CAR donor plasmid, T cell as well as preparation method and application of CAR donor plasmid and T cell

Abstract

The invention discloses a CAR donor plasmid, a T cell as well as a preparation method and application of the CAR donor plasmid and the T cell, and belongs to the field of genetic engineering and immune cell therapy. An RNP compound and donor plasmid DNA are transferred into a T cell through electroporation, and a CAR expression unit is integrated into a T cell genome at a fixed point to prepare the CAR T cell. The donor plasmid DNA comprises a plasmid skeleton, a homologous arm sequence, an EF1 alpha core promoter, a CAR expression element and an SV40 poly A termination signal. The number of base pairs of the plasmid is 4544 bp, the toxicity of the plasmid to T cells after electroporation can be effectively reduced, and the T cell viability and the CAR integration efficiency are improved. Compared with dsDNA and ssDNA, the plasmid DNA is convenient to prepare and low in cost; therefore, the plasmid is taken as the donor template DNA, and the CRISPR / Cas9 technology is combined, so that the use of a virus vector can be avoided to improve the safety of the CAR T cell, and the production cost of the preparation of the CAR T cell can be effectively reduced.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and immunocyte therapy, and particularly relates to a CAR donor plasmid, a T cell, and a preparation method and application thereof. Background Art

[0002] CAR T is to genetically engineer the patient's T cells to make the T cells express a chimeric antigen receptor CAR. CAR is an artificial fusion protein that can target specific antigens, mainly including a recognition domain, a hinge region, a transmembrane domain, and an intracellular signal activation domain (Golubovskaya and Wu 2016). The extracellular recognition domain is a single-chain antibody that can specifically recognize and bind to tumor antigens, helping T cells directly recognize antigen molecules on the tumor cell membrane. After recognizing tumor cells, the intracellular signaling pathway of CAR T cells is activated, prompting T cells to secrete relevant cytokines to lyse or apoptose target cells, thereby achieving the purpose of clearing tumor cells. Therefore, the CAR molecule endows T cells with both the specific affinity of antigen-antibody and the tumor-killing effect.

[0003] The CAR T immunocyte therapy is to induce and activate the patient's own somatic cells, without the toxic and side effects of radiotherapy and chemotherapy, and there will be no drug resistance. The key step is to efficiently and rapidly prepare CAR T cells. Among them, using viral vectors to prepare CAR T is a relatively mature and efficient method. However, viruses have the characteristic of random integration, which may interfere with the expression of normal genes and increase the risk of tumorigenesis. Moreover, the preparation process is relatively complex and requires amplification to obtain a certain concentration of virus to infect T cells. In addition, viruses have a certain immunogenicity, which will activate the immune response of T cells and affect the efficacy of CAR T. Therefore, the CAR T preparation method based on viral vectors has certain limitations in basic research and clinical applications.

[0004] The CRISPR / Cas9 gene editing technology is precise, efficient, and flexible, and has been widely used in the field of tumor immunocyte therapy. The ribonucleoprotein (RNP) complex composed of Cas9 protein and single-guide RNA (sgRNA), and donor DNA enter immune cells through electroporation to perform gene editing on the immune cell genome. The donor DNA has three forms: dsDNA, ssDNA, and plasmid DNA. Among them, ssDNA has less toxicity to cells and higher knock-in efficiency, and the CAR positive rate can reach 30% (Shy, Vykunta et al. 2022; An, Zhang et al. 2024). However, the preparation of ssDNA templates is difficult and the cost is high. Similarly, the synthesis cost of dsDNA is also relatively high, which is not suitable for large-scale production under GMP conditions. The preparation of plasmid DNA is relatively convenient and suitable for GMP production. However, due to the complex structure and large molecular weight of conventional plasmids, they have relatively high toxicity to T cells. According to literature reports, after co-electroporating the RNP complex and plasmid into T cells, the cell viability is less than 20%, and the CAR positive cell rate is only about 10%, making it difficult to obtain a sufficient number of CAR positive cells after electroporation (Jing, Jiao et al. 2021, Zhang, Hu et al. 2022, An, Zhang et al. 2024). Some studies have shown that small plasmid vectors can reduce the toxicity of T cells and improve the efficiency of gene knock-in (Oh, Senger et al. 2022). Summary of the Invention

[0005] Aiming at the problems of low T cell viability and low integration efficiency after co-electroporating RNP and plasmid DNA into T cells in the prior art, the purpose of the present invention is to provide a CAR donor plasmid, T cells, and their preparation methods and applications.

[0006] To achieve the above object, the technical solutions adopted by the present invention are as follows:

[0007] A CAR donor plasmid, comprising: the donor plasmid is a circular plasmid, containing a plasmid backbone, a homologous arm sequence, an EF1α core promoter, a CAR expression element, and an SV40 poly A termination signal.

[0008] Furthermore, the homologous arm sequence is the homologous arm sequence of the safe harbor gene locus AAVS1, and the CAR expression element is any CAR expression element.

[0009] Furthermore, the homologous arm sequence is the homologous arm sequence of the safe harbor gene locus AAVS1, and the CAR expression element is a chimeric antigen receptor expression element against HER2; the CAR donor plasmid can be used as donor DNA to knock the chimeric antigen receptor expression element against HER2 into the AAVS1 locus of the T cell genome.

[0010] Furthermore, the full length of the plasmid is 4544 bp. The EF1α promoter contained in the plasmid is the sequence of the core functional region of the promoter, with a length of 256 bp. The nucleic acid sequence of the core region of the EF1α promoter is shown in SEQ ID NO.2.

[0011] The present invention also provides a CAR T cell, which contains the above-mentioned donor plasmid; the CAR T cell has obvious killing activity against the target tumor cell SKOV-3 with positive HER2 expression, and can significantly secrete cytokines IFN-γ and IL-2.

[0012] Furthermore, the CAR expression element against HER2 is knocked into the AAVS1 locus of the genome of the CAR T cell.

[0013] The present invention also provides a method for preparing the CAR T cell, comprising the following steps:

[0014] Construct and extract the CAR donor plasmid;

[0015] Resuscitate, activate and culture PBMC cells to obtain amplified T cells;

[0016] Transfer 0.5 - 4 μg of the CAR donor plasmid and the RNP complex into T cells by electroporation, and obtain the CAR T cell through homologous recombination repair.

[0017] The present invention also provides an application of the CAR donor plasmid in the preparation of CAR T cells.

[0018] The present invention also provides an application of the CAR T cell in anti-tumor treatment.

[0019] The present invention has the following beneficial effects: By co-electroporating the donor plasmid and the RNP complex into T cells, the present invention can achieve site-specific integration of CAR T cells, and the number of CAR T cells can meet the application requirements. Its advantages lie in avoiding the use of viral vectors, simplifying the preparation process of CAR T cells, and improving the safety of CAR T cells. At the same time, avoiding the use of dsDNA and ssDNA as donor DNA gives full play to the advantage of low plasmid preparation cost and reduces the preparation cost of CAR T cells. In addition, the donor plasmid vector constructed in the present invention is relatively small, which can effectively reduce the toxicity of the plasmid to cells, thereby improving the survival rate of T cells and the integration efficiency of CAR to meet the application requirements. Therefore, the preparation method of CAT T cells and the donor plasmid provided by the present invention can effectively improve the safety of CAR T cells and reduce the preparation cost of CAR T cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0021] Figure 1 It is a schematic structural diagram of the donor plasmid AAVS1-HER2-pCE3 in the present invention;

[0022] Figure 2 It is a schematic diagram of site-specific integration of CRISPR / Cas9 and donor plasmid DNA into CAR T by homologous recombination in the present invention;

[0023] Figure 3 It is a schematic diagram showing the effects of electroporation of different doses of plasmid on the survival rate and knock-in efficiency of CAR T cells in Example 2 of the present invention; among them, a is the cell number statistical chart, b is the cell doubling number statistical chart, c is the live cell percentage growth statistical chart, d is an example electrophoresis diagram of PCR amplification of genomic integration sites, e is an example diagram of detecting CAR expression by flow cytometry, and f is the CAR positive cell number statistical chart; ns indicates no significant difference, * indicates significant difference and p < 0.05, ** indicates significant difference and p < 0.01;

[0024] Figure 4 It is the result diagram of the tumor cell killing experiment of CAR T cells in Example 3 of the present invention; ** indicates significant difference and p < 0.01, and the dotted line indicates that the cell killing efficiency is 0;

[0025] Figure 5It is a detection chart of cytokine secretion levels after co - culturing CAR T cells and tumor cells in Example 4 of the present invention; among them, a is the detection statistical chart of interferon - γ in the cell culture medium, and b is the detection statistical chart of interleukin - 2 in the cell culture medium; *** indicates a significant difference and p < 0.001. Detailed implementation manners

[0026] Here, the exemplary embodiments will be described in detail, and the examples are shown in the accompanying drawings. When the following description refers to the drawings, unless otherwise indicated, the same numbers in different drawings represent the same or similar elements. The implementation manners described in the following exemplary embodiments do not represent all implementation manners consistent with the present invention. On the contrary, they are merely examples of devices and methods consistent with some aspects of the present invention as detailed in the appended claims.

[0027] The terms used in the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The singular forms "a", "the", and "said" used in the present invention and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise. It should also be understood that the term "and / or" used herein refers to and includes any or all possible combinations of one or more of the associated listed items.

[0028] It should be noted that, without conflict, the features in the following embodiments and implementation manners can be combined with each other.

[0029] Example 1: Design, construction and identification of AAVS1 - HER2 - pCE3 plasmid

[0030] In this example, a CAR expression plasmid targeting the HER2 antigen was designed and constructed by knocking it into the AAVS1 locus, and its structure is shown in detail in Figure 1 . This plasmid uses the pCE3 plasmid (Novoprotein, product number C603 - 01) as the backbone, and successively connects the 5' - end homologous arm sequence (SEQ ID NO.1) of the AAVS1 locus, the EF1α core promoter (SEQ ID NO.2), the CAR expression element against HER2 (SEQ ID NO.3, purchased from Annobio Biopharmaceutical Technology Co., Ltd.), the SV40 poly A termination signal (SEQ ID NO.4), and the 3' - end homologous arm sequence (SEQ ID NO.5) of the AAVS1 locus.

[0031] Use a seamless cloning kit to construct the AAVS1 - HER2 - pCE3 plasmid. The specific steps are as follows:

[0032] (1) Perform PCR amplification using DNA polymerase to linearize the pCE3 backbone. The reaction system and reaction program are carried out according to the instruction manual of the DNA polymerase. The amplification primers are as follows:

[0033] pCE3-F: GCAACACAGCGAATTCGCGGCCGCTAAATTC (SEQ ID NO.6);

[0034] pCE3-R: GACCTGCCCGGAATTCGTTTAAACCTGCAG (SEQ ID NO.7).

[0035] (2) Perform PCR amplification using DNA polymerase to obtain the following 5 insertion fragments: the 5' homologous arm sequence of the AAVS1 site, the EF1α core promoter, the CAR expression element against HER2, the SV40 poly A termination signal, and the 3' homologous arm sequence of the AAVS1 site. The reaction system and reaction program are carried out according to the instruction manual of the DNA polymerase. The primer information is as follows:

[0036] Amplification primers for the 5' homologous arm of the AAVS1 site:

[0037] 5HA-F: CCGCGAATTCGCTGTGTTGCTGCCCAAGGA (SEQ ID NO.8);

[0038] 5HA-R: ACGCATGCTCGAGAGGTAAGGGGGGTAGGG (SEQ ID NO.9).

[0039] Amplification primers for the EF1α core promoter:

[0040] EF1α-F: CTTACCTCTCGAGCATGCGTGAGGCTCCGG (SEQ ID NO.10);

[0041] EF1α-R: GGTGGCGGCGAATTCGAAACACGGCACTTACCTGTGTTC (SEQ ID NO.11).

[0042] Amplification primers for the CAR expression element against HER2:

[0043] anti-HER2-F: TTCGAATTCGCCGCCACCATGGCCCTCCCTGTCACCGC (SEQ ID NO.12);

[0044] anti-HER2-R: GCTCAAGCTTTCACCGAGGCGGCAGGGCCT (SEQ ID NO.13).

[0045] SV40 poly A termination signal amplification primer:

[0046] SV40-F: CTCGGTGAAAGCTTGAGCTCGATGAGTT (SEQ ID NO.14);

[0047] SV40-R: GCACAGACTAAACTTGTTTATTGCAGCTTA (SEQ ID NO.15).

[0048] 3' homologous arm sequence of AAVS1 locus:

[0049] 3HA-F: TAAACAAGTTTAGTCTGTGCTAGCTCTTCCAG (SEQ ID NO.16);

[0050] 3HA-R: AATTCCGGGCAGGTCACGCATCCC (SEQ ID NO.17).

[0051] (3) Perform 1% agarose gel electrophoresis on the linearized pCE3 and the PCR products of the 5 inserted fragments respectively, cut the gel to recover the target fragments, and measure the nucleic acid concentration of each fragment.

[0052] (4) Add the linearized pCE3 to a 1.5 mL Ep tube, add the 5 inserted DNA fragments, and then add seamless cloning reagent. Incubate at 50 °C for 15 - 60 min to promote the ligation of the above 5 inserted fragments to the pCE3 vector.

[0053] (5) Add the ligation product to Top10 competent cells for heat shock transformation, and use the universal primer M13 for colony PCR detection and sequencing identification the next day.

[0054] (6) Expand the culture of the strain with correct sequencing, extract the AAVS1-HER2-pCE3 plasmid using an endotoxin-free plasmid large extraction kit, measure the plasmid concentration for standby.

[0055] Example 2: Preparation of CAR T cells based on RNP and plasmid electroporation

[0056] In this example, the Lonza 4D-Nucleofector electroporation device and the P3 Primary Cell 4D-Nucleofector electroporation kit were used to co-electroporate RNP and AAVS1-HER2-pCE3 plasmid DNA into T cells. The CAR expression element against HER2 was integrated into the AAVS1 locus by homologous recombination (as shown in Figure 2 ), and the tolerance of T cells to different doses of plasmid electroporation was tested. The specific steps are as follows:

[0057] (1) The isolated or resuscitated human PBMC cells were cultured in X-VIVO15 culture medium containing IL-2. CD3 / CD28 Dynabeads were added to the suspended cells for activation. After 2-3 days, the magnetic beads were removed, and T cells could be harvested.

[0058] (2) Prepare the electroporation buffer: Mix 82 μL of P3 Primary Cell Nucleofector Solution and 18 μL of Supplement in a 1-1.5 mL EP tube. 20 μL of electroporation solution is required for each electroporation treatment.

[0059] (3) Take a 1.5 mL Ep tube and add Cas9 and AAVS1 sgRNA: AGAGCTAGCACAGACTAGAG (SEQ ID NO.18) at a ratio of 1:2 - 1:3 respectively, mix well, incubate at room temperature for 10 min, and then add 0.5 μg, 1 μg, 2 μg, and 4 μg of AAVS1-HER2-pCE3 plasmid respectively and mix well.

[0060] (4) Take 1 - 5×10 6 T cells, centrifuge, discard the culture medium, and resuspend the cells with 100 μL of electroporation buffer.

[0061] (5) Take 20 μL of T cells suspended in the electroporation buffer into the electroporation cuvette as the Mock treatment. Take 20 μL of T cells suspended in the electroporation buffer and add them to the Ep tube containing the RNP and plasmid mixture, mix well and transfer to the electroporation cuvette.

[0062] (6) Use the Lonza 4D-Nucleofector electroporation device, select the P3 buffer and the EO115 program for electroporation.

[0063] (7) Add X-VIVO15 culture medium to the electroporated electroporation cuvette, and then transfer the electroporated T cells to a multi-well cell culture plate containing X-VIVO15 culture medium, and culture in an incubator at 37°C and 5% CO 2 .

[0064] (8)The results are shown in Figures a - c of Figure 3 . When the initial number of cells in each treatment is 1×10 6 cells, after electroporating 0.5 μg of AAVS1 - HER2 - pCE3 plasmid, the number of viable cells can reach 6.4×10 6 cells after 6 days, and the cell viability is 76.7%; after electroporating 1 μg of AAVS1 - HER2 - pCE3 plasmid, the number of viable cells can reach 4.6×10 6 cells after 6 days, and the cell viability is 71.0%; after electroporating 2 μg of AAVS1 - HER2 - pCE3 plasmid, the number of viable cells can reach 3.5×10 6 cells after 6 days, and the cell viability is 70.2%; after electroporating 4 μg of AAVS1 - HER2 - pCE3 plasmid, the number of viable cells can reach 1.7×10 6 cells after 6 days, and the cell viability is 51.5%.

[0065] (9)On the 5th - 7th day after electroporation, genomic DNA was extracted from T cells treated with Mock and electroporated with different doses of plasmid, and PCR amplification was performed to identify whether the anti - HER2 CAR element was knocked into the AAVS1 locus of the genome. The primer sequences are as follows:

[0066] AAVS1 - F: AGAAAGGTGAAGAGCCAAAGTTAG (SEQ ID NO.19);

[0067] AAVS1 - R: GGAACTCTGCCCTCTAACGCTG (SEQ ID NO.20).

[0068] The results of agarose gel electrophoresis showed that the inserted CAR fragments could be detected in the treatments of electroporating 1 μg, 2 μg, and 4 μg of AAVS1 - HER2 - pCE3 plasmid, and the CAR fragment bands in the treatments of electroporating 2 μg and 4 μg were darker, as shown in Figure 3 Figure d of

[0069] (10)On the 5th - 7th day after electroporation, flow cytometry analysis was performed on T cells treated with Mock and electroporated with different doses of plasmid to detect the CAR positive rate. The results showed that after electroporating 2 μg of AAVS1 - HER2 - pCE3 plasmid, the CAR positive rate was relatively high, up to 36.1%, as shown in Figure 3 Figure e of . According to the data of the number of viable cells and the CAR positive rate after electroporation, it can be seen that more CAR - positive cells were obtained by electroporating 2 μg of AAVS1 - HER2 - pCE3 plasmid, approximately 1.2×10 6 CAR - positive cells, and the number of positive cells was significantly higher than that in the treatments of electroporating 0.5 μg, 1 μg, and 4 μg of plasmid, as shown in Figure 3 Figure f of

[0070] Example 3: Determination of the in vitro killing activity of CAR T cells constructed based on RNP and plasmid against tumor cells

[0071] In this example, luciferase-labeled SKOV-3 was used as the target cell, and the CAR T cells obtained after electroporating RNP and AAVS1-HER2-pCE3 plasmid were tested for killing experiments. The specific steps are as follows:

[0072] (1) Seed SKOV-3 cells into a T25 culture flask 1 day in advance.

[0073] (2) The next day, use the jetPRIME transfection reagent to transfect 3 μg of pGL6-CMV-Luc plasmid into the SKOV-3 cells seeded 1 day in advance.

[0074] (3) 2 days after transfection, digest the SKOV-3 cells, resuspend the SKOV-3 cells with the medium, adjust the cell concentration to 4×10 5 cells / mL, and take 50 μL and add it to a 96-well plate with a black transparent bottom.

[0075] (4) Prepare Mock-treated T cells and CAR T cells obtained after electroporating 1 μg and 2 μg of AAVS1-HER2-pCE3 plasmid. Seed the T cells treated above at the ratios of effector cell:target cell of 1:9, 1:3, 1:1, and 3:1, and supplement the final volume to 100 μL / well with the medium. At the same time, perform the following control treatments: Only seed the SKOV-3 cells transfected with pGL6-CMV-Luc plasmid, and the treatment without seeding T cells is used as the fluorescence intensity positive control group; Seed the SKOV-3 cells transfected with pGL6-CMV-Luc plasmid and add 2% Tween-20 as the fluorescence intensity negative control; Do not seed cells, and only add 100 μL of X-VIVO15 culture medium for the blank group for subsequent enzyme activity detection. Each treatment has 3 replicates.

[0076] (5) Place the above-prepared SKOV-3 tumor cells and T cells in an incubator at 37°C and 5% CO 2 for a total of 16 h.

[0077] (6) After the co-culture ends, take out the 96-well plate containing the cells to be tested.

[0078] (7) According to the kit instructions, use an enzyme-labeled instrument to perform chemiluminescence detection of the luciferase intensity, and set the detection time for each well to 1 sec.

[0079] (8) Calculate the killing efficiency of T cells. The calculation formula is: [ (fluorescence intensity of positive control - fluorescence intensity of negative control) - (fluorescence intensity of experimental group - fluorescence intensity of negative control) ] / (fluorescence intensity of positive control - fluorescence intensity of negative control) × 100%.

[0080] The results are as Figure 4 shown. The CAR T cells obtained after electroporating 1 μg and 2 μg of AAVS1-HER2-pCE3 plasmid had significant killing activity against SKOV-3, and the killing activity of the CAR T cells obtained after electroporating 2 μg of plasmid was significantly higher than that of the treatment with 1 μg of plasmid. When the effector cell:target cell ratio was 1:1, the killing efficiencies of the CAR T cells obtained after electroporating 1 μg and 2 μg of AAVS1-HER2-pCE3 plasmid against SKOV-3 were 43.8% and 71.7% respectively; when the effector cell:target cell ratio was 3:1, the killing efficiencies of the CAR T cells obtained after electroporating 1 μg and 2 μg of AAVS1-HER2-pCE3 plasmid against SKOV-3 were 69.5% and 92.6% respectively.

[0081] Example 4: Detection of CAR T cell factors constructed based on RNP and plasmid electroporation

[0082] In this example, the Mock-treated T cells and the CAR T cells obtained after electroporating 1 μg and 2 μg of AAVS1-HER2-pCE3 plasmid were co-cultured with SKOV-3 cells respectively, and all were inoculated at a ratio of effector cell:target cell of 1:1. After co-culturing for 16 h, centrifuge at 400 g for 10 min, and take the supernatant culture solution for measuring the concentrations of cytokines IFN-γ and IL-2. The concentrations of IFN-γ and IL-2 were measured by ELISA method. The specific kits were: ELISA MAX™ Deluxe Set Human IFN-γ (BioLegend) and ELISA MAX™ Deluxe Set Human IL-2 (BioLegend). The culture supernatant was diluted by an appropriate multiple for measuring the concentration of cytokines, and the specific operation steps were carried out according to the ELISA kit instructions.

[0083] The results showed that after co-culturing the CAR T cells obtained after electroporating 1 μg and 2 μg of AAVS1-HER2-pCE3 plasmid with SKOV-3, the secretion levels of IFN-γ and IL-2 increased significantly, and the ability of the CAR T cells obtained after electroporating 2 μg of plasmid to secrete IFN-γ and IL-2 was significantly higher than that of the treatment with 1 μg of plasmid, as Figure 5 shown in Figure a and Figure b.

[0084] The present invention improves the problems of low T cell viability and low integration efficiency after co-electroporating RNP and plasmid DNA into T cells in the prior art. In the present invention, a small plasmid backbone is used as a plasmid replication framework to amplify the plasmid, a homologous arm sequence is used as a homologous recombination donor sequence for genome-directed integration, an EF1α core promoter is used as a promoter for highly stable expression of the CAR element, the CAR expression element expresses a targeting recognition of a tumor cell surface antigen, activates T cells to exert an immune effect, and an SV40 poly A termination signal induces normal cleavage and polyadenylation of mRNA to ensure normal termination of transcription. The above functional units constitute an essential structure for a plasmid for preparing CRISPR / Cas9 non-viral site-directed integration CAR T cells.

[0085] Other embodiments of the present application will be readily apparent to those skilled in the art upon consideration of the specification and practice of the disclosure herein. The present application is intended to cover any variations, uses, or adaptations of the present application, which follow the general principles of the present application and include known common general knowledge or conventional technical means in the technical field not disclosed in the present application. The specification and examples are only to be considered as exemplary.

[0086] It should be understood that the present application is not limited to the exact structures described above and shown in the drawings, and various modifications and changes can be made without departing from its scope.

Claims

1. A CAR donor plasmid, characterized in that: include: The donor plasmid is a circular plasmid comprising a plasmid backbone, a homology arm sequence, an EF1α core promoter, a CAR expression element and an SV40 poly A termination signal.

2. The CAR donor plasmid according to claim 1, characterized in that The homology arm sequence is the homology arm sequence of the safe harbor gene site AAVS1, and the CAR expression element is any CAR expression element.

3. The CAR donor plasmid according to claim 1, characterized in that The homology arm sequence is the homology arm sequence of the safe harbor gene site AAVS1, and the CAR expression element is an anti-HER2 chimeric antigen receptor expression element.

4. The CAR donor plasmid according to claim 1, characterized in that The full length of the plasmid is 4544 bp, and the EF1α promoter contained in the plasmid is the sequence of the core functional region of the promoter, with a length of 256 bp.

5. A CAR T cell, characterized in that: The CAR T cell contains the CAR donor plasmid described in any one of claims 1-4.

6. The CAR T cell according to claim 5, characterized in that The CAR T cells have an anti-HER2 CAR expression element knocked into the AAVS1 site of the genome.

7. A method for preparing CAR T cells according to claim 5, characterized in that: The following steps are involved: Construction and extraction of CAR donor plasmid; Resuscitate, activate and culture PBMC cells to obtain expanded T cells; 0.5-4 μg of the CAR donor plasmid and RNP complex are transferred into T cells by electroporation, and the CAR T cells are obtained after homologous recombination repair.

8. A use of the CAR donor plasmid according to any one of claims 1 to 4 in the preparation of CAR T cells.

9. A use of the CAR T cells according to claim 5 in anti-tumor treatment.

Images