An anti-tumor vaccine and a preparation method and application thereof

By preparing the BCG-CW@LNT vaccine, which combines the immune-activating properties of BCG cell walls with the immunomodulatory function of tumor cells frozen and thawed in liquid nitrogen, the problem of weak immunogenicity of existing tumor vaccines has been solved, achieving significant anti-cancer immune response and long-term tumor treatment effects, while avoiding side effects.

CN120093906BActive Publication Date: 2026-04-17NANJING DRUM TOWER HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510313206.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-17
Publication Date
2026-04-17
Estimated Expiration
2045-03-17

AI Technical Summary

Technical Problem

Existing cancer vaccines have weak immunogenicity and are difficult to induce a long-term effective immune response, leading to new and recurrent infections. Traditional vaccines such as BCG have side effects in the treatment of bladder cancer.

Method used

An anti-tumor vaccine, BCG-CW@LNT, was prepared by mixing BCG-CW, a cell wall component extracted from BCG, with LNT tumor cells that had been frozen and thawed in liquid nitrogen. This process simulates antigen presentation in the tumor microenvironment and enhances anti-cancer immunity.

Benefits of technology

It significantly activates bone marrow-derived dendritic cells, enhances antigen presentation capacity, promotes tumor-specific CD8+ T cell responses, provides long-term anti-tumor therapeutic effects, avoids side effects, and demonstrates good safety and tolerability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120093906B_ABST
    Figure CN120093906B_ABST
Patent Text Reader

Abstract

This invention relates to the field of tumor vaccines, specifically to an anti-tumor vaccine, its preparation method, and its application. The invention prepares an anti-tumor vaccine, BCG-CW@LNT, by mixing cell walls extracted from BCG vaccine as an immune adjuvant with LNT cells obtained from tumor cells through rapid freeze-thaw cycles in liquid nitrogen. This vaccine utilizes these "therapeutic dead cells" to induce a broad antigen response throughout the entire cell, mimicking the natural presentation of antigens in the tumor microenvironment, thereby enhancing anti-cancer immunity. In bladder cancer and lung cancer models, BCG-CW@LNT demonstrated good anti-tumor therapeutic effects. Furthermore, due to the presence of memory T cells, it exhibits a long-term memory effect, providing long-term anti-tumor and preventative effects, effectively preventing tumor recurrence and offering a novel option for tumor treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of tumor vaccines, specifically to an anti-tumor vaccine, its preparation method, and its application. Background Technology

[0002] Among treatment methods for malignant tumors, therapeutic tumor vaccines represent a significant breakthrough. By activating the patient's own immune system, these vaccines utilize tumor cells, tumor-specific antigens, or related antigens to induce cellular and humoral immune responses, thereby achieving the goal of eliminating or controlling the tumor. However, current traditional vaccines generally suffer from weak immunogenicity and difficulty in inducing a long-term, effective immune response, leading to numerous new and recurrent infections. Further research and innovation are needed to overcome these challenges and achieve wider clinical application of tumor vaccines.

[0003] Currently, apart from BCG instillation, which has been used for over 40 years to treat high-risk non-muscle-invasive bladder cancer (NMIBC), research on cancer-specific tumor vaccines is still limited. Therefore, developing therapeutic tumor vaccines based on BCG may be worth exploring, potentially providing a safer and more effective new immunotherapy option for cancer. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an anti-tumor vaccine BCG-CW@LNT, which addresses the shortcomings of the prior art.

[0005] Another technical problem to be solved by the present invention is to provide a method for preparing the above-mentioned anti-tumor vaccine.

[0006] The final technical problem to be solved by this invention is to provide the application of the above-mentioned anti-tumor vaccine in the preparation of anti-tumor vaccine formulations for cancer treatment.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0008] A method for preparing an anti-tumor vaccine involves first extracting the main immune-activating component, cell wall component (BCG-CW), from BCG (Bacillus Calmette-Guérin). Subsequently, tumor cells are treated with liquid nitrogen via rapid freeze-thaw cycles to obtain LNT (Limited-Nutrient-Tissue) cells. Utilizing these "therapeutic dead cells," a broad antigen response is induced through whole-cell processing, mimicking the natural presentation of antigens in the tumor microenvironment, thereby enhancing anti-cancer immunity. Subsequently, BCG-CW is combined with LNTs to prepare the anti-tumor vaccine BCG-CW@LNT.

[0009] Specifically, the steps include the following:

[0010] (1) Collect the BCG bacteria by centrifugation, wash and resuspend them, then heat-inactivate them, and then use sonication to obtain a homogenate. After heat treatment of the homogenate, centrifuge to collect the precipitate. The precipitate is then defatted and deproteinized to prepare the BCG cell wall BCG-CW.

[0011] (2) Collect tumor cells by centrifugation and resuspend them in cryopreservation solution. After the cryopreservation solution containing tumor cells is frozen in liquid nitrogen, LNT cells are obtained.

[0012] (3) The antitumor vaccine BCG-CW@LNT is prepared by shaking and mixing the BCG-CW cell wall obtained in step (1) with the LNT cells obtained in step (2).

[0013] In step (1), the BCG bacteria are BCG bacteria in the logarithmic growth phase obtained through pre-culture.

[0014] Specifically, BCG bacteria were inoculated into Middlebrook 7H9 medium (purchased from Coolaber, catalog number MKC-301) for pre-culture and cultured with shaking at 37°C and 120 rpm until the logarithmic growth phase.

[0015] In step (1), the heat inactivation is performed under the following conditions: heating at 100-125°C for 10-20 minutes; the preferred condition is heating at 100°C for 20 minutes in a pressure cooker.

[0016] In step (1), the washing is performed with PBS buffer; the resuspension is performed in 1-10% Triton X-100, preferably in 2% Triton X-100.

[0017] In step (1), the centrifugation to collect the precipitate is carried out under the following conditions: centrifugation at 10000g to 16000g for 10 to 30 minutes at 4 to 25°C; the preferred conditions are: 25°C, 15000g, 20 minutes.

[0018] In step (1), the ultrasonic treatment is performed under the following conditions: 50-100 kHz, pulse period ultrasonic treatment for 10-20 min; the preferred treatment conditions are: 80 kHz, pulse period ultrasonic treatment for 20 min with 5s on and 5s off.

[0019] In step (1), the heat treatment conditions are: heating in a metal bath at 60-100℃ for 100-200 min; the preferred conditions are: heating in a metal bath at 80℃ for 180 min.

[0020] In step (2), the tumor cells are solid tumor cells, including subcutaneous tumors, in situ tumors, and metastatic tumors.

[0021] In step (2), the tumor cells include, but are not limited to, mouse-derived bladder cancer cell lines or mouse-derived non-small cell lung cancer cell lines. In the prior art, any tumor cells extracted from solid tumors are within the scope of protection of this invention and can be cryopreserved in liquid nitrogen to obtain LNT cells.

[0022] In some embodiments of the present invention, the mouse-derived bladder cancer cell line includes any one of the MB49 cell line, MB49-LUC-GFP cell line, and MB49-OVA cell line; the mouse-derived lung cancer cell line is an LLC cell line.

[0023] In step (2), the cryopreservation solution is a serum-free cell cryopreservation solution, purchased from NewSemi, catalog number: C40100.

[0024] In step (2), the density of tumor cells in the cryopreservation solution containing tumor cells is 5-10 M / mL.

[0025] In step (2), the liquid nitrogen cryopreservation treatment is performed 1 to 3 times, preferably 2 times. Specifically, the cryopreservation solution containing tumor cells is immersed in liquid nitrogen for 10 to 16 hours, then removed and placed on ice to thaw for 60 to 180 minutes; preferably, the cryopreservation solution containing tumor cells is immersed in liquid nitrogen for 12 hours, then removed and placed on ice to thaw for 90 to 120 minutes.

[0026] In step (3), the mixing ratio of the number of LNT cells to the mass of BCG-CW cell wall is 1:5-30 ng, with a preferred mixing ratio of 1:15 ng.

[0027] The anti-tumor vaccine prepared by the method described above is also within the scope of protection of this invention.

[0028] The anti-tumor vaccine includes BCG-CW cell wall and LNT tumor cells frozen in liquid nitrogen; the BCG-CW cell wall is attached to the surface of LNT cells using LNT cells as a carrier.

[0029] The application of the anti-tumor vaccine in the preparation of agents for the prevention and / or treatment of tumor diseases is also within the scope of protection of this invention.

[0030] The tumor diseases mentioned include, but are not limited to, bladder cancer and lung cancer.

[0031] Specifically, in some embodiments of the present invention, after verifying the immune activation effect of BCG-CW@LNT in vivo and in vitro, the efficacy was further verified in bladder cancer and lung cancer models. The BCG-CW@LNT vaccine prepared by the present invention showed good anti-tumor therapeutic effects in both bladder cancer and lung cancer models. Furthermore, due to the presence of memory T cells, it has a long-term memory effect, which means that it can provide long-term anti-tumor therapeutic and preventive effects.

[0032] Tumor vaccines hold significant research value and application prospects in the field of tumor immunology. Traditionally, tumor vaccines have been primarily viewed as a treatment method, aiming to eliminate existing tumors by activating the body's immune system. However, recent studies have shown that tumor vaccines also demonstrate great potential in preventing tumor formation and recurrence. The core objective of preventative tumor vaccines is to effectively intervene in the early stages of tumor development or recurrence by activating the immune system in advance and inducing a specific immune response against tumor antigens.

[0033] In some embodiments of this invention, BCG-CW@LNT, as a novel anti-tumor vaccine, combines the immune-activating properties of BCG-CW cell walls with the immunomodulatory function of LNTs, exhibiting a significant immune-enhancing effect. Its research on tumor prevention not only provides new insights into tumor immunoprophylaxis but also lays an important foundation for exploring more efficient tumor vaccine design strategies.

[0034] Specifically, in some embodiments of the present invention, the acute and long-term toxicity of BCG-CW@LNT was comprehensively evaluated by detecting routine blood tests, blood biochemical indicators, pathological changes in the spleen, and pathological analysis of major tissues and organs in mice, demonstrating that the BCG-CW@LNT prepared by the present invention has good safety.

[0035] Beneficial effects:

[0036] (1) This invention prepares an anti-tumor vaccine, BCG-CW@LNT, by using cell walls extracted from BCG as an immune adjuvant and mixing them with LNT cells obtained by rapid freeze-thaw of tumor cells in liquid nitrogen. This vaccine can utilize these "therapeutic dead cells" to induce a broad antigen response through whole cells, mimicking the natural presentation of antigens in the tumor microenvironment, thereby enhancing anti-cancer immunity.

[0037] (2) In in vitro experiments, the BCG-CW@LNT prepared using this invention significantly activated bone marrow-derived dendritic cells (BMDCs), effectively enhancing their immune function by promoting their maturation and enhancing their antigen-presenting ability. Particularly in antigen processing, the antigens carried on the surface of BCG-CW@LNT-OVA (taking ovalbumin, OVA as an example) can be efficiently taken up and processed by dendritic cells, and then presented to spleen-derived T cells in OT1 mice, activating the proliferation of specific T cells and significantly increasing the release of anti-tumor cytokines (such as TNF-α and IFN-γ). This mechanism not only enhances the anti-tumor ability of dendritic cells but also effectively mobilizes T cell-mediated specific immune responses.

[0038] (3) In in vivo experiments, BCG-CW@LNT, administered systemically, effectively accumulated in tumors and lymph nodes, fully utilizing its adjuvant function as BCG-CW to efficiently deliver LNT antigens to antigen-presenting cells in tumors and lymph nodes, significantly enhancing tumor-specific CD8 expression. + T cell response. In addition, the homing ability of LNT cells allows BCG-CW@LNT to accumulate in tumor tissue, thereby promoting the infiltration of M1 macrophages in the tumor microenvironment and further enhancing the tumor's immune killing effect.

[0039] (4) In bladder and lung cancer models, the BCG-CW@LNT prepared in this invention not only demonstrated good anti-tumor therapeutic effects (significantly inhibiting the growth of subcutaneous and in situ tumors and significantly prolonging the survival of mice), but also avoided the common toxic side effects such as weight loss and cystitis during bladder instillation. Furthermore, tumor growth was significantly inhibited after pre-immunotherapy with BCG-CW@LNT, indicating that the vaccine can effectively induce an anti-tumor memory immune response in vivo, providing long-term tumor immune protection. That is, due to the presence of memory T cells, it has a long-term memory effect, providing long-term anti-tumor and preventative effects, offering a novel option for tumor treatment.

[0040] (5) The BCG-CW@LNT prepared in this invention exhibits good safety and tolerability. The safety assessment results further confirm that BCG-CW@LNT treatment not only did not cause an acute inflammatory response, but also did not have any adverse effects on the physiological and biochemical functions of mice after long-term (3 weeks) administration, nor did it cause significant damage to major tissues and organs.

[0041] (6) The BCG-CW@LNT prepared in this invention is a novel anti-tumor vaccine that combines the immune-activating properties of BCG-CW cell walls with the immunomodulatory function of LNTs, exhibiting a significant immune-enhancing effect. Its research on tumor prevention not only provides new ideas for tumor immunoprophylaxis but also lays an important foundation for exploring more efficient tumor vaccine design strategies.

[0042] (7) The innovation of the BCG-CW@LNT anti-tumor vaccine prepared in this invention is also reflected in its potential for future personalized treatment. Based on the tumor tissue characteristics of patients with different types of tumors, corresponding LNT cells can be customized to combine with patient-specific antigens, further optimizing the efficacy of the BCG-CW@LNT vaccine. This personalized strategy enables precise treatment based on the patient's specific condition, not only improving the targeting and efficacy of treatment but also effectively reducing adverse reactions and side effects. With the continuous development of tumor immunotherapy, the BCG-CW@LNT anti-tumor vaccine, with its highly efficient immune activation, enhanced anti-tumor immune response, excellent safety, and significant therapeutic effects, provides broad application prospects for future clinical use. Attached Figure Description

[0043] The present invention will be further described in detail below with reference to the accompanying drawings, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0044] Figure 1 SEM images of live MB49 cells and corresponding LNT cells (scale bar = 10 μm).

[0045] Figure 2 This image shows the changes in size and surface structure of LNT cells analyzed using flow cytometry.

[0046] Figure 3 The image shows the fluorescence staining of live MB49 cells and their corresponding LNT cells under a fluorescence microscope.

[0047] Figure 4 The figure shows the results of the CCK8 cell proliferation experiment for live MB49 cells and their corresponding LNT cells.

[0048] Figure 5 The cell membrane structures of live MB49 cells and their corresponding LNT cells under a fluorescence microscope.

[0049] Figure 6 Images of tumor formation in mice after transplantation of live MB49 cells and corresponding LNT cells.

[0050] Figure 7 Survival curves of mice after transplantation of live MB49 cells and corresponding LNT cells.

[0051] Figure 8 Electrophoretic Coomassie brilliant blue staining image of total protein distribution in live MB49 cells and corresponding LNT cells.

[0052] Figure 9 The figure shows the results of Western Blot (WB) detection of GFP expression levels on the surface of live MB49-LUC-GFP cells and their corresponding LNT cells.

[0053] Figure 10 The results show the proteomics analysis of live MB49 cells and their corresponding LNT cells. A is the volcano plot of the proteomic analysis; B is the proteomic heatmap; C is the GO analysis plot of upregulated proteins; and D is the GO analysis plot of downregulated proteins.

[0054] Figure 11 Fluorescent images of BCG-CW adhering to the cell surface.

[0055] Figure 12 High-resolution scanning electron microscopy imaging of BCG-CW@LNT cells prepared with different ratios of LNT cells and BCG-CW (scale bar = 200 μm).

[0056] Figure 13 To detect the CD80+ / CD86+ / MHCII+ ratio in BMDCs after BCG-CW stimulation. In this study, A represents the proportion of BMDCs expressing CD80 and CD86 on the surface after treatment with BCG, BCG-CW, LNT, and BCG-CW@LNT; B represents the proportion of BMDCs expressing MHC-II molecules.

[0057] Figure 14 Cytokine levels in BCG-CW, BCG-CW@LNT, and BMDC co-incubation systems were detected by ELISA.

[0058] Figure 15 The levels of cytokines in BCG-CW, BCG-CW@LNT and BMDC co-incubation systems were detected by qRT-PCR.

[0059] Figure 16 This study focuses on the activation of cytotoxic T cells. A represents the activation effect of MB49-OVA cells, LNT-OVA cells, and BCG-CW@LNT-OVA on OT1 mouse spleen T cells, detected by flow cytometry; B represents the results of flow cytometry statistical analysis; C represents the level of specific T cells detected by flow cytometry; D represents the results of flow cytometry statistical analysis; and E represents the detection of activated CD137. + Specific T cells; F represents the detection of activated CD69. +Specific T cells. Note: no significant difference in ns; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0060] Figure 17 The distribution of BCG-CW@LNT in various tissues of mice.

[0061] Figure 18 cytotoxic CD8 in tumors + T cell activation level.

[0062] Figure 19 This represents the activation level of dendritic cells (DCs) in tumors.

[0063] Figure 20 The levels of M1 and M2 macrophages in the tumor.

[0064] Figure 21 Cytotoxic CD8 in paratumor lymph nodes + T cell activation level.

[0065] Figure 22 This represents the activation level of dendritic cells (DCs) in lymph nodes adjacent to the tumor.

[0066] Figure 23 The efficacy of BCG-CW@LNT in a mouse subcutaneous bladder cancer model is shown in Figure 1. Figure A shows the tumor volume growth curves for each group of mice; Figure B shows tumor tissue images for each group of mice after treatment; Figure C shows the statistical analysis of tumor volume among groups; and Figure D shows the body weight change curves for each group of mice.

[0067] Figure 24 The efficacy of BCG-CW@LNT in a mouse model of orthotopic bladder cancer is shown. A represents in vivo imaging tracking of orthotopic tumor growth in mice (n=5); B represents the growth trend of orthotopic bladder tumors in mice based on fluorescence intensity values; C represents the survival curves of mice in each group; D represents the statistical graph of fluorescence intensity in each group; and E represents HE staining of bladder cancer tissue in each group.

[0068] Figure 25 The efficacy of BCG-CW@LNT in a mouse model of bladder cancer with lung metastases is shown. A represents in vivo fluorescence imaging and HE staining of lung tissue after treatment; B represents quantitative statistics of fluorescence intensity; and C represents mouse survival curves. Note: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0069] Figure 26This study assesses the efficacy of BCG-CW@LNT in a mouse subcutaneous lung cancer tumor model. A represents the measurement of subcutaneous tumor diameter and volume from Day 4 after tumor implantation, used to track tumor growth in each group; B represents the statistical analysis of subcutaneous tumor volume in each group; C represents images of tumor tissue in each group after treatment; and D represents a comparison of body weight changes in each treatment group. Note: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

[0070] Figure 27 This study describes an experiment using BCG-CW@LNT to prevent tumor formation. A shows a schematic diagram of the pre-immunization and tumor inoculation process in mice; B shows the statistical results of tumor volume changes over time in each group of mice; and C shows images of tumor growth in mice under different immunization treatments.

[0071] Figure 28 This study evaluates the safety of the BCG-CW@LNT vaccine. A shows the complete blood count results 24 hours after a single injection and 21 days after long-term BCG-CW@LNT injection, including key blood cell markers (white blood cells, red blood cells, neutrophils, peripheral blood mononuclear cells, and platelets); B shows the blood biochemical analysis results, including liver and kidney function indicators (alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, total bilirubin, blood urea nitrogen, and creatinine levels) in each group of mice; C shows images of spleen size and weight in each treatment group; and D shows the HE staining results of the major organs (heart, liver, spleen, lungs, and kidneys) of the mice. Detailed Implementation

[0072] The present invention will be further described in detail below with reference to specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0073] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0074] In the following examples, the MB49, MB49-LUC-GFP, MB49-OVA, and LLC cell lines were all purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences. All cell lines were validated by STR and regularly tested for mycoplasma contamination.

[0075] Example 1: Preparation of BCG-CW cell wall from BCG

[0076] Bacillus Calmette-Guérin (BCG) bacteria were inoculated into Middlebrook 7H9 medium (Coolaber, catalog number MKC-301) and cultured with shaking at 37°C and 120 rpm until the logarithmic growth phase. The pre-cultured BCG culture was centrifuged at 5,000 × g for 10 min to collect the bacterial pellet. After washing with PBS and resuspending in 2% Triton X-100, the pellet was inactivated by heating at 100°C for 20 min in an autoclave. Subsequently, the pellet was sonicated for 20 min using a VCX 750 sonicator (Thermo Fisher Scientific, USA) with a pulse cycle of 80 kHz and 5 s on / 5 s off. The sonicated homogenate was heated in a metal bath at 80°C for 3 h, and then centrifuged at 15,000 × g for 20 min at 25°C to collect the insoluble fraction. To remove lipids and proteins, the precipitate was washed twice with 5 volumes of 2% (v / v) Triton X-100 and three times with 5 volumes of 2% (w / v) sodium dodecyl sulfate (SDS), centrifuged at 15,000 × g for 20 min after each wash. The resulting BCG-CW precipitate was further washed twice with 5 volumes of 10% (v / v) isopropanol and three times with 5 volumes of acetone to ensure complete removal of SDS. Subsequently, the sample was repeatedly washed with 10% isopropanol until the optical density (OD) of the supernatant at 280 nm was less than 0.05, indicating that residual contaminants had been removed. Finally, the purified BCG-CW was resuspended in 100% isopropanol and stored at -20 °C until use. The dry weight of BCG-CW was calculated by collecting the precipitate by centrifuging the suspension at 15,000 × g for 20 min, drying it overnight at 50 °C, and then weighing it.

[0077] Example 2: Obtaining LNT cells from MB49 tumor cells treated with liquid nitrogen.

[0078] MB49 cells (mouse bladder cancer cells) were collected, centrifuged at 850 rpm for 3 min, and resuspended in serum-free cryopreservation medium (purchased from C40100, serum-free cryopreservation medium), with a cell density of 5–10 M / mL. The cryopreservation medium was then immersed in liquid nitrogen for 12 h, followed by thawing on ice for 90–120 min. This freeze-thaw cycle was repeated 2–3 times to obtain liquid nitrogen-treated LNT cells. Before use, the cells were rapidly thawed in a 37°C water bath, centrifuged at 850 rpm for 3 min, washed with PBS, resuspended in PBS, and stored at 4°C until use.

[0079] 1. Characterization of LNT cell morphology

[0080] Live MB49 cells and LNT cells after liquid nitrogen freeze-thaw treatment were observed using scanning electron microscopy (SEM). Figure 1 The results showed that LNT cells were similar in size to live cells, but their cell surfaces were rougher. Further analysis using flow cytometry, specifically the forward scattered area (FSC-A) and side scattered area (SSC-A), confirmed the changes in LNT cell size and surface structure. Figure 2 ).

[0081] 2. Identification of LNT cell death status and membrane integrity

[0082] The death status of live cells and LNT cells was identified using the Calcein AM / PI live / dead cell double staining kit (purchased from Beyotime, catalog number: C2015M). Under a fluorescence microscope, all LNT cells were observed to be dead cells. Figure 3 Further validation was performed using a CCK-8 cell proliferation assay. Specifically, LNT cells were centrifuged (e.g., 1,000 rpm, 5 minutes), the supernatant was discarded, and the cells were resuspended in complete culture medium. Cells were seeded at a density of 2 × 10^3 cells per well in a 96-well plate, with a volume of 100 μL per well. Following the CCK-8 reagent instructions, the CCK-8 stock solution and complete culture medium were mixed at a 1:9 ratio (e.g., 10 μL CCK-8 stock solution + 90 μL culture medium) to prepare the CCK-8 working solution. 100 μL of the CCK-8 working solution was added to each well and gently shaken to mix. The 96-well plate was then placed back in a 37°C, 5% CO2 cell culture incubator and incubated in the dark for 2 hours (the specific time should be adjusted according to the cell type and growth status). After incubation, the 96-well plate was removed, and the liquid in the wells was gently shaken to mix. The absorbance (OD) of each well was measured at 450 nm using a microplate reader. 450 The results confirmed that LNT cells were dead cells and lacked the ability to proliferate. Figure 4 In addition, nuclear localization was performed using a DAPI staining kit (purchased from Beyotime, catalog number C1002), and live cells and LNT cells were stained with Dil membrane dye. The results showed that LNT cells, like live cells, maintained the integrity of their cell membrane structure. Figure 5 ).

[0083] 3. Subcutaneous tumor grafting experiment

[0084] Live MB49 cells and LNT cells were implanted subcutaneously into the right back of C57 mice at a concentration of 1×10^6 / 100μL, at a concentration of 100μL / mouse, to conduct a subcutaneous tumor implantation experiment, in order to observe their tumorigenicity and their impact on the survival of mice.

[0085] Experimental results showed that, over time, live MB49 cells formed significant subcutaneous tumors in mice, while LNT cells did not exhibit any tumorigenicity. Figure 6 Furthermore, survival curves revealed that all mice receiving live MB49 cell implantation died rapidly, while all mice treated with LNT cells survived. Figure 7 These results indicate that LNT cells treated with liquid nitrogen freeze-thaw not only lost their proliferative capacity but also completely lost their pathogenicity, further confirming their safety.

[0086] 4. To investigate whether the freezing and thawing of tumor cells with liquid nitrogen leads to the loss of key proteins.

[0087] A complete antigen profile can more comprehensively activate the immune system and induce a polyclonal immune response against tumors. Therefore, the integrity of antigenic components is crucial for the immunogenicity of tumor vaccines. To verify whether freezing and thawing tumor cells in liquid nitrogen leads to the loss of key proteins, thereby ensuring the integrity of antigenic components when used as a tumor vaccine, the following experiments were conducted.

[0088] (1) Investigation into the distribution of total protein in live MB49 cells and LNT cells

[0089] Following the Coomassie Brilliant Blue staining method for proteins, proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% polyacrylamide gel. 100 mL of 10× electrophoresis buffer was diluted with 900 mL of ultrapure water to prepare 1× electrophoresis buffer, and mixed thoroughly. The gel plate was removed, and the comb was pulled out vertically upwards. Electrophoresis buffer was drawn up with a 1 mL syringe to flush the comb wells and remove any remaining unpolymerized gel. The gel plate was then installed in the electrophoresis tank, and 1× electrophoresis buffer was added. The initial voltage was set to 80 V, and electrophoresis was performed for approximately 30 minutes. 20 μg of protein samples were loaded. After the samples entered the separating gel, the voltage was adjusted to 120 V, and electrophoresis continued for 60 minutes until the bromophenol blue indicator was close to the bottom of the gel plate. After electrophoresis, the gel was stained using a Coomassie Brilliant Blue staining kit (Beyotime, P0017A). The gel was immersed in the staining solution and stained with gentle shaking at room temperature for 4 hours. The gel was then transferred to destaining solution and incubated for approximately 6 hours, with the destaining solution being changed every 2 hours to ensure clear background removal. The total protein distribution of live MB49 cells and LNT cells was then compared and analyzed.

[0090] The results showed that the overall protein distribution of LNT cells and live MB49 cells was basically the same, with only slight changes in the content of a few proteins, indicating that liquid nitrogen freeze-thaw treatment did not significantly disrupt the protein composition of the cells. Figure 8 This result confirms that LNT cells maintain a high level of protein integrity, providing important experimental evidence for their use as a tumor vaccine.

[0091] (2) Western blot verification of recombinant green fluorescent protein (GFP) expression level

[0092] Taking MB49 cells recombinantly expressing green fluorescent protein (GFP) (i.e., MB49-LUC-GFP cells) as an example, the expression level of GFP on the surface of LNT cells and live cells was detected by Western Blot (WB). In short, the procedure included the following steps: protein denaturation (heating the sample and loading buffer), preparation and pouring of separating and stacking gels (mixing the gels, adding APS, and allowing them to solidify), sample loading (adding the denatured sample and marker), electrophoresis (starting at 80V, continuing at 120V until bromophenol blue is near the bottom), membrane transfer (assembling the transfer clamp, transferring at a constant current of 300mA for 60-70 minutes), blocking (blocking with 5% skim milk powder for 2 hours), incubation with primary antibody (overnight at 4°C), washing with TBST, incubation with secondary antibody (at room temperature for 1 hour), washing with TBST again, and finally development (using ECL reagent for chemiluminescence imaging).

[0093] The results showed that after liquid nitrogen freeze-thaw treatment, the GFP level on the cell membrane did not decrease significantly, and even increased slightly. Figure 9 This finding further supports the idea that liquid nitrogen treatment can effectively preserve key antigenic components on cell membranes, thereby ensuring the immunogenicity and functionality of tumor vaccines.

[0094] (3) Proteomics analysis of live MB49 cells and LNT cells

[0095] To comprehensively elucidate the differences in protein expression between liquid nitrogen-treated (LNT) cells and untreated cells, proteomic analysis was performed on live MB49 cells and LNT cells. Three independent samples were prepared for each cell line to ensure the reliability and reproducibility of the experimental results. The above proteomic analysis was performed by Shanghai Baipu Biotechnology Co., Ltd.

[0096] The results showed that among the 7157 proteins detected, only 175 were upregulated and 94 were downregulated, indicating significant differences in protein level changes. Furthermore, the upregulated proteins were mainly membrane proteins and mitochondrial membrane proteins, while the downregulated proteins were primarily ribosome and ribonucleoprotein components. Figure 10 This result indicates that liquid nitrogen freezing can maximize the preservation and even increase the number of cell surface proteins, especially membrane proteins associated with tumor-specific antigens.

[0097] In summary, LNT cells treated with liquid nitrogen freeze-thaw can maintain the integrity of their cell membrane structure without losing key proteins or surface antigens, and completely lose their pathogenicity and proliferative capacity. These characteristics make LNT cells a safe and highly immunogenic candidate material for tumor vaccines.

[0098] Example 3: Preparation of BCG-CW@LNT vaccine against bladder cancer

[0099] 1. Prepare BCG-CW@LNT vaccine and verify the adhesion effect of BCG-CW to LNT cells.

[0100] Live MB49 cells and corresponding LNT cells from Example 2 were labeled with DAPI staining, and BCG-CW cells prepared in Example 1 were labeled with CY3 dye. 1 × 10⁵ LNT cells were mixed with 1.5 × 10⁶ ng of BCG-CW cell wall (LNT cell to BCG-CW mass ratio of 1:15, unit: cells / ng), and incubated at room temperature and 100 rpm for 30 min to prepare the BCG-CW@LNT anti-bladder cancer vaccine. Under a fluorescence microscope, it was clearly observed that BCG-CW successfully adhered to the surface of LNT cells and live MB49 cells. Figure 11 ).

[0101] 2. High-resolution imaging analysis of BCG-CW on the surface of LNT cells

[0102] To further visualize the uniform distribution of BCG-CW on the surface of LNT cells, high-resolution imaging analysis was performed using scanning electron microscopy (SEM) on BCG-CW@LNT vaccines prepared by mixing LNT cells and BCG-CW in different ratios. Specifically, the BCG-CW component was first sonicated at 80 kHz for 20 min to ensure its full dispersion. Subsequently, the two were mixed according to different ratios of LNT cell quantity to BCG-CW mass (1:5, 1:10, 1:15, 1:30), and mixed on a shaker at room temperature for 30 min to ensure uniform distribution and firm adhesion of BCG-CW to the LNT cell surface.

[0103] SEM observations showed that BCG-CW formed a uniform coating on the surface of LNT cells, and the adhesion effect increased with increasing proportion. Figure 12 ).

[0104] Example 4: Verification of whether the BCG-CW@LNT vaccine against bladder cancer can activate immunity.

[0105] 1. In vitro validation

[0106] (1) Activation status of BCG-CW@LNT on BMDC

[0107] Bone marrow-derived dendritic cells (BMDCs) were isolated from 4–6 week old C57BL / 6 mice and differentiated in vitro using 20 ng / mL GM-CSF and 5 ng / mL IL-4. Immature BMDCs were co-cultured with BCG, BCG-CW, LNT, or BCG-CW@LNT for 24 hours at 37°C under 5% CO2 conditions. After co-culture, cells were harvested, stained with antibodies against CD80, CD86, and MHC-II fluorescent dyes, and analyzed by flow cytometry (BD Biosciences, USA).

[0108] Figure 13 This study demonstrates the stimulatory effect of BCG-CW on dendritic cells (BMDCs) in vitro. Flow cytometry analysis showed that BCG-CW and BCG-CW@LNT, like intact BCG, effectively enhanced the antigen-presenting capacity of dendritic cells, as evidenced by the upregulation of CD80 and CD86 co-stimulatory molecules. Figure 13 (A) In addition, the expression of MHC-II molecules on the surface of professional dendritic cells is upregulated. The upregulation of MHC-II molecules indicates that BCG-CW can enhance the ability of BMDCs to capture and present exogenous antigens, thereby more effectively activating T cell-mediated immune responses. Figure 13 (B in the text). These results indicate that BCG-CW can effectively promote the maturation of BMDCs, thereby enhancing their antigen-presenting capacity.

[0109] The levels of IL-6, IL-12, and TNF-α in BCG-CW and the BCG-CW@LNT co-incubation system with BMDCs were detected using an ELISA kit. The results showed that the levels of IL-6, IL-12, and TNF-α were significantly increased. Figure 14 The expression of IL6, IL-12, and TNF-α in BCG-CW and BCG-CW-encapsulated BCG-CW@LNT co-incubated with BMDCs was detected by qRT-PCR. Upregulation of IL6, IL-12, and TNF-α was found, suggesting a significant pro-inflammatory immune environment. Figure 15 ).

[0110] The primer sequences used for qRT-PCR detection are shown in Table 1 below.

[0111] Table 1 Primer sequences used for qRT-PCR detection

[0112] Gene name forward primer reverse primer IL6 CCTATGCCTCCCTGTGCT TGGTCGCCCTCGTAGTAGA IL12 CCAAAGGGATGACATAGTGAA GGTGAGGAAATGGCAGAGTT TNF-α TCTGAGTGGGACTGGCTGTTGG AGAGACCTCCCTTGTTGAGAAG IFN-γ TGCAGGTCATTCAGATGT AGC TGGCTCTTTCCTGTTTTA GCTG Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA

[0113] (2) Activation of cytotoxic T cells by BCG-CW@LNT-OVA

[0114] Dendritic cells (DCs), as key antigen-presenting cells (APCs), present processed antigenic peptides to the cell surface via the MHC-I / antigen peptide complex. This process activates CD8+. + T cells play a crucial role in inducing specific immune responses. To investigate whether BCG-CW can further enhance the specific T cell killing effect against tumor antigens, the effects of BCG-CW@LNT on dendritic cell maturation, antigen-presenting capacity, and T cell activation in vitro were studied using an MB49-OVA cell model expressing the antigen ovalbumin (OVA). The specific procedures are as follows:

[0115] First, BMDC cells were co-incubated with MB49-OVA cells, LNT-OVA cells (MB49-OVA cells frozen in liquid nitrogen), and BCG-CW@LNT-OVA cells (MB49-OVA cells wrapped in BCG-CW) for 24 h. Then, the stimulated BMDC cells were co-incubated with OT1 mouse spleen T cells at a cell ratio of 1:10 for 12 h. Subsequently, cytotoxic T cells (CD8+) were assessed by flow cytometry. + The analysis included the activation of T cells and antigen-specific responses. The analysis also included total CD8+. + T cells (CD3) + CD8 + Antigen-specific CD8 + T cells (Tetramer) + CD8 + The expression of CD137 and CD69 was used to assess the activation status of T cells, which represent early and sustained T cell activation, respectively.

[0116] Flow cytometry analysis results showed ( Figure 16 In study A), both MB49-OVA cells and liquid nitrogen-frozen MB49-OVA cells (LNT-OVA), after being processed and presented with antigens by bone marrow-derived dendritic cells (BMDCs), significantly activated spleen-derived T cells and promoted CD8 activation. + T cell proliferation. From Figure 16 The B-stream cytometry results show that the BCG-CW@LNT-OVA treatment group has an effect on CD8. + The highest activation efficiency of T cells indicates that BCG-CW modification significantly promotes the maturation and antigen presentation capacity of BMDCs, thereby enhancing T cell activation and proliferation.

[0117] Flow cytometry analysis of specific T cell levels showed that antigen-specific T cells (CD3+) were significantly higher in the BCG-CW@LNT-OVA treatment group. + CD8 + The proportion of SIINFEKL tetramer-positive cells in T cells was significantly higher than in other groups. Figure 16 The results (C and D in the original text) indicate that BCG-CW@LNT-OVA effectively promoted the induction and expansion of antigen-specific T cells by enhancing the presentation efficiency of LNT cell surface antigens by DC cells. Simultaneously, CD137 (… Figure 16 E) and CD69 ( Figure 16 The expression levels of two T cell activation markers (F and F) were significantly increased, further confirming the activation state of specific T cells. Furthermore, the expression levels of TNF-α and IFN-γ were also significantly upregulated in the BCG-CW@LNT-OVA treatment group, suggesting that they may exert anti-tumor immune effects by enhancing the function of cytotoxic T cells, providing an important theoretical basis for subsequent anti-tumor therapy.

[0118] 2. In vivo verification

[0119] (1) Dynamic distribution of BCG-CW@LNT in vivo

[0120] To investigate the dynamic distribution of BCG-CW@LNT in vivo, BCG-CW@LNT labeled with Cyanine 3 (Cy3) was injected intravenously into tumor-bearing C57BL / 6 mice (5 × 10^5 MB49 cells subcutaneously) at a dose of 100 μL per mouse. Mice were euthanized at predetermined time points (days 1, 3, 5, and 7 post-injection), and major organs, tumors, and tumor-draining lymph nodes were harvested. The biodistribution of BCG-CW@LNT in major organs (heart, liver, spleen, lungs, and kidneys) and tumor-related tissues (tumor and tumor-draining lymph nodes) was monitored using a small animal imaging system (Bruker, Germany). Simultaneously, the fluorescence intensity of each tissue was measured in vitro using the same imaging system, and the data were quantitatively analyzed to assess the distribution and retention of BCG-CW@LNT in different tissues.

[0121] The results are as follows Figure 17 As shown, BCG-CW@LNT initially accumulates in the lungs, liver, and spleen, then gradually metastasizes to the liver and is metabolized and cleared, while clearance of BCG-CW@LNT from the spleen is relatively slow. On day 5 post-injection, accumulation of BCG-CW@LNT was observed in the tumor and tumor-draining lymph nodes.

[0122] (2) Assessment of the immunogenicity of BCG-CW@LNT in vivo

[0123] To assess the in vivo immunogenicity of BCG-CW@LNT, C57BL / 6 mice were subcutaneously inoculated with 5 × 10^5 MB49 cells. The immunogenicity was assessed when the tumor volume reached 200–300 mm². 3 Subsequently, PBS, BCG-CW, LNT, or BCG-CW@LNT were injected via tail vein. On day 7 post-injection, tumors and adjacent lymph nodes were collected, and single-cell suspensions were prepared for flow cytometry analysis.

[0124] The results showed that CD8+ in the tumors of mice injected with BCG-CW@LNT increased. + The number of T cells was significantly increased, and cytotoxic T cells with proliferative and killing capabilities (characterized by Ki67 and granzyme B levels) were most upregulated in the BCG-CW@LNT group. Figure 18 Furthermore, the BCG-CW monotherapy group also showed significant T cell activation, further demonstrating its ability to activate the immune system in vivo.

[0125] To investigate the mechanism of T cell activation, the distribution of dendritic cells (DCs) and macrophages in tumors was examined. Flow cytometry staining for DC maturation markers (CD80 and CD86) showed that mature DCs were significantly enriched in the tumors of mice treated with BCG-CW alone and BCG-CW@LNT, with a higher proportion of mature DCs in the BCG-CW@LNT group. Figure 19 Simultaneously, the number of macrophages in the tumor also increased significantly, especially M1 macrophages, while the proportion of M2 macrophages decreased significantly. Figure 20 This indicates that BCG-CW@LNT injection remodels the tumor microenvironment, not only mediating T cell activation through DC maturation but also indirectly activating the pro-inflammatory immune response of tumor macrophages, further enhancing the anti-tumor effect.

[0126] Furthermore, by isolating the peritumoral lymph nodes of mice, cytotoxic CD8 was found in the lymph nodes of mice in each treatment group. + The number of T cells increased in all groups, especially in the BCG-CW alone treatment group and the BCG-CW@LNT treatment group. T cells in the lymph nodes were significantly activated, as evidenced by a significant upregulation of CD69 and CD25 markers. Figure 21 Mature dendritic cells (DCs) were significantly enriched in tumors of mice in both the BCG-CW-treated group and the BCG-CW@LNT-treated group, with a higher proportion of mature DCs in the BCG-CW@LNT group. Figure 22 ).

[0127] Example 5: Efficacy of BCG-CW@LNT vaccine as a therapeutic anti-tumor vaccine in bladder cancer

[0128] 1. Efficacy of BCG-CW@LNT vaccine in a mouse subcutaneous bladder cancer model

[0129] A mouse subcutaneous bladder cancer model was constructed using the MB49 cell line. Five × 10⁵ MB49 cells were resuspended in 100 μL of PBS and injected subcutaneously into the right back of mice. After uniform tumor formation, mice were randomly divided into groups: PBS as the negative control, BCG-CW treatment group, LNT treatment group, BCG-CW@LNT treatment group, and cisplatin (a commonly used chemotherapy drug) as the positive control. From the onset of tumor formation, mice were treated twice weekly at a dose of 100 μL per mouse for two weeks via tail vein injection of PBS, BCG-CW, LNT, BCG-CW@LNT, or cisplatin, respectively. Tumor diameter and body weight changes were recorded every two days, and tumor volume was calculated based on tumor diameter (formula: V = length × width). 2 ×0.52). Mice were sacrificed 3 days after the last administration, and the overall efficacy of tumor treatment was evaluated.

[0130] The tumor volume growth curve calculated based on mouse tumor diameter shows ( Figure 23 In the A group, the tumor size in mice treated with LNT alone was not significantly different from that in the control group (PBS), indicating that LNT alone, which provides tumor antigens, does not exert a significant anti-tumor effect. The BCG-CW alone treatment group showed a moderate inhibitory effect on tumor growth, which may be due to the systemic immune activation induced by BCG-CW. In contrast, both the BCG-CW@LNT treatment group and the positive control drug cisplatin group significantly inhibited tumor growth, with the BCG-CW@LNT group showing the slowest tumor growth. Figure 23 (B and C in the original text). It is noteworthy that, due to the toxic side effects of cisplatin, the body weight of mice in this treatment group was significantly reduced (…). Figure 23 (D in the middle).

[0131] 2. Efficacy of BCG-CW@LNT vaccine in a mouse orthotopic bladder tumor model

[0132] To better simulate the pathogenesis and progression of bladder cancer, a mouse orthotopic bladder tumor model was constructed to systematically evaluate the antitumor efficacy of BCG-CW@LNT. The specific experimental design was as follows: 5 × 10^5 fluorescently labeled MB49-LUC-GFP bladder cancer cells were resuspended in 100 μL of PBS via orthotopic bladder instillation to establish orthotopic tumors in mice. Tumor growth and progression were monitored non-invasively and periodically using a small animal in vivo fluorescence imaging system (IVIS Spectrum, PerkinElmer, USA). Once the tumors had homogeneously colonized, mice were randomly divided into five groups on day 7 after successful orthotopic tumor colonization. These groups received treatment via tail vein injection of PBS (negative control), BCG-CW, LNT, and BCG-CW@LNT, respectively. A bladder instillation BCG treatment group served as a positive control. During treatment, tumor growth was monitored periodically using in vivo imaging, and changes in mouse weight and survival were recorded.

[0133] like Figure 24 As shown in Figure A, the bladder instillation BCG group exhibited a significant antitumor effect, consistent with the clinical efficacy of BCG instillation in the treatment of non-muscle-invasive bladder cancer (NMIBC). Notably, the BCG-CW@LNT treatment group also demonstrated excellent antitumor effects in the orthotopic bladder cancer model, with a tumor growth inhibition rate comparable to the BCG instillation group, and even superior in some indicators (such as weight change and survival). Figure 24 B in the graph represents the growth trend of mouse orthotopic bladder tumors plotted based on fluorescence intensity values. Figure 24 C in the figure represents the survival curve of mice in each group. Figure 24 D in the figure represents the fluorescence intensity statistics of each group. After treatment, bladder tissue from mice in each group was collected for pathological analysis. HE staining results showed ( Figure 24In the PBS control group (E), the bladder tissue of mice exhibited typical tumor pathological features, including extensive tumor cell infiltration, disordered tissue structure, significant nuclear atypia (increased nuclear-cytoplasmic ratio, deep nuclear staining), and pathological mitotic figures. Furthermore, the bladder wall layer structure was disrupted, the boundary between the mucosa and muscle layer was indistinct, and necrotic areas were visible in some areas. The BCG-CW monotherapy group showed weaker tumor suppression, with moderate tumor cell infiltration still observed in the bladder tissue, disordered local tissue structure, and an inflammatory cell infiltration level between the BCG-CW@LNT group and the BCG infusion group. The LNT monotherapy group showed the weakest tumor suppression, with more tumor cell infiltration in the bladder tissue, and significant nuclear atypia and pathological mitotic figures in some areas. In the BCG infusion group, although tumor cell infiltration was significantly reduced compared to the PBS control group, a greater amount of inflammatory cell infiltration (mainly neutrophils and macrophages) and local fibrosis were observed in the bladder tissue, suggesting that BCG infusion may induce a strong local inflammatory response and tissue damage. In addition, mucosal epithelial sloughing and edema were observed in some areas. In contrast, the bladder histopathology improvement was most significant in the BCG-CW@LNT treatment group. Tumor cell infiltration was significantly reduced, the bladder wall layer structure was basically restored to normal, the mucosal epithelial cells were neatly arranged, and only a small number of inflammatory cells (mainly lymphocytes and monocytes) were infiltrated. No obvious fibrosis or necrosis areas were observed, suggesting that BCG-CW@LNT inhibits tumor growth while causing minimal damage to normal tissues. HE staining results further confirmed the significant antitumor effect of BCG-CW@LNT in the orthotopic bladder cancer model. Compared with BCG instillation, BCG-CW@LNT not only effectively inhibits tumor growth but also reduces tissue damage and inflammatory response, demonstrating better treatment safety and tissue protection.

[0134] 3. Efficacy of BCG-CW@LNT vaccine in a mouse model of bladder cancer lung metastasis

[0135] Lung metastasis is one of the most aggressive characteristics of bladder cancer. Once lung metastasis occurs, the patient's prognosis deteriorates significantly, and the survival rate decreases dramatically. Lung metastasis is a major cause of death in bladder cancer patients. Therefore, researching effective treatment strategies to control the occurrence and progression of lung metastasis is crucial for improving the prognosis of bladder cancer patients.

[0136] To more comprehensively evaluate the antitumor therapeutic effect of BCG-CW@LNT, a mouse model of bladder cancer lung metastasis was established by tail vein injection of 1×10^5 MB49 cells. After homogeneous tumor formation, the mice were randomly assigned to groups using a small animal in vivo fluorescence imaging system. Treatment included tail vein injection of LNT, BCG-CW, or BCG-CW@LNT, with a negative control group receiving tail vein injection of PBS and a positive control group receiving tail vein injection of cisplatin. Treatment was administered twice weekly for two weeks.

[0137] Treatment efficacy was assessed using in vivo fluorescence imaging and pathological analysis of lung tissue. In vivo fluorescence imaging showed that BCG-CW@LNT treatment significantly reduced tumor-related fluorescence signals compared to other groups. Pathological analysis of lung tissue using HE staining further confirmed the reduced tumor burden in the BCG-CW@LNT group; compared to the PBS, LNT, and BCG-CW groups, fewer and smaller metastatic nodules were observed. Figure 25 A). Quantitative analysis of fluorescence intensity (in p / sec / cm). 2 / sr indicates that, compared with the PBS (p<0.001), LNT (p<0.01), and BCG-CW (p<0.05) groups, BCG-CW@LNT treatment resulted in a significant decrease in tumor-related fluorescence signal. Figure 25 (B in the text). The fluorescence intensity of the BCG-CW@LNT group was lower than that of the cisplatin group, indicating that it has a good anti-tumor effect. Survival analysis showed that mice treated with BCG-CW@LNT had the longest median survival time, significantly longer than mice treated with PBS, LNT, and BCG-CW. Figure 25 (C in the text). This indicates that BCG-CW@LNT can effectively prolong the survival of mice with lung metastases from bladder cancer.

[0138] Example 6: Efficacy of BCG-CW@LNT as a therapeutic anti-tumor vaccine in lung cancer

[0139] A mouse subcutaneous tumor model was constructed using the Lewis lung cancer cell line (LLC). Five × 10⁵ LLC cells were resuspended in 100 μL of PBS and injected subcutaneously into the right back of mice. After homogeneous tumor formation, mice were randomly divided into four groups: PBS group (negative control), cisplatin group (positive control), LNT monotherapy group, BCG-CW monotherapy group, and BCG-CW@LNT group. The corresponding drugs were administered twice weekly via tail vein at a dose of 100 μL per mouse for 4 weeks. Tumor volume was measured every 2 days during treatment (calculated using the formula: V = length × width² × 0.5²). Note: In this embodiment, LNT refers to LLC cells cryopreserved in liquid nitrogen, and BCG-CW@LNT refers to BCG-CW-encapsulated LLC cells cryopreserved in liquid nitrogen. The treatment process was similar to that of bladder cancer MB49 cells.

[0140] Tumor volume growth curve shows ( Figure 26In the PBS group (A), tumors grew rapidly, while the LNT monotherapy group showed limited inhibitory effect on tumor growth, indicating that LNT relying solely on tumor antigens cannot significantly inhibit lung cancer progression. In contrast, the BCG-CW@LNT treatment group showed a significant tumor growth inhibition effect, with efficacy comparable to the cisplatin group, and even superior to the cisplatin group at certain time points. Figure 26 (B in the text). Furthermore, the body weight of mice in the BCG-CW@LNT treatment group remained stable with no obvious toxic reactions, while the body weight of mice in the cisplatin group decreased significantly, suggesting that it may have some systemic toxicity. Figure 26 (D in the middle).

[0141] In summary, BCG-CW@LNT demonstrated significant therapeutic effects in three bladder cancer models, significantly inhibiting tumor growth and prolonging the survival of mice. Based on its excellent performance in bladder cancer models, we further explored whether BCG-CW@LNT has the potential for pan-cancer therapy. In a subcutaneous lung cancer tumor model, BCG-CW@LNT also showed significant anti-tumor effects, indicating that its immune activation mechanism may be broad-spectrum and applicable to multiple tumor types, suggesting that the BCG-CW@LNT vaccine can serve as a novel anti-tumor therapeutic vaccine.

[0142] Example 7: Evaluation of the tumor prevention efficacy and safety of BCG-CW@LNT

[0143] 1. Evaluation of tumor prevention efficacy

[0144] Mice were immunized weekly via intravenous injection of PBS, LNT, BCG-CW, and BCG-CW@LNT two weeks prior to tumor inoculation (days -14 and -7). On day 0, mice were subcutaneously injected with 5 × 10^5 MB49 tumor cells to establish a tumor model. Figure 27 (A) Tumor growth was then monitored, and tumor volume was measured periodically. Control groups included mice treated with PBS alone, LNT alone, and BCG-CW alone.

[0145] The results showed that mice pre-immunized with BCG-CW@LNT were largely resistant to tumor formation, and no detectable tumor growth was observed in most mice throughout the experiment. Figure 27 (B to C in the text). In contrast, the groups treated with PBS and those treated with LNT only showed rapid tumor growth, indicating that pre-immunization with BCG-CW@LNT effectively prevented tumor establishment.

[0146] 2. Safety evaluation

[0147] Safety is a crucial indicator for evaluating whether a novel anti-tumor vaccine can be translated into clinical trials. Therefore, the acute and long-term toxicity of BCG-CW@LNT was comprehensively assessed by examining complete blood counts, blood biochemical parameters, spleen pathological changes, and pathological analysis of major tissues and organs in mice.

[0148] In the acute toxicity experiment, mice were given a single intravenous injection of BCG-CW@LNT, and blood samples were collected 24 hours later for complete blood count and blood biochemistry analysis. In the long-term toxicity experiment, mice were given intravenous injections of BCG-CW@LNT twice a week for four consecutive weeks, and blood samples were collected on day 21 for testing.

[0149] Blood routine results showed that, regardless of whether it was a single injection or long-term injection of BCG-CW@LNT, no significant abnormalities were observed in the key blood cell indicators (including white blood cells, red blood cells, neutrophils, peripheral blood mononuclear cells, and platelets) in the mice. Figure 28 (A) Blood biochemistry analysis showed that there were no significant differences in liver and kidney function indicators (including alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, total bilirubin, BUN, and CREA) between the BCG-CW@LNT treatment group and the PBS group. Figure 28 The result (B in the original text) indicates that the vaccine had no significant effect on liver and kidney function. The spleen is an important organ of the immune system, and its size changes can reflect the degree of systemic inflammatory response. Experimental results showed that the spleen size of mice in the BCG-CW@LNT treatment group was not significantly different from that in the PBS group. Figure 28 (C in the text). HE staining results showed that no significant pathological changes were observed in the major organs (heart, liver, spleen, lungs, and kidneys) of the BCG-CW@LNT treatment group mice. Figure 28 (D in the original text). The above results demonstrate that the BCG-CW@LNT prepared in this invention exhibits good safety.

[0150] This invention provides an anti-tumor vaccine, its preparation method, and its application. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. A method for preparing an anti-tumor vaccine, characterized in that, Includes the following steps: (1) Collect the BCG bacteria by centrifugation, wash and resuspend them, then heat-inactivate them, and then use sonication to obtain a homogenate. After heat treatment of the homogenate, collect the precipitate by centrifugation. The precipitate is then defatted and deproteinized to prepare the BCG cell wall BCG-CW. (2) Collect tumor cells by centrifugation and resuspend them in cryopreservation solution. After the cryopreservation solution containing tumor cells is frozen in liquid nitrogen, LNT cells are obtained. (3) The BCG-CW cell wall obtained in step (1) and the LNT cells obtained in step (2) are mixed by shaking to prepare the anti-tumor vaccine BCG-CW@LNT; In step (1), the BCG bacteria are BCG bacteria in the logarithmic growth phase obtained through pre-culture; the heat inactivation conditions are: heating at 100~125℃ for 10~20 min. In step (1), the ultrasonic treatment is performed under the following conditions: 50~100 kHz for 10~20 min; the heat treatment is performed under the following conditions: 60~100℃ metal bath for 100~200 min. In step (1), the defatting and deproteinization process involves washing with 2% Triton X-100 and then washing with 2% sodium dodecyl sulfate. In step (2), the tumor cells are mouse-derived bladder cancer cell lines or mouse-derived non-small cell lung cancer cell lines; wherein the mouse-derived bladder cancer cell lines include any one of MB49 cell lines, MB49-LUC-GFP cell lines, and MB49-OVA cell lines, and the mouse-derived non-small cell lung cancer cell lines are LLC cell lines; In step (2), the liquid nitrogen cryopreservation process is performed 1 to 3 times. Specifically, the cryopreservation solution containing tumor cells is soaked in liquid nitrogen for 10 to 16 hours and then placed on ice to thaw for 60 to 180 minutes. In step (3), the mixing ratio of the number of LNT cells to the mass of BCG-CW cell wall is 1:5~30 ng.

2. The preparation method according to claim 1, characterized in that, In step (2), the density of tumor cells in the cryopreservation solution containing tumor cells is 5~10 M / mL.

3. The antitumor vaccine prepared by the preparation method according to any one of claims 1 to 2, characterized in that, The anti-tumor vaccine includes BCG-CW cell walls and LNT cells that have been cryopreserved in liquid nitrogen. The BCG-CW cell wall of BCG uses LNT cells as a carrier and adheres to the surface of LNT cells.

4. The use of the antitumor vaccine according to claim 3 in the preparation of an agent for the prevention and / or treatment of tumor diseases, characterized in that, The tumors mentioned are bladder cancer and lung cancer.