Kit for quantitatively detecting target nucleic acid and application thereof

Abstract

The invention provides a kit for quantitatively detecting target nucleic acid and application of the kit, and belongs to the technical field of gene detection. The invention provides a kit for detecting target nucleic acid. The kit comprises an SPR (Surface Plasmon Resonance) biosensor chip fixed with a DNA tetrahedron probe, a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system reagent and an enzymatic precipitation system reagent. The kit combines an SPR biosensor, a DNA origami technology, a CRISPR technology and an enzymatic precipitation system, can realize quantitative measurement of nucleic acid, and has extremely high sensitivity. Results of the embodiment show that the kit can realize automatic, high-throughput and high-sensitivity sample detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and particularly relates to a kit for quantitatively detecting target nucleic acid and its application. Background Art

[0002] Traditional nucleic acid detection techniques include sequencing, real-time fluorescence quantitative PCR, Northern blot hybridization, microarray, etc. However, traditional detection methods have problems of insufficient sensitivity and complex detection procedures. For example, the Northern blot analysis technique has low sensitivity, is relatively time-consuming and requires a large amount of nucleic acid samples; the microarray chip technology has high throughput but requires extremely precise instruments, and there are also problems of unwanted cross-hybridization and low sensitivity; real-time fluorescence quantitative PCR is costly, the process is complex and requires special laboratory skills.

[0003] Surface Plasmon Resonance (SPR) technology, as an optical and real-time biosensing method, due to its unique advantages such as label-free detection, high sensitivity and low cost, can detect biomolecular interactions by monitoring the refractive index change caused by biomolecular binding. SPR technology can be used for nucleic acid detection, but there is also a problem of low sensitivity when detecting nucleic acid. Summary of the Invention

[0004] In view of this, the present invention provides a kit for detecting target nucleic acid, which combines an SPR biosensor, DNA origami technology, CRISPR technology and an enzymatic precipitation system to quantitatively detect nucleic acid, with extremely high sensitivity and simple operation.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a kit for detecting target nucleic acid, comprising an SPR biosensor chip fixed with a DNA tetrahedron probe, a CRISPR system reagent and an enzymatic precipitation system reagent;

[0007] On the vertex of the DNA tetrahedron probe far from the bottom surface, it hybridizes and binds with an RNA reporter molecule through an extended sequence;

[0008] One end of the RNA reporter molecule is modified with biotin;

[0009] The CRISPR system reagent includes a Cas protein and a crRNA for identifying target nucleic acid;

[0010] The enzymatic precipitation system reagent includes a precipitation substrate and enzyme-modified avidin.

[0011] Preferably, the DNA tetrahedron probe is formed by assembling single-stranded DNA-A, single-stranded DNA-B, single-stranded DNA-C, single-stranded DNA-D, and an RNA reporter molecule;

[0012] The nucleotide sequences of the single-stranded DNA-A, single-stranded DNA-B, single-stranded DNA-C, single-stranded DNA-D, and the RNA reporter molecule are shown in SEQ ID NO:1 to SEQ ID NO:5, respectively.

[0013] Preferably, the bottom surface of the DNA tetrahedron probe is fixed on the surface of the SPR biosensor chip through a gold-thiol bond; the working concentration of the DNA tetrahedron probe is 0.8 - 1.2 μM.

[0014] Preferably, the enzyme in the enzyme-modified avidin includes horseradish peroxidase;

[0015] The precipitation substrate includes 4-chloro-1-naphthol and hydrogen peroxide.

[0016] Preferably, the working concentration of the enzyme-modified avidin is 2 - 10 μg / mL.

[0017] Preferably, it further includes TM buffer and / or hybridization buffer.

[0018] Preferably, when the target nucleic acid is miRNA-137, the nucleotide sequence of the crRNA is shown in SEQ ID NO:6.

[0019] The present invention provides the application of the kit in detecting nucleic acids for non-diagnostic purposes and / or preparing products for detecting nucleic acids.

[0020] The present invention provides a method for quantitatively detecting nucleic acids for non-diagnostic purposes, comprising the following steps:

[0021] The sample to be tested undergoes a CRISPR cleavage reaction with the SPR biosensor chip and the CRISPR system reagent in the kit to obtain a cleaved chip;

[0022] After the cleaved chip undergoes a coupling reaction with the enzyme-modified avidin in the kit, it undergoes an enzymatic precipitation reaction with the precipitation substrate in the kit;

[0023] The change in the SPR signal before and after the enzymatic precipitation reaction is measured by an SPR sensor to calculate the nucleic acid concentration of the sample to be tested.

[0024] Preferably, the system for the CRISPR cleavage reaction is 200 μL and includes the following components in the following amounts: 2.5 μL of 1 pmol / μL Cas13a, 10 μL of 250 nM crRNA, 10 μL of the sample to be tested, 20 μL of 10× reaction buffer, 1 μL of RNase inhibitor, and the balance being RNase-free water;

[0025] The conditions for the CRISPR cleavage reaction are: incubation at 37 °C for 1 h.

[0026] The present invention has the following advantages compared with the prior art:

[0027] The present invention provides a kit for detecting a target nucleic acid, which includes an SPR biosensor chip immobilized with a DNA tetrahedron probe, CRISPR system reagents, and enzymatic precipitation system reagents; a vertex of the DNA tetrahedron probe far from the bottom surface is hybridized and bound to an RNA reporter molecule through an extended sequence; one end of the RNA reporter molecule is modified with biotin; the CRISPR system reagents include a Cas protein and a crRNA for recognizing the target nucleic acid; the enzymatic precipitation system reagents include a precipitation substrate and enzyme-modified avidin. The present invention adopts a TDN-CRISPR-HRP SPR biosensor chip, which combines an SPR biosensor, DNA origami technology, and CRISPR technology to achieve nucleic acid quantitative measurement without any amplification process. The DNA tetrahedron (TDN) in the kit has a highly rigid three-dimensional structure, which can effectively avoid entanglement between probes and precisely control the distance between probes, increase the accessibility of the CRISPR / Cas system cleavage while resisting non-specific adsorption, and improve the detection sensitivity. When detecting nucleic acid with the kit, the higher the concentration of the target nucleic acid in the sample to be tested, the stronger the cleavage activity of the activated CRISPR system, the more the RNA reporter molecule is sheared to free the biotin end, and thus the less biotin coupled to the Avidin-HRP subsequently introduced into the flow cell, the less enzymatic precipitation is generated, and the smaller the change in the SPR signal before and after the enzymatic precipitation reaction; the lower the concentration of the target nucleic acid in the sample to be tested, the greater the change in the SPR signal before and after the enzymatic precipitation reaction; when the target nucleic acid is absent in the sample to be tested, the change in the SPR signal before and after the enzymatic precipitation reaction is the largest. By making a standard curve based on the change in the SPR signal before and after the enzymatic precipitation reaction, the concentration of the target nucleic acid in the sample to be tested can be calculated. The results of the examples show that when detecting miRNA with the kit, the linear detection range is 0.5 pM to 500 nM, and the detection limit is 212 fM, with high detection sensitivity. Description of the Drawings

[0028] Figure 1 It is an electrophoresis result diagram for the CRISPR system to detect miRNA-137;

[0029] Figure 2 It is a logarithmic linear relationship diagram of the SPR signal intensity change curve and the miRNA concentration; among them, (A) is the real-time intensity change curve of the SPR signal during the detection process; (B) is the linear relationship between the concentration of miRNA in the detection solution and the SPR signal intensity.

[0030] Figure 3 It is a result diagram of the SPR signal intensity ratio for detecting different miRNAs.

[0031] Figure 4 It is a result diagram of the concentration optimization experiment of different concentrations of RNA reporter molecules and Avidin-HRP; among them, (A) is the experimental result of the concentration optimization of RNA reporter molecules; (B) is the experimental result of the concentration optimization of Avidin-HRP.

[0032] Figure 5 It is a logarithmic linear relationship diagram of the fluorescence spectrum and fluorescence signal intensity of the CRISPR / Cas13a cleavage assay for fluorescent quantitative detection of target miRNAs at different concentrations and the miRNA concentration; among them, (A) is the fluorescence spectrum of the CRISPR / Cas13a cleavage assay for target miRNAs at different concentrations; (B) is the linear relationship between the concentration of miRNA in the detection solution and the fluorescence signal intensity. Detailed implementation mode

[0033] The present invention provides a kit for detecting target nucleic acids, including an SPR biosensor chip fixed with a DNA tetrahedron probe, CRISPR system reagents, and enzyme precipitation system reagents.

[0034] A RNA reporter molecule is hybridized and bound to the vertex far from the bottom surface on the DNA tetrahedron probe through an extended sequence.

[0035] One end of the RNA reporter molecule is modified with biotin.

[0036] The CRISPR system reagents include a Cas protein and a crRNA for identifying target nucleic acids.

[0037] The enzyme precipitation system reagents include a precipitation substrate and enzyme-modified avidin.

[0038] The kit described in the present invention includes an SPR biosensor chip immobilized with a DNA tetrahedron probe. The DNA tetrahedron (TDN) is preferably a product formed by hybridizing and assembling single-stranded DNA-A, single-stranded DNA-B, single-stranded DNA-C, and single-stranded DNA-D into an equilateral tetrahedron structure. The nucleotide sequence of the single-stranded DNA-A is as shown in SEQ ID NO:1; the nucleotide sequence of the single-stranded DNA-B is as shown in SEQ ID NO:2; the nucleotide sequence of the single-stranded DNA-C is as shown in SEQ ID NO:3; the nucleotide sequence of the single-stranded DNA-D is as shown in SEQ ID NO:4. The ends of the single-stranded DNA-B, single-stranded DNA-C, and single-stranded DNA-D are preferably modified with mercapto groups, and the modification with mercapto groups can enable the DNA tetrahedron to be immobilized on the surface of the SPR biosensor chip through gold-mercapto bonds. The sequence of the single-stranded DNA-A contains a sequence complementary to the RNA reporter molecule and can hybridize and bind to the RNA reporter molecule. The reaction system of the DNA tetrahedron is a TM buffer solution containing the following components: 3 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP), and single-stranded DNA-A, single-stranded DNA-B, single-stranded DNA-C, and single-stranded DNA-D with a concentration of 1 μM each. The TM buffer is preferably an aqueous solution containing the following components: 20 mM Tris-HCl and 50 mM MgCl 2 , pH 8.0. The reaction procedure of the DNA tetrahedron is: after heating at 95 °C for 10 min, cooling to 4 °C within 30 s and maintaining for 20 min.

[0039] The DNA tetrahedron probe is formed by hybridizing the RNA reporter molecule with the extended sequence of DNA-A at the vertex of the DNA tetrahedron away from the bottom surface. The nucleotide sequence of the RNA reporter molecule is as shown in SEQ ID NO:5. One end of the RNA reporter molecule is modified with biotin. The DNA tetrahedron probe self-assembles into a DNA nanostructure, has a highly rigid three-dimensional structure, and has high predictability and precision. The SPR biosensor chip immobilized with the DNA tetrahedron probe can effectively avoid the entanglement between probes and precisely control the distance between probes, increase the accessibility of the CRISPR / Cas system cleavage while resisting non-specific adsorption, improve the cleavage efficiency of the Cas protein, and improve the detection sensitivity. However, the traditional ssDNA probe has low stability and is prone to degradation or denaturation. Moreover, the number of probes is large, and the probes are intertwined with each other. Their high-density immobilization may lead to steric hindrance effects and reduce the cleavage efficiency of the CRISPR / Cas system.

[0040] In the present invention, the bottom surface of the DNA tetrahedron probe is fixed on the surface of the SPR biosensor chip through gold-thiol bonds. The SPR biosensor chip is preferably an optical chip with a high-transmission glass substrate and a nanoscale noble metal coating on the surface. The noble metal is preferably gold. The SPR biosensor chip can be obtained commercially or prepared by conventional methods in the art. In the embodiments of the present invention, the SPR biosensor chip is prepared by the conventional magnetron sputtering coating method in the art. The preparation method of the SPR biosensor chip fixed with the DNA tetrahedron probe includes the following steps: after incubating the DNA tetrahedron with the SPR biosensor chip, the unbound DNA tetrahedron is removed, and then an RNA reporter molecule is added to the reaction system for molecular hybridization to obtain the SPR biosensor chip fixed with the DNA tetrahedron probe. The temperature of the incubation is preferably 20-28 °C, more preferably 22-26 °C, and most preferably 24 °C. The incubation time is preferably 40-80 min, more preferably 50-70 min, and most preferably 60 min. The removal is preferably by rinsing with TM buffer. The rinsing time is preferably 5-10 min, more preferably 6-8 min, and most preferably 7 min. The temperature of the molecular hybridization is preferably 36-38 °C, more preferably 37 °C. The time of the molecular hybridization is preferably the same as the incubation time, which will not be elaborated here. The working concentration of the DNA tetrahedron is preferably 0.8-1.2 μM, more preferably 0.9-1.1 μM, and most preferably 1.0 μM. The solvent of the RNA reporter molecule is hybridization buffer. The hybridization buffer is preferably an aqueous solution containing the following components: 10 mM Tris-HCl, 1 mM EDTA, and 200 mM NaCl, with a pH of 8.0. The working concentration of the RNA reporter molecule is preferably 0.3-2.0 μM, more preferably 0.4-1.5 μM, and most preferably 0.5 μM. The embodiments of the present invention compared the effects of different working concentrations (0.1 μM, 0.25 μM, 0.5 μM, and 1 μM) of the RNA reporter molecule on the detection results. The results showed that the SPR signal intensity increased with the increase in the concentration of the RNA reporter molecule. When the concentration reached 0.5 μM, the SPR signal intensity was close to saturation and no longer increased. Below 0.5 μM would cause the RNA reporter molecule not to completely bind to the TDN probe on the chip surface, reducing the SPR signal intensity and thus the detection sensitivity. Therefore, the optimal working concentration of the RNA reporter molecule is 0.5 μM.

[0041] The kit of the present invention includes CRISPR system reagents, specifically including Cas proteins and crRNAs for identifying target nucleic acids. The Cas proteins preferably include at least one of the following: Cas12a, Cas12b, Cas13a, and Cas13b, and more preferably Cas13a. The sequence of the crRNA preferably can be reverse complementary paired with the target nucleic acid sequence. Given that miRNA-137 is a non-invasive and reliable biomarker for Alzheimer's disease (AD), in the embodiments of the present invention, miRNA-137 is used as a target to illustrate the performance of the kit. When the target nucleic acid is miRNA-137 (the nucleotide sequence is as shown in SEQ ID NO:7), the nucleotide sequence of the crRNA is as shown in SEQ ID NO:6. The CRISPR system reagents preferably further include at least one of the following: 10× reaction buffer, RNase inhibitor, and RNase-free water.

[0042] The present invention combines the CRISPR system to achieve high-specificity recognition through the guiding sequence of the crRNA, and realizes the precise recognition and quantification of miRNA. Conventional detection methods, such as PCR, require multiple steps such as RNA extraction, reverse transcription, and PCR amplification, which are time-consuming and error-prone. The present invention can avoid preprocessing of samples, requires a smaller sample volume, has a shorter detection time, is more convenient to operate, and has a lower cost. In addition, due to the strong designability of the crRNA in the CRISPR-Cas13a system, different target sequence nucleic acid molecules can be detected by simply changing the crRNA sequence.

[0043] The kit of the present invention includes enzyme precipitation system reagents, specifically including precipitation substrates and enzyme-modified avidin. The enzyme in the enzyme-modified avidin preferably includes horseradish peroxidase (HRP); the working concentration of the enzyme-modified avidin is 1.8-10 μg / mL, more preferably 1.9-6 μg / mL, further preferably 2-5 μg / mL, and most preferably 2 μg / mL. In the embodiments of the present invention, the effects of enzyme-modified avidin at different concentrations (0.5 μg / mL, 1 μg / mL, 2 μg / mL, and 5 μg / mL) on the detection results were compared. The results showed that the SPR signal intensity increased with the increase in the concentration of Avidin-HRP. When the concentration reached 2 μg / mL, the SPR signal intensity was close to saturation and no longer increased. When the concentration was lower than 2 μg / mL, it would cause Avidin-HRP to not fully bind to the RNA reporter molecule, reducing the SPR signal intensity and thus reducing the detection sensitivity. Therefore, the optimal working concentration of the enzyme-modified avidin is 2 μg / mL. The solvent of the enzyme-modified avidin is preferably PBS solution, more preferably PBS solution containing 5 mg / mL bovine serum albumin (BSA). The enzyme precipitation substrate preferably includes 4-chloro-1-naphthol (4-CN) and hydrogen peroxide (H2 O 2 )。 The preparation method of the precipitation substrate is preferably a PBS solution containing 3 mM 4-CN and 3 mM H 2 O 2 . The precipitation substrate is preferably prepared immediately before use.

[0044] In the present invention, the kit preferably further includes a TM buffer and / or a hybridization buffer. The TM buffer is preferably an aqueous solution containing the following components: 20 mM Tris-HCl and 50 mM MgCl 2 , with a pH of 8.0. The hybridization buffer is preferably an aqueous solution containing the following components: 10 mM Tris-HCl, 1 mM EDTA, and 200 mM NaCl, with a pH of 8.0.

[0045] The kit provided by the present invention combines the SPR technology with the clustered regularly interspaced short palindromic repeats / clustered regularly interspaced short palindromic repeats-associated nuclease (CRISPR / Cas) technology. CRISPR / Cas is a nucleic acid-based adaptive immune system in bacteria and archaea, which has the ability to recognize and cleave foreign nucleic acid sequences and is a defense mechanism against virus infection. Its basic principle is that the Cas protein non-specifically cleaves non-target sequences after specifically recognizing the target sequence with the assistance of the guide RNA (crRNA). Due to its significant advantages such as mild reaction temperature, good recognition specificity, and high signal amplification ability, it has attracted much attention in biochemical analysis and medical diagnosis and has been widely combined with optical detection methods for nucleic acid detection. In addition, because the crRNA in the CRISPR / Cas system has extremely strong designability, different target sequence nucleic acid molecules can be detected by simply changing the crRNA sequence.

[0046] The present invention combines the CRISPR-based SPR biosensor with the TDN framework probe to achieve quantitative measurement of nucleic acids without any amplification process. In the embodiment of the present invention, first, a DNA tetrahedron (TDN) is synthesized using DNA origami technology, and the TDN is fixed on the gold film surface through three gold-thiol bonds at the bottom end. An RNA reporter molecule biotinylated at one end hybridizes with the extended strand at the top of the TDN, and avidin-horseradish peroxidase (Avidin-HRP) immobilizes HRP on the chip surface through the coupling of biotin and streptavidin. HPR can catalyze 4-chloro-1-naphthol (4-CN), hydrogen peroxide (H 2 O 2)Insoluble precipitates are generated on the chip surface, causing a change in refractive index, thereby generating an SPR signal. The present invention also combines a CRISPR system, and the CRISPR system is introduced into the chip surface on which the TDN / RNA reporter molecule / HRP has been immobilized, including the Cas13a protein, the crRNA bound to the Cas13a protein, and the target nucleic acid bound to the crRNA. When the target nucleic acid is present, the higher the concentration of the target nucleic acid, the stronger the cleavage activity of the activated CRISPR system, the more the RNA reporter molecule is sheared to free the biotin end, and thus the less biotin coupled to the Avidin-HRP subsequently introduced into the flow cell, the less enzymatic precipitate is generated, and the smaller the change in the SPR signal before and after the enzymatic precipitation reaction; the lower the concentration of the target nucleic acid, the greater the change in the SPR signal before and after the enzymatic precipitation reaction. When the target nucleic acid is absent, an enzymatic precipitation reaction can be caused, and the change in the SPR signal before and after the enzymatic precipitation reaction is the largest. By making a standard curve based on the change in the SPR signal before and after the enzymatic precipitation reaction, the concentration of the target nucleic acid in the test sample can be calculated.

[0047] The present invention provides an application of the kit in detecting nucleic acids for non-diagnostic purposes and / or preparing products for detecting nucleic acids.

[0048] Compared with existing microRNA detection technologies, the present invention uses SPR sensing technology. Surface Plasmon Resonance (SPR) technology, as an optical and real-time biosensing method, due to its unique advantages such as label-free detection, high sensitivity, and low cost, can detect biomolecular interactions by monitoring refractive index changes caused by biomolecular binding, providing a suitable and reliable platform for clinical diagnosis. Compared with traditional optical detection methods such as fluorescence and absorption spectroscopy, the kit of the present invention has unparalleled ultra-high sensitivity when detecting nucleic acids. Compared with traditional miRNA detection methods such as qPCR and dPCR, the present invention uses SPR detection, and the process is relatively simple, reducing cumbersome sample preparation and subsequent processing steps, thus greatly simplifying the detection operation process and shortening the detection time. It does not require complex molecular labeling means, avoiding interference and non-specific binding that may be brought about during the labeling process, ensuring the accuracy and reliability of the detection results. It can perform in-situ detection, directly analyze miRNA in the sample, avoiding losses and degradation during the miRNA extraction process, and obtaining more real miRNA expression information. At the same time, the present invention can achieve long-term real-time monitoring of the test sample, thereby obtaining a wide range of kinetic analysis data on various complex molecular interactions in the test sample, and further obtaining more comprehensive analysis of intermolecular affinity, dissociation, and interaction forces. In addition, the combination of the present invention with microfluidic technology can achieve automated, high-throughput, and high-sensitivity sample detection. Compared with existing SPR sensing technology, the present invention uses DNA origami technology to immobilize the synthesized DNA tetrahedron (TDN) on the surface of the SPR chip. Traditional single-stranded DNA (ssDNA) has low stability and is prone to degradation or denaturation. And there are many probes, and the probes are intertwined with each other. Their high-density immobilization may lead to steric hindrance effects and reduce the binding efficiency between the target molecule and the probe. While TDN has a highly rigid three-dimensional structure, which can reduce the adsorption of non-specific molecules, thereby improving the anti-fouling ability of the sensor. And its highly rigid scaffold can accommodate tetrahedral probes with clear probe spacing and direction, precisely controlling the distance between the probes, and having the advantage of fast mass transfer rate of nano-probes.

[0049] The present invention provides a method for quantitatively detecting nucleic acids for non-diagnostic purposes, comprising the following steps:

[0050] The test sample undergoes a CRISPR cleavage reaction with the SPR biosensor chip and the CRISPR system reagent in the kit to obtain a cleaved chip;

[0051] After the cleaved chip undergoes a coupling reaction with the enzyme-modified avidin in the kit, it undergoes an enzymatic precipitation reaction with the precipitation substrate in the kit;

[0052] The difference in SPR signals before and after the enzymatic precipitation reaction is measured by an SPR sensor, and the nucleic acid concentration of the sample to be tested is calculated.

[0053] In the present invention, the sample to be tested undergoes a CRISPR cleavage reaction with the SPR biosensor chip and the CRISPR system reagent in the kit to obtain a cleaved chip.

[0054] In the present invention, the type of the sample to be tested preferably includes at least one of the following: cells, tissues, serum, plasma, whole blood, bacteria, viruses, fungi, and their extracts. In the present invention, the SPR biosensor chip is preferably loaded on an SPR biosensor, and the CRISPR system reagent is added to the flow cell for the cleavage reaction. The system of the CRISPR cleavage reaction is preferably 200 μL and preferably includes the following components in the following amounts: 2.5 μL of 1 pmol / μL Cas13a, 10 μL of 250 nM crRNA, 10 μL of the sample to be tested, 20 μL of 10× reaction buffer, and 1 μL of RNase inhibitor, with the balance being RNase-free water; the conditions of the CRISPR cleavage reaction are: incubation at 37°C for 1 h. The concentration of the RNase inhibitor is 40 U / μL. After the cleavage reaction, TM buffer is preferably added to the flow cell and run for 5 to 10 min, more preferably 7 min, in order to remove the unreacted CRISPR system reagent and the cleaved biotin.

[0055] After obtaining the cleaved chip, in the present invention, the cleaved chip is subjected to a coupling reaction with the enzyme-modified avidin in the kit, and then an enzymatic precipitation reaction is carried out with the precipitation substrate in the kit.

[0056] In the present invention, for the coupling, the enzyme-modified avidin is preferably added to the flow cell. The temperature of the coupling is preferably the same as the temperature for incubating the DNA tetrahedron with the SPR biosensor chip, which will not be elaborated here. The time of the coupling reaction is preferably 15 to 25 min, more preferably 18 to 22 min, and most preferably 20 min. After the coupling reaction, TM buffer is preferably added to the flow cell and run for 5 to 10 min, more preferably 7 min, for rinsing in order to remove the unreacted enzyme-modified avidin. After the run, the SPR signal is measured by an SPR sensor and denoted as SPR1.

[0057] In the present invention, for the enzymatic precipitation reaction, the precipitation substrate is preferably added to the flow cell. The temperature and time of the enzymatic precipitation reaction are preferably the same as those of the above-mentioned coupling, which will not be elaborated here. After the enzymatic precipitation reaction, TM buffer is preferably added to the flow cell and run for 5 to 10 min, more preferably 7 min. After the run, the SPR signal is measured by an SPR sensor and denoted as SPR2.

[0058] After obtaining the SPR signals before and after the enzymatic precipitation reaction, calculate the nucleic acid concentration of the sample to be tested. The change in the SPR signal in the present invention is expressed by the SPR signal intensity ratio (Ri), and the calculation formula is shown in Formula I.

[0059] SPR signal intensity ratio (Ri) = (SPR2 - SPR1) / SPR1 × 100% Formula I.

[0060] Substitute the SPR signal intensity ratio into the standard curve regression equation y = 0.11x + 0.8 to calculate the nucleic acid concentration.

[0061] The method provided by the present invention has ultra-high sensitivity compared with the existing fluorescence quantitative detection technology. The results of the examples of the present invention show that the linear detection range of fluorescence quantitative detection for miRNA is 0.5 nM to 500 nM, and the detection limit is 125 pM; while the linear detection range of the method of the present invention for miRNA is 0.5 pM to 500 nM, and the detection limit is 212 fM. It can be seen that the method provided by the present invention has ultra-high sensitivity when quantitatively detecting nucleic acids.

[0062] In order to further illustrate the present invention, a kit for quantitatively detecting target nucleic acids and its application provided by the present invention will be described in detail below in conjunction with the drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0063] Example 1

[0064] A preparation method of DNA tetrahedron (TDN)

[0065] Synthesize four DNA single strands respectively according to Table 1.

[0066] Table 1 Nucleotide sequences of four DNA single strands

[0067]

[0068] After synthesizing the four DNA single strands, configure the TDN reaction system according to Table 2 (TCEP in the reaction system is used to activate the three sulfhydryl groups at the bottom of TDN so that it can be fixed on the chip surface through gold-sulfur bonds). The configured reaction system is heated at 95°C for 10 min and cooled to 4°C within 30 s, and kept at 4°C for 20 min to form TDN with a final concentration of 1 μM.

[0069] Table 2 TDN reaction system

[0070] Component Dosage Final concentration 30 mM TCEP 10 μL 3 mM Single-stranded DNA 1 μL for each single-stranded DNA; total 4 μL 1 μM for each single-stranded DNA TM buffer 86 μL Total amount 100 μL

[0071] Example 2

[0072] A preparation method of RNA reporter molecule

[0073] The nucleotide sequence of the RNA reporter molecule is GGCAAGACGUUUUU-biotin (SEQ ID NO: 5).

[0074] Dilute the RNA reporter molecule with hybridization buffer to obtain RNA reporter molecule solutions with concentrations of 0.1 μM, 0.25 μM, 0.5 μM, and 1 μM, respectively. The hybridization buffer contains 10 mM Tris-HCl, 1 mM EDTA, and 200 mM NaCl, with a pH of 8.0.

[0075] Example 3

[0076] CRISPR system reagents

[0077] miRNA-137 is a non-invasive and reliable biomarker for Alzheimer's disease (AD). The nucleotide sequence of miRNA-137 is UUAUUGCUUAAGAAUACGCGUAG (SEQ ID NO: 7). When detecting miRNA-137, the nucleotide sequence of the crRNA targeting miRNA-137 is GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCUACGCGUAUUCUUAAGCAAUAA (SEQ ID NO: 6). The preparation method of the CRISPR system reagents is as follows: Incubate Cas13a and crRNA at 37 °C for 10 min to pre-assemble the RNP complex, then add miRNA-137, RNase inhibitor, 10× reaction buffer, and RNase-free water. After incubating at 37 °C for 30 min, the CRISPR system reagents are obtained. The dosage of each reagent is shown in Table 3. The CRISPR system reagents are purchased from Novoprotein Scientific Inc.

[0078] Table 3 CRISPR system reagents

[0079]

[0080]

[0081] To test the feasibility of the CRISPR system for miRNA-137 detection, polyacrylamide gel electrophoresis (PAGE) analysis was performed using 30-nt electrophoretic reRNA. The nucleotide sequence of the electrophoretic reRNA is UUUUUUUUUUGGGGCCGGGGUUUUUUUUUU (SEQ ID NO: 8). The electrophoresis results are shown in Figure 1, The results showed that the electrophoretic reRNA could only be cleaved when Cas13a, crRNA, and the target miRNA were present simultaneously (lanes 5, 6, and 7). It was demonstrated that the target miRNA could be accurately recognized by Cas13a / crRNA, and its cleavage activity was activated to cleave the non-target reRNA.

[0082] Example 4

[0083] Reagents for the enzymatic precipitation system

[0084] The components of the reagents for the enzymatic precipitation system include avidin-horseradish peroxidase (Avidin-HRP), bovine serum albumin (BSA), 4-chloro-1-naphthol (4-CN), hydrogen peroxide (H 2 O 2 ).

[0085] Preparation of the Avidin-HRP solution: Add 2 μL of 1 mg / mL Avidin-HRP and 5 mg BSA to 1 mL of PBS to obtain a 2 μg / mL Avidin-HRP solution;

[0086] Add 0.5 μL of 1 mg / mL Avidin-HRP and 5 mg BSA to 1 mL of PBS to obtain a 0.5 μg / mL Avidin-HRP solution;

[0087] Add 1 μL of 1 mg / mL Avidin-HRP and 5 mg BSA to 1 mL of PBS to obtain a 1 μg / mL Avidin-HRP solution;

[0088] Add 5 μL of 1 mg / mL Avidin-HRP and 5 mg BSA to 1 mL of PBS to obtain a 5 μg / mL Avidin-HRP solution;

[0089] Preparation of the precipitation substrate: A mixture obtained by mixing 6 mM 4-CN (33% ethanol) and 6 mM H 2 O 2 (PBS) in a 1:1 (v / v) ratio. The precipitation substrate needs to be prepared freshly before use.

[0090] Example 5

[0091] A method for detecting miRNA-137

[0092] 1. Load the SPR biosensor chip onto the SPR biosensor;

[0093] Wash the SPR biosensor chip (gold film). Use concentrated H 2 SO 4 and H 2 O2 Soak the SPR biosensor chip in the mixture (3:1, v / v) for 15 min, then soak it in pure water for 2 min, and finally dry it with nitrogen gas. Subsequently, drop the refractive index matching oil onto the prism surface, carefully place the chip at the designated position on the prism surface, and press the chip tightly onto the prism surface through a pressing device (spring).

[0094] Inject TM buffer into the flow cell and run for 7 min;

[0095] 2. Inject the TDN prepared in Example 1 into the flow cell and run at room temperature for 1 h to immobilize the TDN on the chip surface;

[0096] Inject TM buffer into the flow cell and run for 7 min to remove unbound molecules;

[0097] 3. Inject the 0.5 μM RNA reporter molecule solution prepared in Example 2 into the flow cell and run at 37 °C for 1 h. Hybridize the RNA reporter molecule complementarily with the extended strand at the top of the TDN for subsequent CRISPR cleavage and Avidin-HRP conjugation steps;

[0098] Inject TM buffer into the flow cell and run for 7 min to remove unbound molecules;

[0099] 4. Inject the CRISPR system reagent prepared in Example 3 into the flow cell and run at 37 °C for 1 h to achieve cleavage of the RNA reporter molecule on the chip surface;

[0100] Inject TM buffer into the flow cell and run for 7 min;

[0101] 5. Inject the 2 μg / mL Avidin-HRP solution prepared in Example 4 into the flow cell and run at room temperature for 20 min; Avidin-HRP is conjugated to the uncleaved RNA reporter molecule through the biotin / streptavidin interaction to immobilize HRP on the chip surface;

[0102] Inject TM buffer into the flow cell and run for 7 min, and record the end-point signal SPR1;

[0103] 6. Inject the precipitation substrate prepared in Example 4 into the flow cell and run at room temperature for 20 min to carry out an enzymatic precipitation reaction;

[0104] Inject TM buffer into the flow cell and run for 7 min at a flow rate of 3 μL / min to remove unbound molecules, and record the end-point signal SPR2;

[0105] 7. Calculate the SPR signal intensity ratio;

[0106] Record the SPR intensity after introducing Avidin-HRP as SPR1 (δI1 ) After precipitation, the SPR intensity is denoted as SPR2 (δI 2 = SPR2 - SPR1), and the calculation formula for the SPR signal intensity ratio is shown in Equation I;

[0107] SPR signal intensity ratio (Ri) = (SPR2 - SPR1) / SPR1 × 100% Equation I;

[0108] The flow rates of TDN, RNA reporter molecule solution, CRISPR system reagent, Avidin-HRP solution, and precipitation substrate TM buffer in the flow cell are all 2 μL / min; the flow rate of TM buffer injected into the flow cell is 3 μL / min.

[0109] Figure 2 It is a real-time change diagram of the SPR signal and a logarithmic linear relationship diagram between the SPR signal intensity and the miRNA concentration. Figure 2 In (A), it is the real-time intensity change curve of the SPR signal during the detection process. It can be seen that as TDN is covalently bound to the chip, the SPR intensity gradually increases because TDN makes the refractive index of the chip surface larger. The binding of Biotin-RNA does not cause an obvious intensity change because the molecular weight of Biotin-RNA is small and the refractive index change it can cause is small. The binding of Avidin-HRP to the uncut Biotin-RNA causes a small intensity change. In contrast, after introducing the precipitation system, the intensity change is large, indicating that the precipitation generated on the chip surface greatly enhances the refractive index change on the chip surface, so the detection sensitivity can be increased.

[0110] The linear relationship between the concentration of miRNA in the detection solution and the SPR signal intensity is as Figure 2 shown in (B). It can be seen that as the miRNA concentration increases, Ri gradually decreases because the higher the miRNA concentration, the stronger the cleavage ability of cas13a protein on Biotin-RNA on the chip surface, the less Avidin-HRP binds, and the less precipitation there is. The linear detection range of miRNA by the method of the present invention is 0.5 pM - 500 nM. According to the detection limit calculation formula LOD = (k*s) / a, the detection limit is calculated to be 212 fM.

[0111] Example 6

[0112] In order to further verify that the kit provided by the present invention has good detection specificity, the present invention makes 1 - 3 base mutations on the basis of the miRNA-137 sequence, and the mutated sequences are shown in Table 4.

[0113] Table 4 Mutated miRNA-137 sequences

[0114] miRNA with single-base mutation UUAUUGCUUAAUAAUACGCGUAG (SEQ ID NO:9) miRNA with double-base mutation UUAUUGCUUAAUAAUACGCGUAA (SEQ ID NO:10) miRNA with triple-base mutation CUAUUGCUUAAUAAUACGCGUAA (SEQ ID NO:11)

[0115] The above three mutated miRNAs were detected respectively according to the detection method of Example 5. The results showed that, compared with the target miRNA-137, the precipitation signal caused by the miRNA with a single-base mismatch increased significantly, and the precipitation signals caused by the miRNAs with double-base mismatches and triple-base mismatches increased further. As the number of base mutations increased, the signal value gradually approached that of the blank sample ( Figure 3 ). Therefore, the kit of the present invention can identify single-base mutations and has good detection specificity.

[0116] Comparative Example 1

[0117] Detection method of miRNA-137

[0118] To further optimize the working concentration of the RNA reporter molecule, RNA reporter molecule solutions were prepared with concentrations of 0.1 μM, 0.25 μM, 0.5 μM, and 1 μM respectively. Detection was carried out according to the detection method of Example 5.

[0119] Figure 4 (A) in shows the experimental results of the optimization of the RNA reporter molecule concentration. The results showed that the SPR signal intensity increased with the increase in the concentration of the RNA reporter molecule. When the concentration reached 0.5 μM, the SPR signal intensity approached saturation and no longer increased. This indicates that at a concentration of 0.5 μM, the RNA reporter molecule has completely bound to the TDN probe on the chip surface.

[0120] Comparative Example 2

[0121] Detection of miRNA-137

[0122] To further optimize the working concentration of the Avidin-HRP solution, Avidin-HRP solutions were prepared with concentrations of 0.5 μg / mL, 1 μg / mL, 2 μg / mL, and 5 μg / mL respectively. Detection was carried out according to the detection method of Example 5.

[0123] Figure 4 (B) in shows the experimental results of the optimization of the Avidin-HRP concentration. The results showed that the SPR signal intensity increased with the increase in the concentration of Avidin-HRP. When the concentration reached 2 μg / mL, the SPR signal intensity approached saturation and no longer increased. This indicates that at a concentration of 2 μg / mL, Avidin-HRP has completely bound to the RNA reporter molecule on the chip surface.

[0124] Comparative Example 3

[0125] Method for fluorescence quantitative detection of miRNA-137

[0126] The nucleotide sequence of the reporter molecule for fluorescence quantitative detection is FAM-UUUUUUGGCGGUUUUUU-BHQ1 (SEQ ID NO: 12);

[0127] Fluorescence quantitative detection protocol: Incubate 2.5 μL of Cas13a (1 pmol / μL) and 10 μL of crRNA (250 nM) at 37 °C for 10 min to pre-assemble the RNP (Cas13a / crRNA) complex, then add 10 μL of miRNA-137 (0, 0.5 nM, 5 nM, 50 nM, and 500 nM), 0.5 μL of FAM-BHQ1-labeled reRNA (100 μM), 1 μL of RNase inhibitor, and 10 μL of 10× reaction buffer, add ultrapure water to a final volume of 100 μL, after incubating at 37 °C for 20 min, use a fluorescence spectrophotometer to detect the fluorescence intensity of the mixture (λex / λem: 490 / 520 nm).

[0128] Figure 5 In (A) is the fluorescence spectrum of the CRISPR / Cas13a cleavage assay of different concentrations of miRNA-137. The results show that as the miRNA concentration increases, the fluorescence signal gradually increases. This is because the higher the concentration of miRNA-137, the stronger the cleavage ability of the cas13a protein on the FAM-BHQ1-labeled reRNA in the solution, and the fluorescence signal disappears in the absence of miRNA, verifying that reRNA can only be degraded in the presence of the target. The linear relationship between the concentration of miRNA-137 in the detection solution and the fluorescence signal intensity is as Figure 5 shown in (B). The linear detection range of fluorescence quantitative detection for miRNA-137 is 0.5 nM to 500 nM, and the detection limit is 125 pM.

[0129] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. Other embodiments can be obtained according to this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A kit for detecting a target nucleic acid, characterized in that: It includes an SPR biosensor chip with a DNA tetrahedron probe fixed thereon, a CRISPR system reagent, and an enzymatic precipitation system reagent; The vertex on the DNA tetrahedral probe far from the bottom surface is hybridized and combined with the RNA reporter molecule through an extended sequence; One end of the RNA reporter molecule is modified with biotin; The CRISPR system reagents include Cas protein and crRNA for recognizing target nucleic acid; The enzymatic precipitation system reagents include precipitation substrate and enzyme-modified avidin.

2. The kit according to claim 1, characterized in that The DNA tetrahedron probe is formed by assembling single-stranded DNA-A, single-stranded DNA-B, single-stranded DNA-C, single-stranded DNA-D and RNA reporter molecules; The nucleotide sequences of the single-stranded DNA-A, single-stranded DNA-B, single-stranded DNA-C, single-stranded DNA-D and RNA reporter molecule are shown in SEQ ID NO: 1 to SEQ ID NO: 5, respectively.

3. The kit according to claim 1, characterized in that The bottom surface of the DNA tetrahedron probe is fixed on the surface of the SPR biosensor chip through a gold-thiol bond; the working concentration of the DNA tetrahedron probe is 0.8-1.2 μM.

4. The kit according to claim 1, characterized in that The enzyme in the enzyme-modified avidin includes horseradish peroxidase; The precipitation substrate includes 4-chloro-1-naphthol and hydrogen peroxide.

5. The kit according to claim 1, characterized in that The working concentration of the enzyme-modified avidin is 2-10 μg / mL.

6. The kit according to claim 1, characterized in that TM buffer and / or hybridization buffer may also be included.

7. The kit according to any one of claims 1 to 6, characterized in that When the target nucleic acid is miRNA-137, the nucleotide sequence of the crRNA is as shown in SEQ ID NO:

6.

8. Use of the kit according to any one of claims 1 to 7 for detecting nucleic acids for non-diagnostic purposes and / or preparing products for detecting nucleic acids.

9. A method for quantitative detection of nucleic acid for non-diagnostic purposes, characterized in that: The following steps are involved: The sample to be tested undergoes a CRISPR cleavage reaction with the SPR biosensor chip and the CRISPR system reagent in the kit according to any one of claims 1 to 7 to obtain a cleavage chip; After the cleavage chip undergoes a coupling reaction with the enzyme-modified avidin in the kit according to any one of claims 1 to 7, the cleavage chip undergoes an enzymatic precipitation reaction with the precipitation substrate in the kit according to any one of claims 1 to 7; The SPR signal change before and after the enzymatic precipitation reaction is measured by an SPR sensor to calculate the nucleic acid concentration of the sample to be tested.

10. The method according to claim 9, characterized in that: The CRISPR cleavage reaction system is 200 μL, including the following components: 2.5 μL of 1 pmol / μL Cas13a, 10 μL of 250 nM crRNA, 10 μL of the sample to be tested, 20 μL of 10× reaction buffer and 1 μL of RNase inhibitor, and the rest of RNase-free water; The conditions of the CRISPR cleavage reaction were: incubation at 37° C. for 1 h.

Images