A SNP molecular marker related to bull semen quality based on CCDC89 gene and its application

Abstract

The present invention discloses a bull semen quality-related SNP molecular marker based on the CCDC89 gene and its application, belonging to the field of genetic molecular biology technology. The SNP molecular marker is located at the chr29:9868636 position of the bovine CCDC89 gene, and the gene polymorphism is G or A. When the SNP site is G, high semen quality is exhibited. By detecting the polymorphism of this SNP site, the bull semen quality can be tested and the reproductive performance can be identified, thereby assisting breeding and providing reliable support for breeding high-quality next generations. The method has the advantages of high reliability, high efficiency, and low cost.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic molecular biology, and in particular to a bull semen quality-related SNP molecular marker based on the CCDC89 gene and an application thereof. Background Art

[0002] Bull semen quality primarily includes semen yield, sperm density, total sperm count, fresh semen motility, sperm deformity rate, color, nail integrity rate, and post-freezing motility. Semen quality not only affects conception rates in cows but also the growth, development, and performance of calves. Therefore, the selection of superior sires plays a crucial role in the genetic improvement and reproduction of dairy cows. Research on genes associated with bull semen quality encompasses multiple functional areas, primarily encompassing reproductive regulation, spermatogenesis, and metabolic regulation.

[0003] Combining molecular biology with genetic breeding techniques can effectively accelerate the stabilization of genetic traits and shorten the breeding cycle, and is currently a major research and development direction for the screening and breeding of high-quality individuals. Single nucleotide polymorphisms (SNPs) are site polymorphisms caused by the substitution of a single base. They have high genetic stability, abundant loci, and are widely distributed, making them suitable for bull semen quality testing. However, current research on genes that influence bull semen quality is limited, and further exploration and development are needed.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The purpose of the present invention is to provide a bull semen quality-related SNP molecular marker based on the CCDC89 gene and its application.

[0006] The technical solution of the present invention is described in detail as follows:

[0007] In a first aspect, the present invention provides a bull semen quality-related SNP molecular marker based on the CCDC89 gene, wherein the SNP molecular marker is located at position chr29: 9868636 of the bovine genome, and the polymorphism is G or A.

[0008] The coiled-coil domain containing (CCDC) protein family is often associated with fundamental biological processes such as cytoskeleton formation, signal transduction, or organelle localization. Currently, little research has been conducted on the bovine CCDC89 gene. This study of this gene in the present invention indicates that its function is related to bull semen quality, and that polymorphisms at its SNP sites can affect semen quality.

[0009] Optionally or preferably, the SNP molecular marker is the 636th nucleotide of SEQ ID NO: 1 in the sequence listing, which is G or A.

[0010] In a second aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, wherein the product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0011] In a third aspect, the present invention provides a product for detecting the above-mentioned SNP molecular markers, wherein the product is a detection kit, which includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2~3.

[0012] In a fourth aspect, the present invention provides an application of a product for detecting the above-mentioned SNP molecular marker, which is used for identifying or assisting in identifying the quality of bull semen.

[0013] In a fifth aspect, the present invention provides an application of a product for detecting the above-mentioned SNP molecular markers, which is used to predict or assist in predicting the reproductive performance of bulls.

[0014] In a sixth aspect, the present invention provides a method for identifying the quality of bull semen, detecting the genotype of the above-mentioned SNP molecular marker in the semen of the bull to be tested, and identifying or assisting in identifying the quality of the bull semen based on the genotype of the SNP molecular marker of the bull to be tested; the SNP genotypes of the bull semen quality from high to low are GG, GA, and AA.

[0015] In a seventh aspect, the present invention provides a method for predicting or assisting in predicting the reproductive performance of a bull, comprising the following steps:

[0016] (1) Using the genomic DNA of the blood or semen of the bull to be tested as a template;

[0017] (2) Design specific primers for the above-mentioned SNP molecular markers, perform PCR reaction, and obtain the amplified product sequence;

[0018] (3) Sequencing was used to determine the polymorphism of SNP molecular markers in the amplified product sequence. The SNP genotypes of bull semen quality from high to low were GG, GA, and AA.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a SNP site in the CCDC89 gene that is associated with semen quality. By detecting the polymorphism of this SNP site, the semen quality of bulls can be detected and the reproductive performance can be identified, thereby assisting breeding and providing reliable support for breeding high-quality next generations. It has the advantages of high reliability, high efficiency, and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1This is the peak diagram of the SNP molecular marker position of the CCDC89 gene. DETAILED DESCRIPTION

[0022] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0023] Example 1

[0024] A total of 215 bulls were used in the study, originating from the Beijing Dairy Center, Shanghai Guangming Holstein Farming Co., Ltd., and Shandong Aokes Bull Station. Semen was collected from the bulls, and genomic DNA was extracted and diluted to 50 ng / μL for later use. Semen collection volume, sperm density, sperm motility, sperm deformity rate, post-freezing sperm motility, and final sperm motility were also measured and recorded for each bull.

[0025] Amplification primers were designed based on the CCDC89 gene sequence (NCBI reference sequence Gene ID: 538595), and PCR amplification was performed using the genomic DNA of the bull as a template.

[0026] PCR amplification system (25 μL): 1 μL of template (50 ng / μL), 1 μL of 10 μmol / L upstream and downstream primers, 12.5 μL of 2× Taq PCR Master Mix, and 9.5 μL of ddH2O.

[0027] PCR reaction conditions: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min 30 s, 35 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0028] The obtained PCR products were sent to Beijing BGI for sequencing. The sequencing results of different samples were compared using SnapGene software. Combined with the sequencing peak graph, the SNP site in the target fragment was determined to be g.-725G>A. Figure 1 shown.

[0029] Gene frequencies, genotype frequencies, and allele frequencies were calculated using Excel, and association analysis of CCDC89 gene polymorphisms was performed using SPSS 26.0. Results are presented as mean ± standard error, with P < 0.01 indicating an extremely significant difference and P < 0.05 indicating a significant difference (see Table 1 below).

[0030] Table 1 Results of association analysis between CCDC89 gene SNP sites and semen quality

[0031]

[0032] Note: Different letters in the same column indicate significant differences (P < 0.05); the same letters or no letters in the same column indicate no significant differences (P > 0.05).

[0033] As shown in Table 1, when the SNP locus genotype is a combination of GG and GA, the semen collection amount and sperm density are superior, and it can be used as a molecular marker to screen individuals with high semen quality.

[0034] Example 2

[0035] Primers were designed for the sequence SEQ ID NO: 1 containing the SNP marker g.-725G>A. The primer sequences are shown below:

[0036] Upstream primer: ACAGACAGGGCCAACAAAGG, SEQ ID NO: 2,

[0037] Downstream primer: CGGATCTCCGCTTCAGGATG, SEQ ID NO: 3.

[0038] The specific sequence of SEQ ID NO:1 containing the SNP site is as follows:

[0039] ACAGACAGGGCCAACAAAGGAAATTTCAATAGCTAGGTTAGGTTAGGGAATAAAGCAGCAGGCAGGTCCAGAGGAAGAAAATGATAGAGAGACATCAGAGTCTCACAGTTTTTAAATTATATATAACTTTTATATCTTTTAGATGTTCAACTTAGTCCAATTAAGCTTTACCTTATTCGTCTCTTACATAATATGTAGGCTAAGAAAGTCCTTCCTCACCCAGGGCTTCAATGCTTACCTTTATTTTCCTCTAGTTTCCATTTTTAAAAAGTATTTTATTTTTGGCTCTGTCGAGTCTTAGTTGCAGCATGCAGGATCTTCATTGTGGCATAGGGGTCTTTTCATGGCGGAGCACAAATTCTTTGTTACCACGTTCCGGCTTCTCTCTAGTTGAGGCACCGTGGGCTCAGTAGTTGTTGTTCAGGGGCTTAGTTGCCCGACCAAGGATCGAATCCTAGTCCCCTGGATTGCAAGGCAGGTTCTTAACAACAGTCTACCAGGGACGTCCCTCCATGTTTAATATTTTGTTTTCATTTTAGTCCTTACATTTAACATTAAGCATTTCAGATGTTTAATCCATCTGAAACTGACTTTGGTGTGTATAAGGTAAGCCTCATTTGAACTTTTGTGTGTGT GTTTTAATGTTTATCACACCTATATTGTCCATTAGGCTTTTCTCTGTAACCCTATTGTGTTAATGGGTAAAAAGGGAGTTCTAGCTAATAAATATATTCCCAGCTGGGGACAGTTCTTCAAGAAAGAAGAGACATTTCCCTGGGGTTTCTTCTTTCACTGAGCTGTGTTAATCACTACAGGTACAAAGTCACAGCCATTTAGGATCCTTGTTCGCAGGGTCCTTCTGCTACTTTGTATTTATAGATTACAAATTTCTTTACAGAGCCAACGGTTTCCATGCAGAGGACTTTATTCTCATGACCACTGAAGTGGGGACAGGGAGGAGGACTATGTCACCAGTGCTTGATTTGTTTACTCCCACAAGAGATTAGGTGGAGTCAGGTTTCTTACCCCTGATGCTGGCTGGAAATCAAGTGGGGCTGGCATCTCTGTATAGTACATGCCAGACCCTGGGCTGTTAGCGGAGGGCTGTGATTGGCTAGAAAGGCAAGCATAACCTGACATGATTGGCTCTGGACTCCCTCCTGTTGTTACTCCACAGCAGTCTGAAGACCGGTCCACCAATCACAGGGCTCCTTACTGGGTGCACGAGCAACTGCGGGAGATTGCCGGGAGACCCTAGCAACACCGTGGCGTTTGAAATCTGGACGGTGGGGCGCTGTGCAGTCAGCTGTGCAGTCAGTAGAGGAGCGTGCCAATGCCTCAGGAAGAGTCGGCTCCCAGGATGGACACCCCATCCTCTGAAGAACCCTTAGATAAGCAAAACAGAAAACTGGAAGACCAGGAAGAGGAGATGGGGTTTAAGGAGCTGGATGGTCTGAGGGAAGCCTTGGCGAACCTCCGGGGGCTGTCCGAGGAGGACAAGAGTGAGCGGGCGATGCTGTGTTCCCGCATCCAGGAGCAGTCCCAGCTCATCTGCATCCTGAAGCGGAGATCC, where the SNP site is at the 636th position.

[0040] Semen from the experimental bulls was collected, and total DNA was extracted as a template. PCR amplification was performed using primers from SEQ ID NOs: 2-3. The amplified products were sequenced to identify SNP polymorphisms. Semen quality of the experimental bulls was also tested. The results showed that the SNP genotype combinations corresponded consistently with semen quality: GG, GA, and AA were the genotypes corresponding to high to low semen quality.

[0041] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting bull semen quality-related SNP molecular markers of the CCDC89 gene in the preparation of a product for identifying or assisting in identifying bull semen quality, characterized in that: The SNP molecular marker is located at position 9868636 of the cattle genome chr29, and the polymorphism is G or A; NCBI reference sequence of CCDC89 gene Gene ID: 538595; The semen quality includes semen collection volume and / or sperm density.

2. The use according to claim 1, characterized in that The SNP molecular marker is the 636th nucleotide of SEQ ID NO: 1 in the sequence list, which is G or A.

3. The use according to claim 1, characterized in that The reagents include a primer pair, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

4. The use according to claim 1, characterized in that The product is a detection kit, which includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

Images