Anti-parvovirus canine-mouse chimeric antibody

Abstract

The invention discloses an anti-parvovirus canine-mouse chimeric antibody, and belongs to the field of gene engineering, the chimeric antibody comprises a heavy chain variable region, a light chain variable region, a heavy chain constant region and a light chain constant region, the heavy chain variable region and the light chain variable region are mouse-derived fragments, and the heavy chain constant region and the light chain constant region are canine-derived fragments; the amino acid sequence of the heavy chain variable region is as shown in SEQ ID No.2, and the amino acid sequence of the light chain variable region is as shown in SEQ ID No.4. The canine-mouse chimeric antibody has broad-spectrum high neutralization activity on various subtypes of CPV in vitro, the immunological rejection of a mouse antibody in a canine body is reduced, and the canine infected by CPV-2c can be effectively treated by using the canine-mouse chimeric antibody.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to an anti-CPV hybridoma monoclonal antibody and its application after canine-mouse chimeric modification. Background Art

[0002] Canine parvovirus is an acute and severe infectious disease caused by Canine parvovirus (CPV). After infection, it can cause symptoms such as myocarditis or hemorrhagic enteritis in dogs, with a high mortality rate, especially a serious threat to puppies. Currently, mouse monoclonal antibodies are used in clinical treatment for CPV infection. However, after mouse-derived monoclonal antibodies enter the body of heterologous animals, they are prone to cause anti-antibody reactions and even hypersensitivity reactions, resulting in a shortened half-life of mouse-derived monoclonal antibodies and a reduced therapeutic effect. Therefore, there is a clinical need for CPV monoclonal antibodies with low immune rejection, good therapeutic effects, and greater safety for clinical treatment. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a chimeric antibody with good therapeutic effects on canine parvovirus and low immune rejection.

[0004] The technical solution of the present invention is: an anti-parvovirus canine-mouse chimeric antibody, which includes a heavy chain variable region, a light chain variable region, a heavy chain constant region, and a light chain constant region. The heavy chain variable region and the light chain variable region are murine-derived fragments, and the heavy chain constant region and the light chain constant region are canine-derived fragments; the amino acid sequence of the heavy chain variable region is as shown in SEQ ID No.2, and the amino acid sequence of the light chain variable region is as shown in SEQ ID No.4.

[0005] Further, the heavy chain constant region is of IgG2 type, and the light chain constant region is of Kappa type.

[0006] Further, the amino acid sequence of the heavy chain constant region is as shown in SEQ ID No.6, and the amino acid sequence of the light chain constant region is as shown in SEQ ID No.8.

[0007] Application of the above-mentioned chimeric antibody in the preparation of a drug for preventing or treating canine parvovirus

[0008] A DNA fragment encoding the above-mentioned chimeric antibody.

[0009] Further, the DNA fragment includes a heavy chain encoding gene and a light chain encoding gene. The nucleotide sequence of the heavy chain encoding gene is as shown in SEQ ID No.9, and the nucleotide sequence of the light chain encoding gene is as shown in SEQ ID No.11.

[0010] An expression vector containing the nucleotide sequence shown in SEQ ID No.9 or SEQ ID No.11.

[0011] A host cell containing the above-mentioned DNA fragment or expression vector.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The anti-canine parvovirus hybridoma antibody provided by the present invention can recognize and neutralize various subtypes of CPV. After designing primers to amplify the variable region sequences of the heavy and light chains of the antibody, a canine-mouse chimeric antibody expression plasmid vector containing the heavy chain of the antibody (CH-pcDNA3.4) and the variable region sequence of the light chain (CL-pcDNA3.4) was successfully constructed and successfully expressed in HEK293 cells. The neutralizing activity of the canine-mouse chimeric antibody prepared by the method invented in this study did not decrease significantly. Animal experiments showed that the canine-mouse chimeric antibody had a therapeutic effect on dogs infected with CPV-2c. Description of the Drawings

[0014] Figure 1 : Detection results of the ELISA reactivity of the hybridoma antibody.

[0015] Figure 2 : Detection results of the IFA reactivity of the hybridoma antibody

[0016] Figure 3 : Map of the plasmid of the heavy chain of the canine-mouse chimeric antibody constructed.

[0017] Figure 4 : Map of the plasmid of the light chain of the canine-mouse chimeric antibody constructed.

[0018] Figure 5 : Protein electrophoresis map of the canine-mouse chimeric antibody.

[0019] Figure 6 : Survival rate of the canine-mouse chimeric antibody treatment after dogs were challenged with CPV-2c. Detailed Embodiments

[0020] Unless otherwise specified, the experimental methods in the following examples are all conventional methods. Unless otherwise specified, the test materials used in the following examples were all purchased from commercial channels.

[0021] Description of key materials:

[0022] F81 cells: Used as infected cells in the neutralization experiment and stored in this laboratory.

[0023] HEK293 cells: Used for expressing the canine-mouse chimeric antibody and provided by Zhuhai Kairui Company.

[0024] Protein A purification column: Used for purifying the canine-mouse chimeric antibody and purchased from Huiyan Biotech Company.

[0025] CH-pcDNA3.4 vector: The CH-pcDNA3.4 vector contains the constant region of canine IgG2 heavy chain, which was optimized and synthesized by Genewiz Biotechnology Co., Ltd. and is stored in our laboratory.

[0026] CL-pcDNA3.4 vector: The CL-pcDNA3.4 vector contains the constant region of canine kappa light chain, which was optimized and synthesized by Genewiz Biotechnology Co., Ltd. and is stored in our laboratory.

[0027] Example 1 Preparation and Identification of Anti-CPV Hybridoma Antibody

[0028] 1. Production of Anti-CPV Hybridoma Antibody

[0029] The inactivated CPV-2 whole virus after purification was emulsified with Freund's adjuvant and used to immunize female BALB / c mice at 6 - 8 weeks old. The primary immunization dose was 100 μg / mouse (Freund's complete adjuvant), and the subsequent two immunizations were at the same dose (Freund's incomplete adjuvant), with a 14-day interval between each immunization. Finally, 3 days after intraperitoneal injection of 300 μg inactivated virus for immunization, the spleens of the mice were taken for cell fusion, and hybridoma cells were screened. The purified CPV-2 whole virus was used as the coating antigen, and the cell culture supernatant from the hybridoma was screened by enzyme-linked immunosorbent assay. The antibody secreted by the screened hybridoma was named 5E7.

[0030] 2. ELISA Reactivity of Anti-CPV Monoclonal Antibody

[0031] The purified CPV-2 virus was coated on the ELISA coating plate overnight at 4°C. After washing 5 times with PBST, 5% non-fat milk powder was added and blocked at 37°C for 2 h. After washing 5 times with PBST, 2-fold serial diluted 5E7 and control antibody (antibody not binding to CPV) were added and incubated at 37°C for 1.5 h. After washing 5 times with PBST, 1:5000 diluted anti-mouse IgG-HRP antibody was added and incubated at 37°C for 0.5 h. After washing 5 times with PBST, chromogenic solution was added and incubated at 37°C for 10 min, then the stop solution was added, and the OD630 nm value was read with an enzyme-linked immunosorbent assay reader. The results are as Figure 1 shown. 5E7 can still specifically bind to CPV-2 at a relatively low concentration, demonstrating that 5E7 has good reactivity.

[0032] 3. Indirect Immunofluorescence Detection of Antibody Reactivity

[0033] Use a 12-well plate to inoculate different CPV strains (CPV-2, CPV-2a, CPV-2b, CPV-2c strains). After 48 h of virus inoculation, wash 3 times with PBS, fix with 4% paraformaldehyde for 10 min, wash 3 times with PBS, add 0.2% Triton-100 for permeabilization for 10 min, wash 3 times with PBS, add 5E7 antibody at 10 μg / mL, incubate at 37 °C for 1.5 h, wash 3 times with PBS, add anti-dog IgG-FITC antibody diluted 1:100, incubate at 37 °C for 0.5 h, wash 3 times with PBS, add DAPI diluted 1:5000, wash 3 times with PBS, add 1 mL of PBS, observe and take pictures with an inverted fluorescence microscope. The results are as Figure 2 shown, 5E7 can specifically recognize CPV-2, CPV-2a, CPV-2b, and CPV-2c strains.

[0034] 4. Neutralization test to detect the neutralization titer of anti-CPV monoclonal antibody

[0035] Add 50 μL of DMEM medium to a 96-well plate, and then add 50 μL of 5E7 to the first column and perform two-fold serial dilution. Add 200 TCID 50 of CPV to the diluted 5E7, and incubate in a cell culture incubator at 37 °C and 5% CO 2 for 1 h. Add F81 cells to the above 96-well plate and culture in a cell culture incubator at 37 °C and 5% CO 2 for 96 h, then fix with methanol, add anti-CPV murine antibody and incubate in the incubator for 2 h. After washing with PBS, add anti-mouse fluorescent secondary antibody and incubate in the cell culture incubator for 1 h. Observe with a fluorescence microscope after washing with PBS. Evaluate the neutralization activity by calculating the IC 50 (half of the maximum inhibitory concentration), and the results are shown in the following table.

[0036] Table 1 IC of 5E7 against different CPVs 50

[0037] CPV-2 CPV-2a CPV-2b CPV-2c 5E7 0.138 μg / mL 0.364 μg / mL 0.273 μg / mL 0.364 μg / mL

[0038] Example 2 Construction, expression and purification of 5E7 canine-mouse chimeric antibody.

[0039] 1. Amplification of 5E7 heavy and light chain sequences

[0040] Extract RNA from the hybridoma cells prepared in Example 1 according to the instructions of the RNA extraction kit, and reverse transcribe the RNA into cDNA according to the instructions by adding it to the reverse transcription system. The 5E7 heavy chain and light chain sequences are amplified by RCR.

[0041] Primers for amplifying the heavy chain sequence:

[0042] H-F: AATTGACGTCCAGMTSCAGCAGYCTGG

[0043] H-R: ATTAAGTCGACCKYGGTSYTGCTGGCYGGGTG

[0044] Primers for amplifying the light chain sequence:

[0045] L-F: ATATCCATGGCAGACRTCMAGATRAYCCAGWCTMCA

[0046] L-R: CTACCTCGAGTTAACACTCATTCCTGTTGAAGC

[0047] Amplification system:

[0048] Table 2 Amplification system

[0049]

[0050] Amplification program: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min.

[0051] The gene sequence of the heavy chain variable region (VH) of the antibody obtained by PCR amplification is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.2; the gene sequence of the light chain variable region (VL) is shown in SEQ ID No.3, and the amino acid sequence is shown in SEQ ID No.4.

[0052] 2. Vector construction

[0053] 2.1 Construction of the vector expressing the constant region of canine IgG2 heavy chain

[0054] The vector containing the constant region of canine IgG2 heavy chain was synthesized by Genewiz. The gene sequence of the constant region of canine IgG2 heavy chain (CH) is shown in SEQ ID No.5, and the amino acid sequence is shown in SEQ ID No.6.

[0055] 2.2 Construction of the vector expressing the constant region of canine kappa light chain

[0056] The vector containing the constant region of canine kappa light chain was synthesized by Genewiz. The gene sequence of the constant region of canine kappa light chain (CL) is shown in SEQ ID No.7, and the amino acid sequence is shown in SEQ ID No.8.

[0057] 2.3 Construction of the complete plasmids of heavy and light chains

[0058] The amplified heavy-chain variable region (VH) gene was codon-optimized and inserted into the CH-pcDNA3.4 vector containing the canine IgG2 heavy-chain constant region through BamHI and EcoRI restriction sites to construct a vector plasmid expressing the complete heavy chain of the antibody; the light-chain variable region (VL) gene was codon-optimized and inserted into the CL-pcDNA3.4 vector containing the canine Kappa light-chain constant region through BamHI and BbvCI to construct a vector plasmid expressing the complete light chain of the antibody. The constructed heavy-chain plasmid map is as shown in Figure 3 shown, and the light-chain plasmid map is as shown in Figure 4 shown.

[0059] The nucleotide sequence of the complete heavy chain of the antibody is as shown in SEQ ID No.9, and the amino acid sequence is as shown in SEQ ID No.10; the nucleotide sequence of the complete light chain of the antibody is as shown in SEQ ID No.11, and the amino acid sequence is as shown in SEQ ID No.12.

[0060] The recombinant expression plasmid was transformed into DH5α competent cells to amplify the plasmid, and the plasmid was extracted using an endotoxin-free plasmid extraction kit. The operation steps were carried out according to the kit instructions.

[0061] 3. Antibody expression

[0062] According to the operation instructions of Zhuhai Kairui Company, the plasmids were co-transfected into HEK293 cells at a ratio of 1:1 to express the antibody.

[0063] The specific operations are as follows:

[0064] The concentration of HEK293 cells was adjusted to 2×10 6 , 80 μg of the light-chain plasmid and 80 μg of the heavy-chain plasmid were mixed with 500 μL of transfection reagent (TA-293), incubated for 10 min, and then added to 100 mL of suspended HEK293 cells, and placed in a 37°C shaker for incubation. After 24 h, 600 μL of protein expression enhancer (KE-293) and 2 mL of transient transfection nutrient supplement (KT-Feed 50×) were added. On the 6th day, the cell supernatant was collected and centrifuged at 10000 rpm for 30 min.

[0065] 4. Antibody purification and verification

[0066] Filter the supernatant after expression through a 0.22-μm filter. Purify the antibody using a Protein A purification column according to the instructions. The specific operations are as follows: After connecting the Protein A purification column to a peristaltic pump, rinse it with ultrapure water at a flow rate of 1 mL / min for 10 column volumes, then rinse it with the equilibration buffer for 10 column volumes and load the sample at a flow rate of 0.2 mL / min. After the loading is completed, rinse it with the equilibration buffer at a flow rate of 1 mL / min for 10 column volumes, and finally elute the protein using the elution buffer. Replace the purified antibody into PBS using an ultrafiltration tube and store it at -80°C. Take out 80 μL of the purified sample, mix it evenly with 20 μL of 5× protein reducing / non-reducing loading buffer, and then place it in a metal bath at 100°C for 10 min. After SDS-PAGE protein electrophoresis, identify the expression and purification situation through Coomassie Brilliant Blue staining. The results are as Figure 5 shown. The canine-rat chimeric antibody (abbreviated as CM-5E7 in the figure) shows two bands in the denaturing reducing SDS-PAGE, one around 55 KDa, which is the heavy chain, and one around 30 KDa, which is the light chain. A band around 170 KDa appears in the denaturing non-reducing SDS-PAGE, which is the assembled complete antibody.

[0067] 5. Neutralization assay of canine-rat chimeric antibody

[0068] Add 50 μL of DMEM medium to a 96-well plate, and then add 50 μL of CM-5E7 to the first column and perform two-fold serial dilution. Add 200 TCID 50 of CPV to the diluted CM-5E7, and incubate it in a cell culture incubator at 37°C and 5% CO 2 for 1 h. Add F81 cells to the above 96-well plate and culture it in a cell culture incubator at 37°C and 5% CO 2 for 96 h, then fix it with methanol, add a mouse-derived anti-CPV antibody and incubate it in the incubator for 2 h. After washing with PBS, add a fluorescent anti-mouse secondary antibody and incubate it in the cell culture incubator for 1 h. After washing with PBS, observe it using a fluorescence microscope. Evaluate the neutralization activity through the IC 50 (half of the maximum inhibitory concentration) of the antibody. The results are shown in the following table.

[0069] Table 3 IC of CM-5E7 against different CPVs 50

[0070] CPV-2 CPV-2a CPV-2b CPV-2c CM-5E7 0.172 μg / mL 0.458 μg / mL 0.344 μg / mL 0.458 μg / mL

[0071] Example 3 Therapeutic trial of canine-rat chimeric antibody.

[0072] 1. Grouping of animal experiments

[0073] Fifteen healthy Chinese rural dogs with negative CPV detection were randomly divided into three groups (five dogs / group): healthy group, CPV challenge group, and canine-rat chimeric antibody treatment group. The CPV challenge group and the canine-rat chimeric antibody treatment group were orally challenged with 1×10 5 TCID 50 of CPV-2c, and the blank control group was orally administered an equal amount of PBS.

[0074] 2. Canine-rat chimeric antibody treatment protocol

[0075] The canine-rat chimeric antibody treatment group was treated by intramuscular injection (1 mg / kg) after symptoms appeared after challenge, and the treatment continued for five consecutive days. The blank control group and the challenge group were not treated. The animals were continuously observed for 21 days after challenge to observe the death situation.

[0076] The results showed that all the animals in the challenge control group (abbreviated as CPV in the figure) died on days 7-9 after challenge; one dog in the canine-rat chimeric antibody treatment group (abbreviated as CPV+CM-5E7 in the figure) died on day 9 after challenge, and the other dogs all survived; all the dogs in the blank control group (abbreviated as Control in the figure) survived, and the results are as Figure 6 shown.

Claims

1. An anti-parvovirus canine-mouse chimeric antibody comprising a heavy chain variable region, a light chain variable region, a heavy chain constant region and a light chain constant region, characterized in that: The heavy chain variable region and light chain variable region are mouse-derived fragments, and the heavy chain constant region and light chain constant region are canine-derived fragments; the amino acid sequence of the heavy chain variable region is shown in SEQ ID No.2, and the amino acid sequence of the light chain variable region is shown in SEQ ID No.

4.

2. The chimeric antibody according to claim 1, characterized in that The heavy chain constant region is of IgG2 type, and the light chain constant region is of Kappa type.

3. The chimeric antibody according to claim 2, characterized in that The amino acid sequence of the heavy chain constant region is shown in SEQ ID No.6, and the amino acid sequence of the light chain constant region is shown in SEQ ID No.

8.

4. Use of the chimeric antibody according to any one of claims 1 to 3 in the preparation of a medicament for preventing or treating canine parvovirus.

5. A DNA fragment encoding the chimeric antibody according to any one of claims 1 to 3.

6. The DNA fragment according to claim 5, characterized in that The DNA fragment includes a heavy chain encoding gene and a light chain encoding gene, the nucleotide sequence of the heavy chain encoding gene is shown as SEQ ID No.9, and the nucleotide sequence of the light chain encoding gene is shown as SEQ ID No.

11.

7. An expression vector containing the nucleotide sequence shown in SEQ ID No.9 or SEQ ID No.

11.

8. A host cell containing the DNA fragment according to claim 6 or the expression vector according to claim 7.

Images