Polypeptide compound, polypeptide cyclization method mediated by polypeptide ligase and application of polypeptide compound
By using subtilisin-engineered polypeptide ligase and Omniligase-1 catalyzed enzyme chainization reaction, the problem of insufficient phage infectivity and substrate type compatibility in the prior art was solved, and the effect of efficiently building a diverse circular peptide library and improving targeting efficiency was achieved.
Patent Information
- Application Number
- CN202510310977.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-06-06
AI Technical Summary
Existing chemical crosslinked phage strategies have defects in phage invasiveness and substrate type compatibility, limiting the diversity and targeting efficiency of cyclic peptide libraries.
The polypeptide ligase generated by the transformation of subtilisin is used to construct the cyclic peptide backbone through sulfide bonding from side chains, and combined with the enzyme chain reaction catalyzed by Omniligase-1 to generate cyclic peptide molecules with extensive substrate compatibility.
The cyclization modification of phage display peptides is achieved efficiently constructing phage display peptides under mild reaction conditions, expanding the diversity of the cyclic peptide library and improving the screening efficiency of cyclic peptide ligands targeting disease-related proteins.
Smart Images

Figure CN120098076A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of chemical enzymatic cyclization modification of gene-encoded peptide libraries, and in particular to polypeptide compounds and polypeptide cyclization methods and applications thereof mediated by polypeptide ligase. Background Art
[0002] Cyclic peptides are an extremely important framework in the development of peptide drugs. Approved peptide drugs including desmopressin and cyclosporin are all cyclic peptides. Due to the rigidity of the structure, cyclic peptide molecules can resist degradation by proteolytic enzymes, have high specific affinity for target proteins, and target intracellular target proteins partly due to cell membrane permeability. Rapid discovery of highly active cyclic peptide active molecules is the core content of this field. Discovering active cyclic peptide molecules from animals and plants is the most direct method to discover cyclic peptide drug leads. However, the components in the body are complex, and identifying endogenous cyclic peptide active molecules is a time-consuming and laborious project. In addition, most endogenous cyclic peptides are cyclic peptide frameworks composed of disulfide bonds, which cannot tolerate glutathione reducing conditions and are prone to internal rearrangement of disulfide bonds. Therefore, constructing a structurally stable cyclic peptide molecule library in vitro is an important core technology in the field of cyclic peptide drug discovery.
[0003] Genetically encoded cyclic peptide technology is a powerful means to reconstruct cyclic peptide library in vitro. In particular, Winter and Heinis et al. established the bicyclic peptide technology in 2009 by using tribromomethylbenzene to cross-link three Cys residues of phage epitopes (see Nat Chem Biol 2009, 5, 502-507), which pushed the discovery of stable cyclic peptide drugs to a new level. The core idea of this technology is to use chemical cross-linking reagents to achieve the cyclic structure transformation of phage epitope linear peptides. Based on similar pathways, multiple research groups have developed different chemical cross-linking reagents to construct phage cyclic peptides. For example, Derda et al. combined chemical cross-linking reagents with Knorr pyrazole synthesis reactions to display non-natural pharmacophores in phage cyclic peptides (see JAmChem Soc 2021, 143, 5497-5507); Wu and Bernardes used the bioorthogonal reaction of N-terminal Cys to construct a special single-cyclic peptide phage library (JAm Chem Soc 2020, 142, 5097-5103; Nat Commun 2024, 15, 7308). Nevertheless, these methods based on chemical cross-linking reagents require the use of highly active electrophilic reagents, have the defect of reacting with the internal Cys of pIII of phage, and affect the infectivity of phage.
[0004] In order to solve the defects of the chemical cross-linking phage strategy, we proposed a technology based on chemoenzymatic method to construct phage-displayed cyclic peptides in 2024 (Chem Sci 2024, 15, 9649-9656; Org Lett 2024, 26, 2601-2605). Unlike the chemical cross-linking method, the chemoenzymatic method uses low-activity electrophilic reagents and does not affect the infectivity of the phage. The reaction conditions of the chemoenzymatic modification of phages are mild, and high-efficiency cyclization modification of phages can be achieved at low concentrations of substrates, generating a large-scale cyclic peptide molecule library to screen cyclic peptide ligands targeting specific target proteins. In 2024, we used SortaseA enzyme and asparaginyl endopeptidase (OaAEP1) to successfully establish a chemoenzymatic phage cyclic peptide display platform. However, these two ligases have an obvious disadvantage in practical application: SortaseA requires the N-terminal amino acid of the phage display peptide to be glycine (patent application number: 202410093169.X); asparagine endopeptidase requires the N-terminal amino acid of the phage display peptide to be glycine-leucine (patent application number: 202410092951.X). These restrictions make several sites in the ring of the cyclic peptide library specific amino acids, which is not conducive to the diversity of the library.
[0005] Subtilisin is a serine protease secreted by Bacillus subtilis, belonging to a proteolytic enzyme of the C13 peptidase family. Through directed evolution and amino acid mutation, people have successfully transformed subtilisin into a peptide ligase tool, and its representative ligases include Subtiligase, Peptiligase and Omniligase-1 (PNAS2009, 96, 9497-9502; Adv Synth Catal 2016, 358, 4041-4048; Nat Methods2016, 13, 925-927; Nat Chem Biol 2018, 14, 50-57). Omniligase-1 is a ligase with broad substrate selectivity, with many types of ligation sites, and the N-terminal amino acid residue of the substrate nucleophilic peptide is no longer limited to Gly or Gly-Leu. The peptide ligation reaction catalyzed by Omniligase-1 is efficient, the reaction conditions are mild, and the effect on the infectivity of phage will be small. Omniligase-1 has been widely used in peptide ligation, but has not yet been used to construct a library of genetically encoded cyclic peptides. By deeply exploring the peptide ligation reaction of Omniligase-1, developing a new system for peptide cyclization mediated by subtilisin, and using it to cyclize and modify phage surface-displayed peptide libraries, a more powerful chemoenzymatic genetically encoded macrocyclic peptide screening platform will be established. Summary of the invention
[0006] In view of the shortcomings of the prior art, the present invention provides a polypeptide ligase-mediated polypeptide cyclization method with mild reaction conditions, high-efficiency enzyme concatenation and broad substrate compatibility, constructs a cyclic peptide backbone with side chain to side chain thioether bonds, realizes efficient chemical enzymatic cyclization modification of phage-displayed polypeptides, and successfully screens cyclic peptide ligands targeting disease-related proteins.
[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions:
[0008] A polypeptide compound, wherein the polypeptide compound is a polypeptide compound recognized by a polypeptide ligase containing an electrophilic reactive group, and the compound has the following general structural formula:
[0009]
[0010] Where, X a X is any one of hydrogen, acetyl, and an oligopeptide group consisting of natural or unnatural amino acids except cysteine; b Any one of an electrophilic group and an oligopeptide group composed of natural or non-natural amino acids containing an electrophilic group; X c X is any one of oxygen (oxyester bond) and sulfur (thioester bond); d Any one of the oligopeptide sequences consisting of amino group, natural or unnatural amino acids except cysteine; n is any number between 1 and 8.
[0011] Preferably, the electrophilic group is any one of chloroacetamido, 4-chloroacetamidobenzamido, 3,5-bis[(2-chloroacetyl)amino]benzamido, 3,5-bis(chloromethyl)benzylthio, 2-(chloromethyl)benzylthio, 3-(chloromethyl)benzylthio, 4-(chloromethyl)benzylthio, 4-(chloromethyl)biphenylmethylthio, 2,3,4,5,6-pentafluorophenylthio, and 4-(2',3',4',5',6'-pentafluorophenyl)-2,3,5,6-tetrafluorophenylthio.
[0012] The method of polypeptide cyclization mediated by polypeptide ligase comprises the following steps:
[0013] S1. Using the polypeptide compound according to any one of claims 1 to 2 to carry out polypeptide enzyme ligation reaction and intramolecular polypeptide cyclization reaction with a cysteine-containing polypeptide template in a buffered salt solution in the presence of a polypeptide ligase produced by transformation of subtilisin to produce a cyclic peptide molecule;
[0014] The cysteine-containing polypeptide template is as follows:
[0015] Template a: XB-(X)mC; Template b: XB-(X)mC-(X)nC;
[0016] Wherein, template a is used to construct a monocyclic peptide, template b is used to construct a bicyclic peptide, B represents any one of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine, and L-histidine, X represents any natural L-amino acid, C represents L-cysteine and the position can be changed as required, and m and n represent the number of amino acids between 3 and 20;
[0017] S2. Select the cysteine-containing polypeptide template in S1, express it at the N-terminus of the phage pIII protein through gene encoding fusion, and then construct a phage-displayed cyclic peptide library through S1 step operation, and screen the macrocyclic peptide ligand for the target protein.
[0018] Preferably, the polypeptide ligase produced by the modification of subtilisin is any one of Subtiligase, Peptiligase and Omniligase-1.
[0019] Preferably, in step S1, the concentration range of the polypeptide compound is 0.01 μM to 1.0 mM, and the concentration range of the polypeptide ligase is 0.01 μM to 10.0 mM; the buffered saline solution is any one of PBS, HEPES, NaOAc and Tris, containing 0.0 μM to 10.0 mM TCEP, and the pH range is 7.0 to 10.0.
[0020] Preferably, the time for the peptide enzyme ligation reaction and the intramolecular polypeptide cyclization reaction in step S1 is 1 min-6 h, and the reaction temperature is 0-45°C.
[0021] Preferably, the phage in S2 is a phage system consisting of pCANTAB 5E phagemid and helper phage M13KO7 or M13KE phage system.
[0022] Preferably, the step S2 of screening macrocyclic peptide ligands for the target protein comprises the following steps:
[0023] S2-1, constructing a phage-displayed single-ring peptide or double-ring peptide library using a peptide ligase-mediated peptide cyclization method;
[0024] S2-2, the target protein is biotinylated and fixed on magnetic beads, the phage-displayed single-ring peptide or double-ring peptide library in S2-1 is co-incubated with the immobilized target protein, and after 2 to 6 rounds of bio-panning, the bio-panned phage particles are sequenced;
[0025] S2-3. Synthesize the enriched target cyclic peptides based on the sequencing results, and evaluate the binding affinity and biological activity with the target protein.
[0026] The above-mentioned polypeptide cyclization is applied to the construction of gene-encoded cyclic peptide libraries, including polypeptide connection and intramolecular polypeptide cyclization of phage-displayed, mRNA-displayed, DNA-displayed, yeast-displayed, ribosome-displayed or bacterial-displayed polypeptide libraries to construct monocyclic and bicyclic peptide libraries.
[0027] The cyclic peptide ligand obtained by cyclization of the above polypeptide is applied to the development of drugs, detection kits or other biomedicines and biomaterials.
[0028] The present invention provides a polypeptide compound and a polypeptide cyclization method and application thereof mediated by a polypeptide ligase, which have the following advantages over the prior art:
[0029] (1) Compared with the existing subtilisin-mediated polypeptide ligation method, the present invention realizes for the first time the preparation of side chain-to-side chain cyclic peptides based on the polypeptide ligase produced by the modification of subtilisin, and the present application produces a ligation intermediate through an enzyme ligation reaction, and utilizes the intramolecular polypeptide cyclization reaction of the ligation intermediate to produce the cyclic peptide, wherein the intramolecular polypeptide cyclization reaction is a cyclization reaction between the electrophilic group in the ligation intermediate and the cysteine residue.
[0030] (2) Compared with the existing technology of cyclization modification of phage polypeptides using chemical cross-linking reagents, the present invention adopts mild reaction conditions and does not affect the infectivity of phages.
[0031] (3) Compared with the chemoenzymatic cyclization modification phage technology based on SortaseA and OaAEP1 previously developed by the applicant, the polypeptide ligase produced by the modification of Bacillus subtilisin used in the present invention has a wider range of substrate types and has fewer restrictions on the type of N-terminal amino acid of the phage peptide library.
[0032] (4) Compared with codon expansion or Flexizyme technology, the present invention does not involve codon modification and ribosome embedding of non-natural amino acids, which greatly reduces the difficulty and cost of constructing a cyclic peptide library. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 To carry out the bicyclic peptide cyclization and generate the phage bicyclic peptide library containing 3,5-di[(2-chloroacetyl)amino]benzoyl peptide oxygen ester 11 under the catalysis of Omniligase-1;
[0034] Figure 2 is the structural formula of chloroacetyl-containing polypeptide oxygen ester 10;
[0035] Figure 3It is a 3,5-di[(2-chloroacetyl)amino]benzoyl polypeptide oxygen ester 11 structural formula;
[0036] Figure 4 The chromatographic reaction of peptide connection and cyclization between Omniligase-1 catalyzing 10 and peptide template 1;
[0037] Figure 5 The chromatographic reaction of peptide connection and cyclization between Omniligase-1 catalyzed 11 and peptide template 2 series;
[0038] Figure 6 Chromatography for peptide ligation and cyclization reaction between Omniligase-1 catalyzed 11 and peptide template 3 series;
[0039] Figure 7 Chromatography for peptide ligation and cyclization reaction between Omniligase-1 catalyzed 11 and peptide template 4 series;
[0040] Figure 8 Omniligase-1 catalyzes 11 and peptide templates 5 series to undergo peptide ligation and cyclization reaction chromatography;
[0041] Fig. 9 Omniligase-1 catalyzes 11 and peptide templates 6 series to undergo peptide ligation and cyclization reaction chromatography;
[0042] Fig.10 Chromatography for peptide ligation and cyclization reaction between Omniligase-1 catalyzed 11 and peptide template 7 series;
[0043] Fig.11 Chromatography for peptide ligation and cyclization reaction between Omniligase-1 catalyzed 11 and peptide template 8 series;
[0044] Fig.12 Chromatography for peptide ligation and cyclization reaction between Omniligase-1 catalyzed 11 and peptide template 9 series;
[0045] Fig.13 This is a graph showing the results of the binding test between the functional bicyclic peptide 12 and the target protein TEAD4. DETAILED DESCRIPTION
[0046] In order to explain the present invention more clearly, the following will further illustrate it through implementation cases and drawings.
[0047] (1) Two cysteine-containing polypeptide templates having the following characteristics:
[0048] Template a: XB-(X) m -C
[0049] Template b: XB-(X) m -C-(X) n -C;
[0050] Among them, template a is used to construct a single-ring peptide, template b is used to construct a double-ring peptide, B represents any one of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine, and L-histidine, X represents any natural L-amino acid, C represents L-cysteine and the position can be changed as required, and m and n represent the number of amino acids between 3 and 20.
[0051] According to the above template characteristics, 9 peptide template series were selected as follows: H-FIEWLCK-NH 2 (Peptide template 1, N-terminal is the α-amino group of L-phenylalanine); H-XLHGCRPYCK-NH 2 (polypeptide template 2 series, X = S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G); H-XIHGCRPYCK-NH 2 (3 series of peptide templates, X = S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E); H-XVHGCRPYCK-NH 2 (4 series of polypeptide templates, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, or E);
[0052] H-XMHGCRPYCK-NH 2 (5 series of peptide templates, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G); H-XYHGCRPYCK-NH 2 (6 series of polypeptide templates, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E); H-XWHGCRPYCK-NH 2 (7 series of peptide templates, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L); H-XFHGCRPYCK-NH 2 (8 series of polypeptide templates, X=S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L); H-XHHGCRPYCK-NH 2 (9 series of polypeptide templates, X = Q, A, S, V, I, M, W, or F).
[0053] The polypeptide templates are all composed of L-type amino acids, with the N-terminus being the α-amino group of the X residue and the C-terminus being the amide of lysine. The polypeptides provided here are only used to illustrate the technical details and specific implementation schemes of the present invention, and are not the entire content of this patent. When constructing a cyclic peptide library, the position of the cysteine residues in the template can be changed according to specific needs, and the number of amino acids in the template can be reduced or increased according to needs. The transformed polypeptide templates still fall within the scope of protection of this patent. Therefore, changes and modifications to the polypeptide backbone type made on the basis of this patent are still within the scope of protection of this patent.
[0054] (2) A chemically synthesized polypeptide compound having the following characteristics:
[0055]
[0056] Among them, X a X is any one of hydrogen, acetyl, and an oligopeptide group consisting of natural or unnatural amino acids except cysteine; b is any one of an electrophilic group and an oligopeptide group composed of natural or non-natural amino acids containing an electrophilic group, wherein the electrophilic group is any one of a chloroacetamide group, a 4-chloroacetamide benzamide group, a 3,5-bis[(2-chloroacetyl)amino]benzamide group, a 3,5-bis(chloromethyl)benzylthio group, a 2-(chloromethyl)benzylthio group, a 3-(chloromethyl)benzylthio group, a 4-(chloromethyl)benzylthio group, a 4-(chloromethyl)biphenylmethylthio group, a 2,3,4,5,6-pentafluorophenylthio group, and a 4-(2',3',4',5',6'-pentafluorophenyl)-2,3,5,6-tetrafluorophenylthio group; Xc is any one of oxygen (oxygen ester bond) and sulfur (thioester bond); X c X is any one of oxygen (oxyester bond) and sulfur (thioester bond); d Any one of the oligopeptide sequences consisting of amino group, natural or non-natural amino acids except cysteine; n is any number between 1 and 8; all simple changes and modifications to the polypeptide compound made on the basis of this patent are still within the scope of protection of this patent.
[0057] (3) In the presence of a polypeptide ligase produced by modification of Bacillus subtilisin, the chemically synthesized polypeptide compound and the polypeptide template containing cysteine in the sequence undergo polypeptide ligation and intramolecular polypeptide cyclization in a buffered salt solution to produce a cyclic peptide molecule.
[0058] Wherein, the polypeptide ligase is Subtiligase, Peptiligase or Omniligase-1, the concentration range of the polypeptide compound is 0.01 μM to 1.0 mM, the concentration range of the polypeptide ligase is 0.01 μM to 10.0 mM, the buffered saline solution is any one of the commonly used buffers PBS (phosphate), HEPES (4-hydroxyethylpiperazineethanesulfonic acid), NaOAc (sodium acetate) and Tris (trishydroxymethylaminomethane), the buffered saline solution contains TCEP (tris(2-carboxyethyl)phosphine) in the concentration range of 0.0 μM to 10.0 mM, the pH range of the buffered saline solution is 7.0 to 10.0, the enzyme linkage reaction time is 1 minute to 6 hours, and the reaction temperature is 0 to 45°C. All simple changes to the conditions made on the basis of this patent are still within the scope of protection of this patent. (4) Construction and application of phage display cyclic peptide library:
[0059] Sequence characteristics of bicyclic peptide library displayed on phage surface:
[0060] XBXXXXCXXXXXXCGGSG (from N to C terminus, X is any natural L-amino acid, B represents any one of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine, L-histidine, encoded by NNK method, random amino acid mutations are performed at 11 positions in the sequence, where GGSG is a flexible amino acid linker and is located between the bicyclic peptide library and the pIII protein on the phage surface).
[0061] Two DNA sequences were designed and synthesized based on the characteristics of the polypeptide sequence:
[0062] Primer A: 5'-TT GGTCTCGGTGC GCCGGTGCCGTATCCGGATCCGCTG-3'; Primer B:5'-TTT GGTCT CAGCAC CGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNNANMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3'
[0063] Primer C: 5'-TTT GGTCTCAGCAC CGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNATAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3'
[0064] Primer D: 5'-TTT GGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNCCAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3'
[0065] (Template chain of the library, where N is A / T / C / G, M is C / A, K is G / T, and the underlined base is the BsaI restriction site).
[0066] The above primer A was matched with primer B, primer C or primer D respectively, and the pCANTAB 5E mutant vector (without BsaI restriction site) was used as a template, and a high-fidelity polymerase such as KeyPo enzyme was used for whole plasmid PCR reaction, and then treated with BsaI and DpnI and then ligated with T4 ligase and electroporated into competent TG1 cells. The number of library transformations was 2.0×10 10 , and then packaged into a phage peptide library with the super helper phage M13KO7.
[0067] The phage peptide library was mixed with the polypeptide compound containing 3,5-di[(2-chloroacetyl)amino]benzoyl to generate a bicyclic peptide phage library mediated by Omniligase-1, and then five rounds of screening were performed with the target protein TEAD4. Phage clones were randomly selected for sequencing, bicyclic peptides corresponding to the enriched polypeptide sequences were chemically synthesized, and polarized fluorescence with the target protein was measured to evaluate the effect of the technology.
[0068] (5) The polypeptide templates with different characteristics involved in the present invention can all produce cyclic polypeptides with different characteristics in the intramolecular polypeptide cyclization mediated by Omniligase-1, and can be used to prepare a gene-encoded cyclic peptide library to discover cyclic peptide ligands for target proteins.
[0069] The polypeptide template containing two cysteines displayed on the surface of the phage is XB-(X) as described in step (1). m -C-(X) n -C, and incubated with a peptide compound containing 3,5-di[(2-chloroacetyl)amino]benzoyl, peptide ligation and intramolecular peptide dicyclization occurred under the mediation of Omniligase-1, producing a phage bicyclic peptide library (such as Figure 1 As shown), and bicyclic peptide ligands were screened for specific target proteins.
[0070] XB-(X) m -C-(X) n-C was fused to the N-terminus of phage pill, and then a peptide compound containing 3,5-di[(2-chloroacetyl)amino]benzoyl was cyclized under the mediation of Omniligase-1 to produce a library with a capacity of 2.0×10 10 Bicyclic peptide library. With TEAD4 fixed on streptavidin magnetic beads as the target, after 5 rounds of phage screening and phage clone sequencing, a highly enriched bicyclic peptide was found, and its affinity with TEAD4 was determined to be in the range of 1.5μM by polarized fluorescence, which illustrates the effect of this patented technology in constructing a gene-encoded cyclic peptide library and discovering functional cyclic peptide ligands.
[0071] Embodiment 1:
[0072] According to the above content, chloroacetyl-containing peptide oxygen ester 10 was synthesized:
[0073] Weigh 300.0 μmol of Rinkamide resin (535.0 mg, 0.56 mmol / g), add to a 5.0 mL solid phase synthesizer, add 3.0 mL of DMF and swell at room temperature for 20 minutes. Add 2.0 mL of 20% piperidine and shake at room temperature for 6 minutes. Wash the resin with DMF, add 2.0 mL of DMF amino acid condensation reagent, which contains 4.5 equivalents of Fmoc-Ala-OH (557.0 mg), 4.5 equivalents of oxyma (127.0 mg) and 4.5 equivalents of N, N'-diisopropylcarbodiimide (139.0 μL). Shake at 55°C for 40 minutes. Wash the resin with DMF, and condense Ser, Val, Arg, Ala, Leu, and hydroxyacetic acid in turn. Treat with 10% hydrazine hydrate for 30 minutes and wash the resin. 5.0 equivalents of Fmoc-Lys(Boc)-OH (596.0 mg), 3.0 equivalents of DMAP (73.2 mg), and 3.0 equivalents of N,N'-diisopropylcarbodiimide (141.0 μL) were dissolved in a mixed solution of 8 mL of DCM / DMF (1:1, volume ratio), added to the resin, and transferred together to a 15-mL centrifuge tube, and reacted at 25°C for 12 h. The resin was washed with DMF, and 2.0 mL of 20% Fmoc was added to remove the amino group of Lys. The condensation of Pro, Leu, and Ala amino acids was continued according to the SPPS synthesis process. After the N-terminal Fmoc protecting group of the peptide was removed by 20% piperidine, it was treated with acetic anhydride blocking reagent (DMF: acetic anhydride: 2,6-lutidine = 89:5:6, volume ratio) for 2 minutes. The resin was dried at room temperature, and freshly prepared trifluoroacetic acid lysis solution was added, wherein the volume ratio of TFA, m-cresol, water and triisopropylsilane was 88:5:5:2. The trifluoroacetic acid lysis solution containing the peptide was collected, and 9 volumes of pre-cooled ether were added to obtain a crude peptide in the form of white powder.
[0074] Take 1.0 equivalent (75.6 mg, 94.5 g / mol) of chloroacetic acid and 2.0 equivalent (184 mg, 115 g / mol) of HOSu and add them to a 5 mL EP tube. After adding 3 mL of DMF to dissolve, add 2.0 equivalents of N, N'-diisopropylcarbodiimide (249 μL) and shake at room temperature for 1 hour before setting aside. Take 3.3 mg of crude peptide and react with 10.0 equivalent (113.4 μL) of chloroacetic acid activated ester, add 500 μL of DMF and 10.0 equivalents of DIEA (5 μL). After 30 minutes, the chromatography was quenched with water, chromatographic preparation, and freeze-dried to obtain 10 (7.0 mg, sequence AcNH-Ala-Leu-Pro- ClAc Lys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH 2 , the side chain amino group of Lys is modified by chloroacetyl, Ogly: glycolic acid, such as Figure 2 ), which was detected by ESI-MS (m / z): 1199.18, calculated for C 52 H 90 C1N 15 O 15 :1199.64.
[0075] The synthesized 10 is used for the enzymatic monocyclization of peptides, the enzymatic monocyclization of phage-displayed peptide libraries and the screening of functional monocyclic peptide ligands.
[0076] Embodiment 2:
[0077] Synthesis of 3,5-bis[(2-chloroacetyl)amino]benzoyl-containing peptide oxyester 11
[0078] Weigh 300.0 μmol of Rinkamide resin (535.0 mg, 0.56 mmol / g), add to a 5.0 mL solid phase synthesizer, add 3.0 mL of DMF and swell at room temperature for 20 minutes. Add 2.0 mL of 20% piperidine and shake at room temperature for 6 minutes. Wash the resin with DMF, add 2.0 mL of DMF amino acid condensation reagent, which contains 4.5 equivalents of Fmoc-Ala-OH (557.0 mg), 4.5 equivalents of oxyma (127.0 mg) and 4.5 equivalents of N, N'-diisopropylcarbodiimide (139.0 μL). Shake at 55°C for 40 minutes. Wash the resin with DMF, and condense Ser, Val, Arg, Ala, Leu, and hydroxyacetic acid in turn. Treat with 10% hydrazine hydrate for 30 minutes and wash the resin. 5.0 equivalents of Fmoc-Lys(Boc)-OH (596.0 mg), 3.0 equivalents of DMAP (73.2 mg), and 3.0 equivalents of N,N'-diisopropylcarbodiimide (141.0 μL, 3.0 equivalents) were dissolved in a mixed solution of 8.0 mL of DCM / DMF (1:1, volume ratio), added to the resin, and transferred together to a 15-mL centrifuge tube, and reacted at 25°C for 12 h. The resin was washed with DMF, and 2.0 mL of 20% Fmoc was added to remove the amino group of Lys. The condensation of Pro, Leu, and Ala amino acids continued according to the SPPS synthesis process. After the N-terminal Fmoc protecting group of the peptide was removed by 20% piperidine, it was treated with acetic anhydride blocking reagent (DMF: acetic anhydride: 2,6-lutidine = 89:5:6, volume ratio) for 2 minutes. The resin was dried at room temperature, and freshly prepared trifluoroacetic acid lysis solution was added, wherein the volume ratio of TFA, m-cresol, water and triisopropylsilane was 88:5:5:2. The trifluoroacetic acid lysis solution containing the peptide was collected, and 9 volumes of pre-cooled ether were added to obtain a crude peptide in the form of white powder.
[0079] Take 3,5-bis[(2-chloroacetyl)amino]benzoic acid (15.2 mg) and N-hydroxysuccinimide (23.0 mg) and dissolve them in 0.8 mL DMF, add N,N'-diisopropylcarbodiimide (31.2 μL). React at room temperature for 60 minutes, add 3.0 mL of chromatographic aqueous phase / chromatographic organic phase (1:1, volume ratio) to quench the reaction, and purify by liquid chromatography to obtain the activated ester of 3,5-bis[(2-chloroacetyl)amino]benzoic acid.
[0080] The activated ester of 3,5-bis[(2-chloroacetyl)amino]benzoic acid (8.0 mg) was dissolved in 0.2 mL DMF, and the crude peptide (16.0 mg, sequence: AcNH-Ala-Leu-Pro-Lys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH 2, Ogly: glycolic acid) and N,N-diisopropylethylamine (4.0 μL). After reacting at room temperature for 60 minutes, 3.0 mL of chromatographic aqueous phase was added to quench the reaction. After high performance liquid chromatography purification and freeze drying, 3,5-di[(2-chloroacetyl)amino]benzoyl peptide oxygen ester 11 (5.9 mg, sequence AcNH-Ala-Leu-Pro- Cab Lys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH 2 , Cab Lys: The side chain of Lys is modified by 3,5-di[(2-chloroacetyl)amino]benzoyl, Ogly: Hydroxyacetic acid structure, such as Figure 3 ), which was detected by ESI-MS (m / z): 1409.82, calculated for C 61 H 97 Cl 2 N 17 O 17 :1409.66.
[0081] The synthesized 11 is used for the enzymatic bicyclization of peptides, the enzymatic bicyclization of phage-displayed peptide libraries, and the screening of functional bicyclic peptide ligands.
[0082] Embodiment 3:
[0083] Biological expression of Omniligase-1
[0084] The full gene of Omniligase-1 was custom synthesized from Universal. The synthesized plasmid was treated with XhoI and Ndel endonucleases, inserted into the pET22b plasmid vector, and transformed into Top10 cells. Top10 cells were amplified, and the plasmid containing Omniligase-1 was collected by the kit. The gene sequence of Omniligase-1 is:
[0085] ATGAAATGTGTCAGTTACGGCGTCGCGCAGATCAAGGCACCGGCGCTGCACAGCCAGGGTTATACCGGCTCCAACGTTAAGGTGGCGGTCCTCGATAGCGGCATCGATAGCTCCCATCCCGACCTCAATGTTGCCGGCGGCGCTTCTTTTGTGCCAAGCGAAACTAATCCTTTTCAGGATAATAATAGTCACGGGACGCATGTAGCAGGTACAGTCCTGGCGGTTGCGCCGAGCGCGTCACTCTACGCCGTGAAAGTGCTGGGCGCGGACGGCAGCGGACAATATAGTTGGGTAATTAATGGCATCGAGTGGGCCATCGCGAACAATATGGATGTGATCAATATGAGCCTGGGCGGCCCAAGCGGCAGTGCTGCCTTAAAAGCGGCGGTGGATAAAGCTGTGGCAAGTGGGGTCGTCGTGGTGGCAGCGGCGGGCAATAGTGGCACGAGTGGCTCTTCTTCGACTGTCTCTTACCCCGCGAAATACCCGTCGGTCATCGCGGTTGGGGCGGTTGATAGCTCTAACCAACGTGCCCCCTGGAGCAGTGTAGGCCCAGAATTAGATGTGATGGCGCCAGGTGTGTCTATCTGTAGCACACTCCCGGGCGGCAAATATGGTGCGCATAGTGGCACATGTCCAGCCAGTAACCACGTTGCCGGGGCGGCGGCCCTGATCTTAAGTAAACATCCAAACTGGACCAACACCCAGGTGCGTAGCAGTTTGGAAAACACCGCGACGAAACTGGGTGATTCTTTTTATTACGGGAAAGGTCTCATCAATGTTGAGGCGGCCGCCCAA
[0086] The plasmid containing Omniligase-1 was transformed into chemically competent cells BL21 (DE3), and streaked onto LB plates (containing ampicillin) and grown overnight at 37°C. Select strains with good growth and inoculate them into 500 mL LB medium (containing ampicillin) for culture. IPTG (0.1 mM) was used to induce the expression of the target protein, and the strains were collected after culturing at 16°C for 20 hours. The cells were resuspended in Tris lysis buffer (20.0 mM Tris, 500.0 mM NaCl, 5% glycerol, pH 7.5), and the cells were lysed by ultrasound. The cell supernatant was collected and passed through a Ni-NTA purification column, and the target polypeptide ligase Omniligase-1 was eluted using a 400.0 mM imidazole solution. Omniligase-1 was dissolved in lysis buffer (20.0 mM Tris, 500.0 mM NaCl, 5% glycerol, pH 7.5) with a quantitative concentration of 1.7 mg / mL and stored in aliquots at -80°C for use in enzymatic dicyclization of peptides, enzymatic dicyclization of phage-displayed peptide libraries, and screening of functional bicyclic peptide ligands.
[0087] Embodiment 4:
[0088] Enzyme-catalyzed peptide ligation and monocyclization
[0089] Take 200.0 μL of enzyme binding buffer (0.76M Na 2 HPO 4 , 1 mM TCEP, pH = 8.0), 2.0 μL of chloroacetyl-containing peptide oxygen ester 10 (final concentration of 200.0 μM), and then the peptide template 1 (sequence H-FIEWLCK-NH 2 , final concentration 200.0μM), Omniligase-1 (54.0μg, final concentration 10μM) was added. After shaking at room temperature for 2 hours, the liquid chromatography analysis was performed. Figure 4 As shown, in the presence of Omniligase-1, peptide oxygen ester 10 and peptide template 1 underwent an enzymatic cyclization reaction to produce the target monocyclic peptide product (molecular formula: C 70 H 105 N 15 O 15 S; theoretical molecular weight: 1427.76; observed molecular weight: 1427.98).
[0090] Embodiment 5:
[0091] Enzyme-catalyzed peptide ligation and bicyclization
[0092] Take 200.0 μL of enzyme binding buffer (0.76M Na 2 HPO 4, 1 mM TCEP, pH = 8.0), 2.0 μL 3,5-bis[(2-chloroacetyl)amino]benzoyl peptide oxygen ester 11 (final concentration of 10.0 μM) was added, followed by the addition of peptide template 2 series (H-XLHGCRPYCK-NH 2 , where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G, with a final concentration of 3.0 μM), Omniligase-1 (27.0 μg, with a final concentration of 5 μM) was added. The reaction solution was incubated at 4°C for 30 minutes and analyzed by liquid chromatography. Figure 5 As shown, in the presence of Omniligase-1, 11 and 15 polypeptide templates 2 undergo enzymatic cyclization reactions to generate the target bicyclic peptide product. Bicyclic-[SL] molecular formula C 82 H 122 N 24 O 20 S 2 , observed molecular weight 1826.67, theoretical molecular weight 1826.84; bicyclo-[TL] molecular formula C 83 H 124 N 24 O 20 S 2 , observed molecular weight 1840.77, theoretical molecular weight 1840.86; bicyclo-[NL] molecular formula C 83 H 123 N 25 O 20 S 2 , observed molecular weight 1853.67, theoretical molecular weight 1853.85; bicyclo-[AL] molecular formula C 82 H 122 N 24 O 19 S 2 , observed molecular weight 1810.92, theoretical molecular weight 1810.85; bicyclo-[YL] molecular formula C 86 H 126 N 24 O 20 S 2 , observed molecular weight 1902.63, theoretical molecular weight 1902.87; bicyclo-[KL] molecular formula C 85 H 129 N 25 O 19 S 2 , observed molecular weight 1868.01, theoretical molecular weight 1867.91; bicyclo-[RL] molecular formula C 85 H 129 N 27 O 19 S 2, observed molecular weight 1895.73, theoretical molecular weight 1895.91; bicyclo-[IL] molecular formula C 85 H 128 N 24 O 19 S 2 , observed molecular weight 1852.98, theoretical molecular weight 1852.89; bicyclo-[VL] molecular formula C 84 H 126 N 24 O 19 S 2 , observed molecular weight 1838.73, theoretical molecular weight 1838.88; bicyclo-[FL] molecular formula C 88 H 126 N 24 O 19 S 2 , observed molecular weight 1886.73, theoretical molecular weight 1886.88; bicyclo-[WL] molecular formula C 90 H 127 N 25 O 19 S 2 , observed molecular weight 1925.79, theoretical molecular weight 1925.89; bicyclo-[GL] molecular formula C 81 H 120 N 24 O 19 S 2 , observed molecular weight 1796.67, theoretical molecular weight 1796.78; bicyclo-[ML] molecular formula C 85 H 129 N 25 O 19 S 2 , observed molecular weight 1870.92, theoretical molecular weight 1870.85; bicyclo-[HL] molecular formula C 85 H 124 N 26 O 19 S 2 , observed molecular weight 1876.77, theoretical molecular weight 1876.87; bicyclo-[QL] molecular formula C 84 H 125 N 25 O 20 S 2 , observed molecular weight 1867.77, theoretical molecular weight 1867.87.
[0093] Following similar procedures, 11 and 17 peptide templates 3 series (H-XIHGCRPYCK-NH 2, wherein X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E, and the final concentration is 3.0 μM) undergoes an enzyme concatenation reaction to generate the target bicyclic peptide product such as Figure 6 Bicyclic-[SI] molecular formula C 82 H 122 N 24 O 20 S 2 , observed molecular weight 1827.33, theoretical molecular weight 1826.84; bicyclo-[TI] molecular formula C 83 H 124 N 24 O 20 S 2 , observed molecular weight 1840.74, theoretical molecular weight 1840.86; bicyclo-[NI] molecular formula C 83 H 123 N 25 O 20 S 2 , observed molecular weight 1854.03, theoretical molecular weight 1853.85; bicyclo-[AI] molecular formula C 82 H 122 N 24 O 19 S 2 , observed molecular weight 1810.65, theoretical molecular weight 1810.85; bicyclo-[YI] molecular formula C 88 H 126 N 24 O 20 S 2 , observed molecular weight 1903.23, theoretical molecular weight 1902.87; bicyclo-[KI] molecular formula C 85 H 129 N 25 O 19 S 2 , observed molecular weight 1867.62, theoretical molecular weight 1867.91; bicyclo-[RI] molecular formula C 85 H 129 N 27 O 19 S 2 , observed molecular weight 1895.67, theoretical molecular weight 1895.91; bicyclo-[II] molecular formula C 85 H 128 N 24 O 19 S 2 , observed molecular weight 1852.65, theoretical molecular weight 1852.89; bicyclo-[VI] molecular formula C 84 H 126 N 24 O19 S 2 , observed molecular weight 1839.33, theoretical molecular weight 1838.88; bicyclo-[FI] molecular formula C 88 H 126 N 24 O 19 S 2 , observed molecular weight 1887.30, theoretical molecular weight 1886.88; bicyclo-[WI] molecular formula C 90 H 127 N 25 O 19 S 2 , observed molecular weight 1925.67, theoretical molecular weight 1925.89; bicyclo-[GI] molecular formula C 81 H 120 N 24 O 19 S 2 , observed molecular weight 1796.55, theoretical molecular weight 1796.78; bicyclo-[MI] molecular formula C 85 H 129 N 25 O 19 S 2 , observed molecular weight 1870.68, theoretical molecular weight 1870.85; bicyclo-[HI] molecular formula C 85 H 124 N 26 O 19 S 2 , observed molecular weight 1876.62, theoretical molecular weight 1876.87; bicyclo-[QI] molecular formula C 84 H 125 N 25 O 20 S 2 , observed molecular weight 1867.68, theoretical molecular weight 1867.87; bicyclo-[DI] molecular formula C 83 H 122 N 24 O 21 S 2 , observed molecular weight 1854.36, theoretical molecular weight 1854.84; bicyclo-[EI] molecular formula C 84 H 124 N 24 O 21 S 2 , observed molecular weight 1868.43, theoretical molecular weight 1868.85.
[0094] Following similar procedures, 11 and 16 peptide templates in the 4 series (H-XVHGCRPYCK-NH 2, where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, or E, and the final concentration is 3.0 μM) to produce the target bicyclic peptide product such as Figure 7 As shown. Bicyclo-[SV] molecular formula C 81 H 120 N 24 O 20 S 2 , observed molecular weight 1813.35, theoretical molecular weight 1812.81; bicyclo-[TV] molecular formula C 82 H 122 N 24 O 20 S 2 , observed molecular weight 1827.03, theoretical molecular weight 1826.83; bicyclo-[NV] molecular formula C 82 H 121 N 25 O 20 S 2 , observed molecular weight 1840.35, theoretical molecular weight 1839.82; bicyclo-[AV] molecular formula C 81 H 120 N 24 O 19 S 2 , observed molecular weight 1797.00, theoretical molecular weight 1796.82; bicyclo-[YV] molecular formula C 87 H 124 N 24 O 20 S 2 , observed molecular weight 1889.34, theoretical molecular weight 1888.84; bicyclo-[KV] molecular formula C 84 H 127 N 25 O 19 S 2 , observed molecular weight 1853.94, theoretical molecular weight 1853.88; bicyclo-[RV] molecular formula C 84 H 127 N 27 O 19 S 2 , observed molecular weight 1882.35, theoretical molecular weight 1881.88; bicyclo-[IV] molecular formula C 84 H 126 N 24 O 19 S 2 , observed molecular weight 1838.94, theoretical molecular weight 1838.86; bicyclo-[VV] molecular formula C 83 H 124 N 24 O19 S 2 , observed molecular weight 1824.42, theoretical molecular weight 1824.85; bicyclo-[FV] molecular formula C 87 H 124 N 24 O 19 S 2 , observed molecular weight 1872.42, theoretical molecular weight 1872.85; bicyclo-[WV] molecular formula C 89 H 125 N 25 O 19 S 2 , observed molecular weight 1911.72, theoretical molecular weight 1911.86; bicyclo-[EV] molecular formula C 83 H 122 N 24 O 21 S 2 , observed molecular weight 1854.96, theoretical molecular weight 1854.82; bicyclo-[MV] molecular formula C 83 H 124 N 24 O 19 S 3 , observed molecular weight 1857.00, theoretical molecular weight 1856.82; bicyclo-[HV] molecular formula C 84 H 122 N 26 O 19 S 2 , observed molecular weight 1863.21, theoretical molecular weight 1862.84; bicyclo-[QV] molecular formula C 83 H 123 N 25 O 20 S 2 , observed molecular weight 1853.43, theoretical molecular weight 1853.84; bicyclo-[GV] molecular formula C 80 H 118 N 24 O 19 S 2 , observed molecular weight 1782.35, theoretical molecular weight 1782.77.
[0095] Following similar procedures, 11 and 15 peptide templates in series 5 (H-XMHGCRPYCK-NH 2 , wherein X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, or G, and the final concentration is 3.0 μM) undergoes an enzyme concatenation reaction to generate the target bicyclic peptide product such as Figure 8 As shown. Bicyclic-[SM] molecular formula C 81 H 120 N24 O 20 S 3 , observed molecular weight 1845.03, theoretical molecular weight 1844.88; bicyclo-[TM] molecular formula C 82 H 122 N 24 O 20 S 3 , observed molecular weight 1859.16, theoretical molecular weight 1858.90; bicyclo-[NM] molecular formula C 82 H 121 N 25 O 20 S 3 , observed molecular weight 1872.30, theoretical molecular weight 1871.89; bicyclo-[AM] molecular formula C 81 H 120 N 24 O 19 S 3 , observed molecular weight 1829.37, theoretical molecular weight 1828.89; bicyclo-[YM] molecular formula C 87 H 124 N 24 O 20 S 3 , observed molecular weight 1921.32, theoretical molecular weight 1920.91; bicyclo-[KM] molecular formula C 84 H 127 N 25 O 19 S 3 , observed molecular weight 1886.34, theoretical molecular weight 1885.95; bicyclo-[RM] molecular formula C 84 H 127 N 27 O 19 S 3 , observed molecular weight 1914.20, theoretical molecular weight 1913.95; bicyclo-[IM] molecular formula C 84 H 126 N 24 O 19 S 3 , observed molecular weight 1870.65, theoretical molecular weight 1870.93; bicyclo-[VM] molecular formula C 83 H 124 N 24 O 19 S 3 , observed molecular weight 1857.30, theoretical molecular weight 1856.92; bicyclo-[FM] molecular formula C 87 H 124 N 24 O 19 S 3, observed molecular weight 1905.30, theoretical molecular weight 1904.92; bicyclo-[WM] molecular formula C 89 H 125 N 25 O 19 S 3 , observed molecular weight 1943.70, theoretical molecular weight 1943.93; bicyclo-[GM] molecular formula C 80 H 118 N 24 O 19 S 3 , observed molecular weight 1815.03, theoretical molecular weight 1814.74; bicyclo-[MM] molecular formula C 83 H 124 N 24 O 19 S 4 , observed molecular weight 1888.65, theoretical molecular weight 1888.89; bicyclo-[HM] molecular formula C 84 H 122 N 26 O 19 S 3 , observed molecular weight 1895.34, theoretical molecular weight 1894.91; bicyclo-[QM] molecular formula C 83 H 123 N 25 O 20 S 3 , observed molecular weight 1885.47, theoretical molecular weight 1885.91.
[0096] Following similar procedures, 11 and 17 peptide templates 6 series (H-XYHGCRPYCK-NH 2 , wherein X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, or E, and the final concentration is 3.0 μM) undergoes an enzyme concatenation reaction to generate the target bicyclic peptide product such as Fig. 9 As shown. Bicyclic-[SY] molecular formula C 85 H 120 N 24 O 21 S 2 , observed molecular weight 1876.62, theoretical molecular weight 1876.85; bicyclo-[TY] molecular formula C 86 H 122 N 24 O 21 S 2 , observed molecular weight 1890.32, theoretical molecular weight 1890.87; bicyclo-[NY] molecular formula C 86 H 121 N 25 O 21S 2 , observed molecular weight 1903.65, theoretical molecular weight 1903.86; bicyclo-[AY] molecular formula C 85 H 120 N 24 O 20 S 2 , observed molecular weight 1860.45, theoretical molecular weight 1860.86; bicyclo-[YY] molecular formula C 91 H 124 N 24 O 21 S 2 , observed molecular weight 1952.34, theoretical molecular weight 1952.88; bicyclo-[KY] molecular formula C 88 H 127 N 25 O 20 S 2 , observed molecular weight 1918.26, theoretical molecular weight 1917.92; bicyclo-[RY] molecular formula C 88 H 127 N 27 O 20 S 2 , observed molecular weight 1945.53, theoretical molecular weight 1945.92; bicyclo-[IY] molecular formula C 88 H 126 N 24 O 20 S 2 , observed molecular weight 1902.63, theoretical molecular weight 1902.90; bicyclo-[VY] molecular formula C 87 H 124 N 24 O 20 S 2 , observed molecular weight 1888.56, theoretical molecular weight 1888.89; bicyclo-[FY] molecular formula C 91 H 124 N 24 O 20 S 2 , observed molecular weight 1937.04, theoretical molecular weight 1936.89; bicyclo-[WY] molecular formula C 93 H 125 N 25 O 20 S 2 , observed molecular weight 1975.65, theoretical molecular weight 1975.90; bicyclo-[GY] molecular formula C 84 H 118 N 24 O 20 S 2, observed molecular weight 1846.35, theoretical molecular weight 1846.76; bicyclo-[MY] molecular formula C 87 H 124 N 24 O 20 S 3 , observed molecular weight 1920.57, theoretical molecular weight 1920.86; bicyclo-[HY] molecular formula C 88 H 122 N 26 O 20 S 2 , observed molecular weight 1926.96, theoretical molecular weight 1926.88; bicyclo-[QY] molecular formula C 87 H 123 N 25 O 21 S 2 , observed molecular weight 1917.66, theoretical molecular weight 1917.88; bicyclo-[DY] molecular formula C 86 H 120 N 24 O 22 S 2 , observed molecular weight 1904.64, theoretical molecular weight 1904.85; bicyclo-[EY] molecular formula C 87 H 122 N 24 O 22 S 2 , observed molecular weight 1919.16, theoretical molecular weight 1918.86.
[0097] Following similar procedures, 11 and 18 peptide templates 7 series (H-XWHGCRPYCK-NH 2 , where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L, and the final concentration is 3.0 μM) and an enzyme concatemerization reaction occurs to generate the target bicyclic peptide product such as Fig.10 As shown. Bicyclic-[SW] molecular formula C 87 H 121 N 25 O 20 S 2 , observed molecular weight 1900.17, theoretical molecular weight 1899.89; bicyclo-[TW] molecular formula C 88 H 123 N 25 O 20 S 2 , observed molecular weight 1913.67, theoretical molecular weight 1913.91; bicyclo-[NW] molecular formula C 88 H 122 N 26 O20 S 2 , observed molecular weight 1927.26, theoretical molecular weight 1926.90; bicyclo-[AW] molecular formula (C 87 H 121 N 25 O 19 S 2 , observed molecular weight 1884.39, theoretical molecular weight 1883.90; bicyclo-[YW] molecular formula C 93 H 125 N 25 O 20 S 2 , observed molecular weight 1976.34, theoretical molecular weight 1975.92; bicyclo-[KW] molecular formula C 90 H 128 N 26 O 19 S 2 , observed molecular weight 1940.44, theoretical molecular weight 1940.96; bicyclo-[RW] molecular formula C 90 H 128 N 28 O 19 S 2 , observed molecular weight 1969.36, theoretical molecular weight 1968.96; bicyclo-[IW] molecular formula C 90 H 127 N 25 O 19 S 2 , observed molecular weight 1926.30, theoretical molecular weight 1925.94; bicyclo-[VW] molecular formula C 89 H 125 N 25 O 19 S 2 , observed molecular weight 1911.63, theoretical molecular weight 1911.93; bicyclo-[FW] molecular formula C 93 H 125 N 25 O 19 S 2 , observed molecular weight 1959.66, theoretical molecular weight 1959.93; bicyclo-[WW] molecular formula C 95 H 126 N 26 O 19 S 2 , observed molecular weight 1999.26, theoretical molecular weight 1998.94; bicyclo-[GW] molecular formula C 86 H 119 N 25 O 19 S 2, observed molecular weight 1869.22, theoretical molecular weight 1869.78; bicyclo-[MW] molecular formula C 89 H 125 N 25 O 19 S 3 , observed molecular weight 1944.30, theoretical molecular weight 1943.90; bicyclo-[HW] molecular formula C 90 H 123 N 27 O 19 S 2 , observed molecular weight 1950.36, theoretical molecular weight 1949.92; bicyclo-[QW] molecular formula C 89 H 124 N 26 O 20 S 2 , observed molecular weight 1941.42, theoretical molecular weight 1940.92; bicyclo-[DW] molecular formula C 88 H 121 N 25 O 21 S 2 , observed molecular weight 1928.25, theoretical molecular weight 1927.89; bicyclo-[EW] molecular formula C 89 H 123 N 25 O 21 S 2 , observed molecular weight 1942.29, theoretical molecular weight 1941.90; bicyclo-[LW] molecular formula C 90 H 127 N 25 O 19 S 2 , observed molecular weight 1926.30, theoretical molecular weight 1925.94.
[0098] Following similar procedures, 11 and 18 peptide templates 8 series (H-XFHGCRPYCK-NH 2 , where X is S, T, N, Q, Y, R, K, H, A, I, F, M, V, W, G, D, E, or L, and the final concentration is 3.0 μM) and an enzyme concatemerization reaction occurs to generate the target bicyclic peptide product such as Fig.11 As shown. Bicyclo-[SF] molecular formula C 85 H 120 N 24 O 20 S 2 , observed molecular weight 1861.20, theoretical molecular weight 1860.81; bicyclo-[TF] molecular formula C 86 H 122 N 24 O20 S 2 , observed molecular weight 1875.30, theoretical molecular weight 1874.83; bicyclo-[NF] molecular formula C 86 H 121 N 25 O 20 S 2 , observed molecular weight 1887.60, theoretical molecular weight 1887.82; bicyclo-[AF] molecular formula C 85 H 120 N 24 O 19 S 2 , observed molecular weight 1844.64, theoretical molecular weight 1844.82; bicyclo-[YF] molecular formula C 91 H 124 N 24 O 20 S 2 , observed molecular weight 1937.10, theoretical molecular weight 1936.84; bicyclo-[KF] molecular formula C 88 H 127 N 25 O 19 S 2 , observed molecular weight 1901.79, theoretical molecular weight 1901.88; bicyclo-[RF] molecular formula C 88 H 127 N 27 O 19 S 2 , observed molecular weight 1929.54, theoretical molecular weight 1929.88; bicyclo-[IF] molecular formula C 88 H 126 N 24 O 19 S 2 , observed molecular weight 1887.30, theoretical molecular weight 1886.86; bicyclo-[VF] molecular formula C 87 H 124 N 24 O 19 S 2 , observed molecular weight 1873.02, theoretical molecular weight 1872.85; bicyclo-[FF] molecular formula C 91 H 124 N 24 O 19 S 2 , observed molecular weight 1921.32, theoretical molecular weight 1920.85; bicyclo-[WF] molecular formula C 93 H 125 N 25 O 19 S 2, observed molecular weight 1960.26, theoretical molecular weight 1959.86; bicyclo-[GF] molecular formula C 84 H 118 N 24 O 19 S 2 , observed molecular weight 1830.30, theoretical molecular weight 1830.77; bicyclo-[MF] molecular formula C 87 H 124 N 24 O 19 S 3 , observed molecular weight 1905.30, theoretical molecular weight 1904.82; bicyclo-[HF] molecular formula C 88 H 122 N 26 O 19 S 2 , observed molecular weight 1911.27, theoretical molecular weight 1910.84; bicyclo-[QF] molecular formula C 87 H 123 N 25 O 20 S 2 , observed molecular weight 1901.40, theoretical molecular weight 1901.84; bicyclo-[DF] molecular formula C 86 H 120 N 24 O 21 S 2 , observed molecular weight 1888.50, theoretical molecular weight 1888.81; bicyclo-[EF] molecular formula C 87 H 122 N 24 O 21 S 2 , observed molecular weight 1902.60, theoretical molecular weight 1902.82; bicyclo-[LF] molecular formula C 88 H 126 N 24 O 19 S 2 , observed molecular weight 1886.40, theoretical molecular weight 1886.86.
[0099] Following similar operations, 11 and 8 peptide templates 9 series (H-XHHGCRPYCK-NH 2 , where X is Q, A, S, V, I, M, W, or F, and the final concentration is 3.0 μM) to produce the target bicyclic peptide product such as Fig.12 As shown. Bicyclic-[SH] molecular formula C 82 H 118 N 26 O 20 S 2, observed molecular weight 1851.24, theoretical molecular weight 1850.85; bicyclo-[AH] molecular formula C 82 H 118 N 26 O 19 S 2 , observed molecular weight 1834.35, theoretical molecular weight 1834.86; bicyclo-[IH] molecular formula C 85 H 124 N 26 O 19 S 2 , observed molecular weight 1876.86, theoretical molecular weight 1876.90; bicyclo-[VH] molecular formula C 84 H 122 N 26 O 19 S 2 , observed molecular weight 1863.36, theoretical molecular weight 1862.89; bicyclo-[FH] molecular formula C 88 H 122 N 26 O 19 S 2 , observed molecular weight 1911.21, theoretical molecular weight 1910.89; bicyclo-[WH] molecular formula C 90 H 123 N 27 O 19 S 2 , observed molecular weight 1949.34, theoretical molecular weight 1949.90; bicyclo-[MH] molecular formula C 84 H 122 N 26 O 19 S 3 , observed molecular weight 1895.34, theoretical molecular weight 1894.86; bicyclo-[QH] molecular formula C 84 H 121 N 27 O 20 S 2 , observed molecular weight 1892.34, theoretical molecular weight 1891.88.
[0100] exist Figures 5 to 12In the figure, 0 min is the chromatogram of 11 (10 μM) and a series of nucleophilic peptides (3 μM) in an aqueous solution without peptide ligase and pH 3, and 30 min is the chromatogram of 11 (10 μM) and a series of nucleophilic peptides (3 μM) in an aqueous solution of Omniligase-1 (5 μM) and pH 8 after 30 min of reaction at 4°C; "*" and "**" refer to the hydroxyacetic acid-containing peptide and 3,5-di[(2-chloroacetyl)amino]benzoyl-containing peptide produced by the hydrolysis of the oxygen ester bond of 11 catalyzed by Omniligase-1, respectively; since the enzyme cyclization reaction catalyzed by Omniligase-1 is carried out at 4°C (for 30 minutes) rather than the optimal conditions, optimizing the temperature, pH, solution buffer salt composition, reaction time and reaction substrate can improve the efficiency of the enzyme cyclization reaction in this test.
[0101] Embodiment 6:
[0102] Omniligase-1 catalyzes the modification of bacteriophages
[0103] The commercial M13KE phage plasmid was transformed into ER2738 cells, and the original M13KE plasmid was amplified and extracted.
[0104] The sequences of the four customized primers are as follows:
[0105] Primer 1: 5′-TTTGGTCTC AGA GTG AGAATA GAAAGG TAC CACTAAAGG-3′;
[0106] Primer 2: 5'-TTGGTCTC CAC TCT NNKNTN CAT CTTAATATT TGCGGT AAT CAT ACT ATGCAG TGC GGC GGC TCT GGC GGC TCTGGC GGC TCG GCC GAAACT GTT GAAAGT TGT TTA-3';
[0107] Primer 3: 5'-TTGGTCTC CAC TCT NNK TAT CAT CTTAATATT TGCGGT AAT CAT ACTATG CAG TGC GGC GGC TCT GGC GGC TCTGGC GGC TCG GCC GAAACT GTT GAAAGT TGT TTA-3';
[0108] Primer 4: 5'-TTGGTCTC CAC TCT NNK TGG CAT CTT AATATT TGCGGT AAT CAT ACTATG CAG TGC GGC GGC TCT GGC GGC TCTGGC GGC TCG GCC GAAACT GTT GAAAGT TGT TTA-3'
[0109] Primer 1 was used in parallel with primer 2, primer 3 or primer 4 for whole plasmid PCR. After mixing the reaction solution, the kit recovered the DNA and treated it with BsaI and DpnI. After overnight enzyme ligation with T4 DNA ligase, the DNA was electroporated into RE2738 cells, the phage was amplified and cultured, and the M13KE-XB phage library was collected (X is any natural amino acid, and B is any one of F, M, V, I, L, Y or W). 11 Each phage was dissolved in 100.0 μL PBS buffer (0.76 M Na 2 HPO 4 , 1.0 mM TCEP, pH 8.0), add Biotin-11 (sequence Biotin-βAla-Ala-Leu-Pro- Cab Lys-Ogly-Leu-Ala-Arg-Val-Ser-Ala-NH 2 , final concentration 10.0 μM) and Omniligase-1 (final concentration 5.0 μM). After the reaction solution was incubated at 4°C for 30 minutes (250 rpm), 3.5 μL HCl solution (6.0 M HCl) was added to adjust the pH to 5.0. Then, 25.0 μL PEG solution (20% PEG8000, 0.5 M NaCl) was added to precipitate the phage particles, and resuspended in TBS and graded diluted to 10 5 pfu / mL phage solution. Take three clean 2.0mL centrifuge tubes and name them Aa, Ab, and B. Add 20.0μL phage solution (10 5 pfu / mL) and 50.0 μL Binding buffer and 50.0 μL Blocking buffer. In the Ab tube, add 50.0 μL Binding buffer (10.0 mM Tris-Cl, 150.0 mM NaCl, 10.0 mM MgCl) to the washed streptavidin magnetic beads (20.0 μL). 2 , 1.0 mM CaCl 2 , pH 7.4) and 50.0 μL Locking Buffer (10.0 mM Tris-Cl, 150.0 mM NaCl, 10.0 mM MgCl 2, 1.0 mM CaCl 2 , 0.3% Tween-20, 3% (w / v) BSA). In tube B, add 20.0 μL of phage solution (10 5 pfu / mL) and 50.0μL Binding buffer and 50.0μL Blocking buffer. After 1 hour at 25°C, tube Aa and tube Ab were mixed (named tube A), and 50.0μL Binding buffer and 50.0μL Blocking buffer were added to tube B. Tubes A and B were incubated at 25°C for 30 minutes. The magnetic beads were captured on the magnetic stand of group A, and the supernatant was transferred to a clean centrifuge tube. 200.0μL washing buffer (10.0mMTris-Cl, 150.0mM NaCl, 10.0mM MgCl 2 , 1.0 mM CaCl 2 , pH 7.4, 0.1% Tween-20) and then transfer the solution to the centrifuge tube containing the phage supernatant in tube A. Add 400.0 μL washing buffer to tube B. Gradient determination of the supernatant in tube A and the phage in tube B captured by magnetic beads. Calculation method of the efficiency of omniligase-1 modification of phage: modified phage ratio (%) = [(B titer - A titer) / B titer] × 100%. The phage capture experiment was repeated 3 times. The titer test determined that 80% of the phage particles were modified by Biotin-11.
[0110] Embodiment 7:
[0111] Construction of phage bicyclic peptide library and screening of bicyclic peptide ligands
[0112] Using the pCANTAB 5E phagemid vector as a template, the recognition site of BsaI of the phagemid vector was point mutated by homologous recombination to obtain pCANTAB5E' (5'-GAGCGTGGGTCTCGCGGTATCATTGCAGCAC-3' was mutated to 5'-GAGCGTGGGTCGCGCGGTATCATTGCAGCAC-3'). Four DNA primers were customized, and the sequences were as follows (M is C or A; N is A or C or T or G):
[0113] Primer 5:
[0114] 5'-TTGGTCTCGGTGCGCCGGTGCCGTATCCGGATCCGCTG-3';
[0115] Primer 6:
[0116] 5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNNANMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3';
[0117] Primer 7:
[0118] 5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNATAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3';
[0119] Primer 8:
[0120] 5'-TTTGGTCTCAGCACCGCCAGAGCCGCCGCAMNNMNNMNNMNNMNNMNNGCAMNNMNNMNNMNNCCAMNNGGCCATGGCCGGCTGGGCCGCATAGAAAGG-3';
[0121] Primer 5 was used in parallel with primer 6, primer 7 or primer 8 for PCR of the whole plasmid template pCANTAB 5E'. After mixing the reaction solution, the DNA was recovered by the kit and treated with BsaI and DpnI. The DNA was ligated overnight with T4 DNA ligase and then electroporated into TG1 cells (the diversity of electroporation was determined to be 2×10 10 pfu). Take TG1 containing the library to amplify the culture, and use super helper phage to infect and package, and collect the M13KE-XBX4CX6C phage library (X is any natural amino acid, and B is any one of F, M, V, I, L, Y or W). Take the phage library (2×10 12 pfu) was dissolved in 100.0 μL of enzyme binding buffer (0.76 M Na 2 HPO 4, 1mM TCEP, pH=8.0), followed by the addition of 11 (final concentration of 5.0μM). The reaction system was immediately incubated at 4°C for 30 minutes. 3.5μL hydrochloric acid (6.0M HCl) was added to adjust the pH to 5.0, and then the target phage particles were precipitated with PEG8000 solution. The phage particles were resuspended in 1.5mL of binding buffer and 750.0μL of blocking buffer and incubated at room temperature for 30 minutes. At the same time, 50.0μL of streptomycin-coated magnetic beads (Dynabeads M-280) were taken, washed and resuspended in 300.0μL of binding buffer and 150.0μL of blocking buffer, and incubated at room temperature for 30 minutes. The supernatant of the magnetic beads was removed on the magnetic stand, and the magnetic beads were resuspended in 100.0μL of binding buffer / blocking buffer (2:1). 50.0 μL of magnetic beads were added to the phage solution. After incubation at room temperature for 30 minutes, the phage supernatant was collected and the beads were demagnetized. The phage was treated with 50.0 μL of magnetic beads again for 30 minutes. The phage was transferred to 20.0 μL of TEAD4-coated magnetic beads that had been treated with binding buffer / blocking buffer in advance and incubated at room temperature for 30 minutes. After washing the magnetic beads 10 times, elution buffer at pH 2.2 was added. A small amount of neutralized phage was taken for titer determination, and the rest was used to infect TG1 cells, plated and grown overnight, and packaged phage. The second and third rounds of screening were performed according to the above process. In the fourth and fifth rounds of screening, the phage was pre-treated with empty magnetic beads for 9 times, and other operations were similar. After the fifth round of screening, 30 clones were randomly selected for sequencing, and 5 bicyclic peptides were synthesized, and their ability to bind to TEAD4 was evaluated by positive fluorescence. One of the bicyclic peptides 12 has a binding capacity of 1.5 μM (e.g. Fig.13 As shown, 12-L is the linear form of 12, i.e., there is no cyclized cross-linking arm in the sequence of 12, only Lys and Cys residues with unmodified side chains). The binding affinity of this peptide is 100 times higher than that of its corresponding linear peptide, indicating the effectiveness of this platform technology.
[0122] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A polypeptide compound, characterized in that: The polypeptide compound is a polypeptide compound recognized by a polypeptide ligase containing an electrophilic reactive group, and the compound has the following general structural formula: Where, X a X is any one of hydrogen, acetyl, and an oligopeptide group consisting of natural or unnatural amino acids except cysteine; b Any one of an electrophilic group and an oligopeptide group composed of natural or non-natural amino acids containing an electrophilic group; X c X is any one of oxygen (oxyester bond) and sulfur (thioester bond); d Any one of the oligopeptide sequences consisting of amino group, natural or unnatural amino acids except cysteine; n is any number between 1 and 8.
2. The polypeptide compound according to claim 1, characterized in that: The electrophilic group is any one of chloroacetamido, 4-chloroacetamidobenzamido, 3,5-bis[(2-chloroacetyl)amino]benzamido, 3,5-bis(chloromethyl)benzylthio, 2-(chloromethyl)benzylthio, 3-(chloromethyl)benzylthio, 4-(chloromethyl)benzylthio, 4-(chloromethyl)biphenylmethylthio, 2,3,4,5,6-pentafluorophenylthio, and 4-(2',3',4',5',6'-pentafluorophenyl)-2,3,5,6-tetrafluorophenylthio.
3. A polypeptide ligase-mediated polypeptide cyclization method, characterized in that: The method comprises the following steps: S1. Using the polypeptide compound according to any one of claims 1 to 2 to carry out polypeptide enzyme ligation reaction and intramolecular polypeptide cyclization reaction with a cysteine-containing polypeptide template in a buffered salt solution in the presence of a polypeptide ligase produced by transformation of subtilisin to produce a cyclic peptide molecule; The cysteine-containing polypeptide template is as follows: Template a: XB-(X)mC; Template b: XB-(X)mC-(X)nC; Wherein, template a is used to construct a monocyclic peptide, template b is used to construct a bicyclic peptide, B represents any one of L-leucine, L-isoleucine, L-valine, L-methionine, L-tyrosine, L-tryptophan, L-phenylalanine, and L-histidine, X represents any natural L-amino acid, C represents L-cysteine and the position can be changed as required, and m and n represent the number of amino acids between 3 and 20; S2. Select the cysteine-containing polypeptide template in S1, express it at the N-terminus of the phage pIII protein through gene encoding fusion, and then construct a phage-displayed cyclic peptide library through S1 step operation, and screen the macrocyclic peptide ligand for the target protein.
4. The method for polypeptide cyclization according to claim 3, characterized in that: The polypeptide ligase produced by the modification of subtilisin is any one of Subtiligase, Peptiligase and Omniligase-1.
5. The method for polypeptide cyclization according to claim 3, characterized in that: In step S1, the concentration range of the polypeptide compound is 0.01 μM to 1.0 mM, and the concentration range of the polypeptide ligase is 0.01 μM to 10.0 mM; the buffered salt solution is any one of PBS, HEPES, NaOAc and Tris, containing 0.0 μM to 10.0 mM TCEP, and the pH range is 7.0 to 10.
0.
6. The method for polypeptide cyclization according to claim 3, characterized in that: The duration of the peptide enzyme ligation reaction and the intramolecular polypeptide cyclization reaction in step S1 is 1 min-6 h, and the reaction temperature is 0-45°C.
7. The method for polypeptide cyclization according to claim 3, characterized in that: The phage in S2 is a phage system consisting of pCANTAB 5E phagemid and helper phage M13KO7 or M13KE phage system.
8. The method for polypeptide cyclization according to claim 3, characterized in that: The step S2 of screening macrocyclic peptide ligands for the target protein comprises the following steps: S2-1, constructing a phage-displayed single-ring peptide or double-ring peptide library using a peptide ligase-mediated peptide cyclization method; S2-2, the target protein is biotinylated and fixed on magnetic beads, the phage-displayed single-ring peptide or double-ring peptide library in S2-1 is co-incubated with the immobilized target protein, and after 2 to 6 rounds of bio-panning, the bio-panned phage particles are sequenced; S2-3. Synthesize the enriched target cyclic peptides based on the sequencing results, and evaluate the binding affinity and biological activity with the target protein.
9. An application of the polypeptide cyclization method mediated by a polypeptide ligase according to any one of claims 3 to 8, characterized in that: The polypeptide cyclization is applied to the construction of a gene-encoded cyclic peptide library.
10. Use of a cyclic peptide ligand obtained by the polypeptide cyclization method according to any one of claims 3 to 8 in the development of drugs, detection kits or other biomedicines and biomaterials.
Citation Information
Patent Citations
Asparagine endopeptidase mediated polypeptide cyclization method and application in phage display peptide library
CN117925757A
Ligase catalyzed polypeptide cyclization method and application in phage display peptide library
CN117925758A