE electrophoresis was performed. The gel protein bands were transferred to the NC membrane in an electrotransfer system by the conventional method; the membrane was incubated in a TBST blocking solution containing 3% skim milk powder at room temperature for 1 h, and antibody 1E5 prepared in Example 1 (final concentration of the primary antibody was 2 μg / mL) was added and incubated at room temperature for 1 h; then the membrane was washed 3 - 4 times with TBST, and goat anti-rabbit secondary antibody HRP-conjugated Goat anti-Rabbit IgG(H+L) (purchased from jackson immunoresearc, catalog number 111-035-045, dilution ratio of the secondary antibody 1:5000) was added and incubated at room temperature for 1 h; the membrane was washed 3 - 4 times again with TBST; finally, ECL hypersensitive color development solution was added for development.

[0101] The WB detection results are shown in Figure 5, wherein the positive cells include Jurkat cells and human histiocytic lymphoma cells (U-937), the negative cells include MCF7 cells, and the negative tissues include mouse spleen, mouse thymus, rat spleen, and rat thymus. The results showed that the antibody of the present invention can specifically bind to the human PSGL-1 / CD162 protein. Only a clear band was detected in positive cells such as Jurkat and U-937. The light band is the dimer of the target protein, and the band size is consistent with the theoretical position. At the same time, no band was detected in the negative cell samples, indicating that the antibody has good recognition specificity and can effectively avoid false positive results. Moreover, the antibody of the present invention only recognizes Human CD162 and has no cross-reaction with homologous proteins of other species.

[0102] 3. Establishment of the immunofluorescence (IF) detection method for antibody 1E5

[0103] Take the positive cells U-937 expressing the PSGL-1 / CD162 protein. After washing with PBS, add 4% neutral formaldehyde fixative and fix at room temperature for 15 min. After fixation, centrifuge at 3000 rpm for 3 min, leave the cells precipitated at the bottom, remove the upper fixative, add PBS to resuspend the cells, and repeat the PBS washing once. Aspirate the cell suspension and spread it on a glass slide, and observe whether the cell density is appropriate under a microscope. After the smear is made, let it dry overnight. Add 5% blank goat serum to the prepared cell smear to completely cover the aforementioned cell sample, and incubate it in a 37°C constant temperature and humidity incubator for 30 min. Remove the blocking solution, and then add the working solution of antibody 1E5 prepared with TBS buffer (the final concentration of the primary antibody is 2 μg / mL), and incubate overnight at 4°C; take it out and warm it to room temperature for 15 min, remove the primary antibody working solution, rinse it once with TBST buffer and soak and wash it three times, 3 - 5 min each time. Then add the fluorescent secondary antibody Cy3-conjugated Goat anti-Rabbit IgG(H+L) (from ABclonal, catalog number AS007, dilution ratio of the secondary antibody 1:500) diluted with TBS buffer, incubate for 1 h at 37°C in the dark, remove the secondary antibody working solution, wash it with TBST buffer, add 1 μg / mL DAPI working solution to the sample, and incubate for 30 min at room temperature in the dark; remove the DAPI working solution, rinse it once with TBST buffer and soak and wash it twice, and observe and collect images under a fluorescence microscope Confocal.

[0104] The IF detection results of U-937 cells are shown in Figure 6, wherein, the upper figure is a fluorescence imaging diagram of using antibody 1E5 to bind to human U-937 cells. After antibody 1E5 binds to the PSGL-1 / CD162 protein, it is labeled with a fluorescent secondary antibody as Cy3 red. The lower figure is a comparison diagram of using DAPI to counterstain the nuclei of U-937 cells (showing blue) and merging the red and blue colors. It can be seen from the figure that the fluorescence signal on the U-937 cell membrane is clear and bright, and the actual IF detection result is consistent with the theoretical localization of the antibody, and the detection result has a high credibility.

[0105] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A rabbit antibody against human PSGL-1 protein, characterized in that: It comprises a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region are shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively; the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively.

2. The rabbit-derived antibody against human PSGL-1 protein according to claim 1, characterized in that: The amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

7.

3. The rabbit-derived antibody against human PSGL-1 protein according to claim 2, characterized in that: The amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

6.

4. The rabbit-derived antibody against human PSGL-1 protein according to claim 1, characterized in that: The antibody is a full-length antibody or an antigen-binding region thereof; the antigen-binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. An antibody conjugate, characterized in that: The method comprises the rabbit antibody against human PSGL-1 protein according to any one of claims 1 to 4 and a detection label connected to the antibody.

6. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the rabbit antibody against human PSGL-1 protein as described in any one of claims 1 to 4.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleic acid sequence of the antibody light chain variable region is shown as SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.14 or a sequence complementary thereto.

8. The nucleic acid molecule according to claim 7, characterized in that The nucleic acid sequence of the antibody light chain is shown as SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.13 or a sequence complementary thereto.

9. Use of the rabbit antibody against human PSGL-1 protein according to any one of claims 1 to 4 or the antibody conjugate according to claim 5 in the preparation of a human PSGL-1 protein immunoassay kit.

10. A human PSGL-1 protein immunoassay kit, characterized in that: The invention comprises the rabbit antibody against human PSGL-1 protein as claimed in any one of claims 1 to 4 or the antibody conjugate as claimed in claim 5.

Images