CCDC89 gene-based bull semen quality related SNP (Single Nucleotide Polymorphism) molecular marker and application thereof

Abstract

The invention discloses a bull semen quality related SNP molecular marker based on a CCDC89 gene and application of the bull semen quality related SNP molecular marker, and belongs to the technical field of genetic molecular biology, the SNP molecular marker is located at the position of chr29: 9868636 of the bull CCDC89 gene, the gene polymorphism is G or A, and when the SNP site is G, high semen quality is shown. By detecting the polymorphism of the SNP site, the detection of the bull semen quality and the identification of the reproductive performance can be realized, the breeding is assisted, the reliable support is provided for breeding the next generation of high quality, and the SNP site has the advantages of high reliability, high efficiency, low cost and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic molecular biology, and particularly relates to an SNP molecular marker related to bull semen quality based on the CCDC89 gene and its application. Background Art

[0002] Bull semen quality mainly includes semen collection volume, sperm density, total sperm count, fresh sperm motility, sperm malformation rate, color, acrosome integrity rate, post-thaw motility, etc. Semen quality not only affects the conception rate of cows, but also affects the growth and development and production performance of the calves born. Therefore, the selection of excellent breeding bulls plays a decisive role in the genetic improvement and reproduction of dairy cows. The research on genes related to bull semen quality involves multiple functional directions, mainly covering reproductive regulation, sperm production and metabolic regulation, etc.

[0003] By combining molecular biology with genetic breeding techniques, the stability of genetic traits can be effectively accelerated and the cycle can be shortened, which is the main research and development direction for screening and breeding high-quality individuals at present. Single nucleotide polymorphism (SNP) is a site polymorphism caused by the substitution of a single base, with high genetic stability, rich sites and wide distribution, and can be applied to the detection of bull semen quality. However, the research results on genes affecting bull semen quality are still relatively limited at present, and further exploration and development are still needed.

[0004] In view of this, the present invention is specifically proposed. Summary of the Invention

[0005] The purpose of the present invention is to provide an SNP molecular marker related to bull semen quality based on the CCDC89 gene and its application.

[0006] The technical solution of the present invention is described in detail as follows: In the first aspect, the present invention provides an SNP molecular marker related to bull semen quality based on the CCDC89 gene. The SNP molecular marker is located at position chr29: 9868636 in the bovine genome, and the polymorphism is G or A.

[0007] The coiled-coil domain containing (CCDC) protein family is usually related to basic biological processes such as cytoskeleton formation, signal transduction or organelle localization. At present, there is little research on the bovine CCDC89 gene. The research of the present invention on this gene shows that its function is related to bull semen quality, and the polymorphism of its SNP locus affects semen quality.

[0008] Optionally or preferably, the SNP molecular marker is the 636th nucleotide of SEQ ID NO:1 in the sequence listing, which is G or A.

[0009] In a second aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, and the product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequences are shown in SEQ ID NO: 2 to 3.

[0010] In a third aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, and the product is a detection kit, and the detection kit includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequences are shown in SEQ ID NO: 2 to 3.

[0011] In a fourth aspect, the present invention provides an application of a product for detecting the above-mentioned SNP molecular marker, which is used for identifying or assisting in identifying the quality of bull semen.

[0012] In a fifth aspect, the present invention provides an application of a product for detecting the above-mentioned SNP molecular marker, which is used for predicting or assisting in predicting the reproductive performance of bulls.

[0013] In a sixth aspect, the present invention provides a method for identifying the quality of bull semen, which detects the genotype of the above-mentioned SNP molecular marker in the semen of the bull to be tested, and identifies or assists in identifying the quality of bull semen according to the genotype of the SNP molecular marker of the bull to be tested; the SNP genotypes of bull semen quality from high to low are GG, GA, and AA in sequence.

[0014] In a seventh aspect, the present invention provides a method for predicting or assisting in predicting the reproductive performance of bulls, including the following steps: (1) Using the genomic DNA of the blood or semen of the bull to be tested as a template; (2) Designing specific primers for the above-mentioned SNP molecular marker, performing a PCR reaction to obtain an amplified product sequence; (3) Sequencing to determine the polymorphism of the SNP molecular marker in the amplified product sequence, and the SNP genotypes of bull semen quality from high to low are GG, GA, and AA in sequence.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an SNP locus related to semen quality of the CCDC89 gene. By detecting the polymorphism of this SNP locus, the detection of bull semen quality and the identification of reproductive performance can be realized, thereby assisting in breeding and providing reliable support for breeding high-quality offspring, with advantages such as high reliability, high efficiency, and low cost. Description of the Drawings

[0016] Figure 1 It is a peak map of the position of the SNP molecular marker of the CCDC89 gene. Detailed Embodiments

[0017] To enable those skilled in the art to better understand the solution of this application, the following will clearly and completely describe this application in combination with embodiments and the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application. The instruments and reagents used in the embodiments are from commercial channels without special instructions.

[0018] Example 1 A total of 215 experimental breeding bulls were from Beijing Dairy Cattle Center, Shanghai Bright Holstein Husbandry Co., Ltd. and Shandong Oaks Breeding Bull Station respectively. The semen of the breeding bulls was collected, and genomic DNA was extracted respectively and diluted to 50 ng / μL for standby. At the same time, the semen collection volume, sperm density, sperm motility, sperm malformation rate, post-thaw sperm motility, final motility and other trait indicators of each breeding bull were detected and recorded.

[0019] According to the gene sequence of gene CCDC89 (NCBI reference sequence Gene ID: 538595), amplification primers were designed, and PCR amplification was carried out using the genomic DNA of the breeding bull as a template.

[0020] PCR amplification system (25 μL): template (50 ng / μL) 1 μL, 1 μL of upstream and downstream primers at 10 μmol / L each, 12.5 μL of 2×Taq PCR MasterMix, ddH 2 O 9.5 μL.

[0021] PCR reaction conditions: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min 30 s, 35 cycles; extension at 72°C for 10 min, and preservation at 4°C.

[0022] The obtained PCR products were sent to Beijing Genomics Institute for sequencing. The SnapGene software was used to compare the sequencing results of different samples, and combined with the sequencing peak map, the SNP site in the target fragment was determined to be g.-725G>A, as Figure 1 shown.

[0023] The Excel software was used to calculate gene frequencies, genotype frequencies and allele frequencies, and the SPSS 26.0 software was used to conduct an association analysis on the polymorphism of the CCDC89 gene. The experimental results were expressed as "mean ± standard error". When P<0.01, it indicated a highly significant difference, and when P<0.05, it indicated a significant difference. See Table 1 below.

[0024] Table 1 Results of association analysis between SNP site of CCDC89 gene and semen quality Note: Different lowercase letters in the same column indicate significant differences (P < 0.05); the same lowercase letters or no letters indicate no significant differences (P > 0.05).

[0025] As can be seen from Table 1, when the SNP locus genotypes are GG and GA combinations, their semen collection volume and sperm density are more superior, and they can be used as molecular markers for screening individuals with high semen quality.

[0026] Example 2 Primers were designed for the sequence SEQ ID NO:1 containing the SNP molecular marker g.-725G>A, and the primer sequences are as follows: Forward primer: ACAGACAGGGCCAACAAAGG, SEQ ID NO:2, Reverse primer: CGGATCTCCGCTTCAGGATG, SEQ ID NO:3.

[0027] The specific sequence of SEQ ID NO:1 containing the SNP locus is as follows: ACAGACAGGGCCAACAAAGGAAATTTCAATAGCTAGGTTAGGTTAGGGAATAAAGCAGCAGGCAGGTCCAGAGGAAGAAAATGATAGAGAGACATCAGAGTCTCACAGTTTTTAAATTATATATAACTTTTATATCTTTTAGATGTTCAACTTAGTCCAATTAAGCTTTACCTTATTCGTCTCTTACATAATATGTAGGCTAAGAAAGTCCTTCCTCACCCAGGGCTTCAATGCTTACCTTTATTTTCCTCTAGTTTCCATTTTTAAAAAGTATTTTATTTTTGGCTCTGTCGAGTCTTAGTTGCAGCATGCAGGATCTTCATTGTGGCATAGGGGTCTTTTCATGGCGGAGCACAAATTCTTTGTTACCACGTTCCGGCTTCTCTCTAGTTGAGGCACCGTGGGCTCAGTAGTTGTTGTTCAGGGGCTTAGTTGCCCGACCAAGGATCGAATCCTAGTCCCCTGGATTGCAAGGCAGGTTCTTAACAACAGTCTACCAGGGACGTCCCTCCATGTTTAATATTTTGTTTTCATTTTAGTCCTTACATTTAACATTAAGCATTTCAGATGTTTAATCCATCTGAAACTGACTTTGGTGTGTATAAGGTAAGCCTCATTTGAACTTTTGTGTGTGT GTTTTAATGTTTATCACACCTATATTGTCCATTAGGCTTTTCTCTGTAACCCTATTGTGTTAATGGGTAAAAAGGGAGTTCTAGCTAATAAATATATTCCCAGCTGGGGACAGTTCTTCAAGAAAGAAGAGACATTTCCCTGGGGTTTCTTCTTTCACTGAGCTGTGTTAATCACTACAGGTACAAAGTCACAGCCATTTAGGATCCTTGTTCGCAGGGTCCTTCTGCTACTTTGTATTTATAGATTACAAATTTCTTTACAGAGCCAACGGTTTCCATGCAGAGGACTTTATTCTCATGACCACTGAAGTGGGGACAGGGAGGAGGACTATGTCACCAGTGCTTGATTTGTTTACTCCCACAAGAGATTAGGTGGAGTCAGGTTTCTTACCCCTGATGCTGGCTGGAAATCAAGTGGGGCTGGCATCTCTGTATAGTACATGCCAGACCCTGGGCTGTTAGCGGAGGGCTGTGATTGGCTAGAAAGGCAAGCATAACCTGACATGATTGGCTCTGGACTCCCTCCTGTTGTTACTCCACAGCAGTCTGAAGACCGGTCCACCAATCACAGGGCTCCTTACTGGGTGCACGAGCAACTGCGGGAGATTGCCGGGAGACCCTAGCAACACCGTGGCGTTTGAAATCTGGACGGTGGGGCGCTGTGCAGTCAGCTGTGCAGTCAGTAGAGGAGCGTGCCAATGCCTCAGGAAGAGTCGGCTCCCAGGATGGACACCCCATCCTCTGAAGAACCCTTAGATAAGCAAAACAGAAAACTGGAAGACCAGGAAGAGGAGATGGGGTTTAAGGAGCTGGATGGTCTGAGGGAAGCCTTGGCGAACCTCCGGGGGCTGTCCGAGGAGGACAAGAGTGAGCGGGCGATGCTGTGTTCCCGCATCCAGGAGCAGTCCCAGCTCATCTGCATCCTGAAGCGGAGATCC, where the SNP site is at position 636.

[0028] Collect the semen of experimental bulls, extract the total DNA as a template, perform PCR amplification using SEQ ID NO: 2-3 as primers, and sequence the amplification products to identify the polymorphism of SNP sites. At the same time, detect the semen quality of experimental bulls. The results show that the genotype combinations of SNP sites correspond to the semen quality, that is, the genotypes corresponding to the semen quality from high to low are GG, GA, and AA in turn.

[0029] In this article, specific examples are used to elaborate on the inventive concept in detail. The description of the above embodiments is only used to help understand the core idea of the present invention. It should be noted that for those of ordinary skill in the art, any obvious modifications, equivalent substitutions or other improvements made without departing from the inventive concept shall be included in the protection scope of the present invention.

Claims

1. A bull semen quality-related SNP molecular marker based on the CCDC89 gene, characterized in that: The SNP molecular marker is located at position 9868636 of the cattle genome chr29, and the polymorphism is G or A.

2. The SNP molecular marker according to claim 1, characterized in that: The SNP molecular marker is the 636th nucleotide of SEQ ID NO: 1 in the sequence list, which is G or A.

3. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

4. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The product is a detection kit, which includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

5. Use of the product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Used to identify or assist in identifying the quality of bull semen.

6. Use of the product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Used to predict or assist in predicting bull reproductive performance.

7. A method for identifying the quality of bull semen, characterized in that: Detect the genotype of the SNP molecular marker of claim 1 or 2 in the bull semen to be tested, and identify or assist in identifying the bull semen quality based on the genotype of the SNP molecular marker of the bull to be tested; the SNP genotypes of the bull semen quality from high to low are GG, GA, and AA.

8. A method for predicting or assisting in predicting the reproductive performance of a bull, characterized in that: The following steps are involved: (1) Using the genomic DNA of the blood or semen of the bull to be tested as a template; (2) Designing specific primers for the SNP molecular marker described in claim 1 or 2, performing a PCR reaction, and obtaining an amplified product sequence; (3) Sequencing was used to determine the polymorphism of SNP molecular markers in the amplified product sequence. The SNP genotypes of bull semen quality from high to low were GG, GA, and AA, respectively.

Images