Application of nucleotide analogue in preparation of medicine for preventing and / or treating diseases caused by bovine nodular skin disease virus

Abstract

The invention belongs to the technical field of veterinary drugs, and particularly relates to novel application of monomeric compounds, in particular to application of nucleotide analogues in preparation of drugs for preventing and / or treating diseases caused by bovine nodular skin disease viruses. Iodine glycoside, non-auridine, cytarabine and vidarabine are all monomeric compounds and belong to nucleotide analogues. It is found for the first time that iodoglycoside, non-aurine glycoside, cytarabine and vidarabine can inhibit bovine nodular skin disease virus replication in a safe concentration range in a dose-dependent mode. The iodoglycoside, the non-aurine glycoside, the cytarabine and the vidarabine have low cytotoxicity, can efficiently inhibit the bovine nodular dermatosis virus, and have a good application prospect in the aspect of preventing or treating the bovine nodular dermatosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of veterinary drugs. Specifically, it relates to new uses of a class of monomeric compounds, and particularly to the application of nucleotide analogs in the preparation of drugs for preventing and / or treating diseases caused by lumpy skin disease virus of cattle. Background Art

[0002] Lumpy skin disease (LSD) is a subacute to acute infectious disease characterized by nodular lesions on the skin of cattle, caused by lumpy skin disease virus (LSDV). LSDV belongs to the family Poxviridae ), genus Capripoxvirus ( Capripoxvirus ). After cattle are infected with LSDV, the mortality rate is about 10% and the morbidity rate is about 90%. The diseased cattle show symptoms such as fever, weight loss, decreased milk production, and nodules all over the body, which seriously restricts the economic benefits brought by cattle farming. The existing technologies mainly adopt the strategies and measures of combining emergency immunization with attenuated vaccines and isolation and culling for the prevention and control of LSD. Although the current vaccination has a good protective effect, clinical results show that there are certain side reactions in the inoculation of attenuated vaccines, and more and more studies have proved that there is a risk of strain recombination in the use of live attenuated vaccines. Currently, there is no effective drug available for the treatment of LSDV. In the case of defects in vaccine immunity, there is an urgent need to develop effective drugs for preventing or treating LSD as a technical reserve. Summary of the Invention

[0003] In view of the deficiencies of the prior art, the present invention provides the application of nucleotide analogs in the preparation of drugs for preventing and / or treating diseases caused by lumpy skin disease virus of cattle, thus promising to bring a new antiviral drug for the prevention and treatment of LSD.

[0004] The technical solution provided by the present invention is as follows:

[0005] The present invention provides the application of nucleotide analogs in the preparation of drugs for preventing and / or treating diseases caused by lumpy skin disease virus of cattle, and the nucleotide analogs are selected from any one or more of idoxuridine, non-adenine arabinoside, cytarabine, and vidarabine.

[0006] Further, the disease caused by lumpy skin disease virus of cattle is lumpy skin disease of cattle caused by lumpy skin disease virus.

[0007] Further, the drug uses any one or more of idoxuridine, non-adenine arabinoside, cytarabine, and vidarabine as active ingredients.

[0008] Furthermore, the concentration of idoxuridine used in the drug is 20 μM, the concentration of non-ara-uridine used is 5 μM, the concentration of cytarabine used is 0.5 μM, and the concentration of vidarabine used is 20 μM.

[0009] Furthermore, the drug is a drug for inhibiting the replication stage of lumpy skin disease virus.

[0010] The present invention also provides the application of nucleotide analogs in any one of the following (1)-(3): (1) Preparing a drug for preventing and / or treating lumpy skin disease virus infection; (2) Preparing an inhibitor of lumpy skin disease virus; (3) Preparing a drug for inhibiting the proliferation of lumpy skin disease virus; The nucleotide analogs are selected from any one or more of idoxuridine, non-ara-uridine, cytarabine, and vidarabine.

[0011] The present invention also provides a drug for treating lumpy skin disease, and the drug takes the nucleotide analogs in an effective amount as described above as the active ingredient.

[0012] Furthermore, the drug further comprises one or more pharmaceutically acceptable carriers.

[0013] Furthermore, the pharmaceutically acceptable carriers include: excipients, fillers, binders, wetting agents, disintegrants, diluents, and / or surfactants.

[0014] Furthermore, the dosage form of the drug is any one or more of tablets, capsules, oral liquids, granules, pills, or injections.

[0015] Beneficial effects

[0016] The present invention for the first time discovers that idoxuridine, non-ara-uridine, cytarabine, and vidarabine can inhibit the proliferation of lumpy skin disease virus and can be used to treat diseases caused by lumpy skin disease virus infection. In the MDBK cell line and the Vero cell line, the selectivity index (SI) of idoxuridine as an LSDV drug is greater than 62.11 and 7.89 respectively; the SI of non-ara-uridine as an LSDV drug is greater than 303.03 and 31.55 respectively; the SI of cytarabine as an LSDV drug is greater than 714.29 and 2000 respectively; the SI of vidarabine as an LSDV drug is greater than 30.12 and 14.71 respectively; this shows that idoxuridine, non-ara-uridine, cytarabine, and vidarabine have a large safety range in inhibiting LSDV proliferation. Therefore, idoxuridine, non-ara-uridine, cytarabine, and vidarabine have good prospects in the preparation of anti-lumpy skin disease virus drugs. Description of the drawings

[0017] Figure 1 It is a schematic diagram of the chemical structure of the compound;

[0018] Figure 2 It is the activity curve and cytotoxicity curve of the compound inhibiting the proliferation of LSDV in MDBK;

[0019] Figure 3 It is the activity curve and cytotoxicity curve of the compound inhibiting the proliferation of LSDV in Vero;

[0020] Figure 4 It is the fluorescence images of different concentrations of the compound inhibiting the proliferation of rLSDV in MDBK;

[0021] Figure 5 It is the fluorescence images of different concentrations of the compound inhibiting the proliferation of rLSDV in Vero;

[0022] Figure 6 It is to detect the inhibitory effect of the compound on LSDV by TCID 50 (Note: Idoxuridine 20 μM, Fialuridine 5 μM, Cytarabine 0.5 μM, and Vidarabine 20 μM);

[0023] Figure 7 It is to detect the inhibitory effect of the compound on LSDV by qPCR (Note: Idoxuridine 20 μM, Fialuridine 5 μM, Cytarabine 0.5 μM, and Vidarabine 20 μM);

[0024] Figure 8 It is to detect the inhibitory effect of the compound on LSDV with different MOIs by Western blot (Note: Idoxuridine 20 μM, Fialuridine 5 μM, Cytarabine 0.5 μM, and Vidarabine 20 μM);

[0025] Figure 9 It is the schematic diagram of the experimental design of Time of addition;

[0026] Figure 10 It is to detect the inhibitory effect of the compound labeled with mCherry on rLSDV at different stages (Note: Idoxuridine 20 μM, Fialuridine 5 μM, Cytarabine 0.5 μM, and Vidarabine 20 μM);

[0027] Figure 11 It is to detect the inhibitory effect of the compound on rLSDV at different stages by Luciferase (Note: Idoxuridine 20 μM, Fialuridine 5 μM, Cytarabine 0.5 μM, and Vidarabine 20 μM);

[0028] Figure 12The compound inhibits LSDV DNA synthesis (Note: Idoxuridine 20 μM, Fialuridine 5 μM, Cytarabine 0.5 μM, and Vidarabine 20 μM). Detailed implementation mode

[0029] The embodiments of the present invention provide the use of nucleotide analogs in the preparation of drugs for preventing and / or treating diseases caused by Lumpy skin disease virus; the nucleotide analogs are selected from any one or more of Idoxuridine, Fialuridine, Cytarabine, and Vidarabine.

[0030] It should be noted that Idoxuridine, Fialuridine, Cytarabine, and Vidarabine are all monomeric compounds and belong to nucleotide analogs. The CAS number of Fialuridine is 69123-98-4, and its chemical formula is C9H10FIN2O5; the CAS number of Idoxuridine is 54-42-2, and its chemical formula is C9H11IN2O5; the CAS number of Cytarabine is 147-94-4, and its chemical formula is C9H13N3O5; the CAS number of Vidarabine is 5536-17-4, and its chemical formula is C10H13N5O4. The chemical structures of the 4 compounds are as Figure 1 shown.

[0031] Example 1

[0032] 1. Experimental materials and methods

[0033] 1.1 Experimental materials

[0034] Idoxuridine, Fialuridine, Cytarabine, and Vidarabine were purchased from MCE Company. RIPA protein lysate was purchased from Yuanye Company. DNA extraction kit, CCK-8 kit, reverse transcription reagent, and SYBR Green Master Mix were purchased from YEASEN Company. β-Tublin mouse monoclonal antibody, HRP-labeled goat anti-rabbit secondary antibody, and HRP-labeled goat anti-mouse secondary antibody were purchased from Yamei Company. Trypsin was purchased from Solarbio Company. LSDV rabbit polyclonal antibody was prepared and stored in our laboratory, and Alexa Fluor™ 594-labeled goat anti-rabbit secondary antibody was purchased from Thermo Fisher Scientific. BeyoClick™ EdU-488 cell proliferation detection kit and BeyoClick™ EU-488 RNA synthesis detection kit were purchased from Beyotime Institute of Biotechnology. MDBK, Vero cell lines, fetal bovine serum, and DMEM were purchased from Nanjing Senbeijia Company. LSDV rabbit polyclonal antibody was prepared and stored in our laboratory. LSDV rabbit polyclonal antibody was prepared and stored in our laboratory, and the preparation method is as follows:

[0035] Mix the LSDV virus with Freund's complete adjuvant at a ratio of 1:1, and use it as an immunogen after emulsification. According to 0.5×106.2 TCID 50 New Zealand white rabbits were immunized subcutaneously at multiple points with the dose of

[0036] The LSDV XJ201901 strain was isolated, identified and preserved by the China Animal Health and Epidemiology Center, and its NCBI GeneBank accession number is OM984485. The specific preparation method of the recombinant rLSDV strain carrying the mCherry and Luciferase expression cassettes is as follows:

[0037] ORF50 and ORF51 of LSDV are two adjacent proteins. According to the literature, inserting foreign genes between the genes encoding these two proteins will not affect the replication of the virus itself. Therefore, we used this region as the insertion position for the mCherry and firefly luciferase reporter gene (Luciferase). First, a donor plasmid carrying mCherry and Luciferase was constructed. When constructing the recombinant virus, the MDBK cell line was infected with the LSDV XJ201901 strain, and 6 h later, the donor plasmid was transfected into the MDBK cell line. At this time, the viral DNA would be recombined by the homologous recombinase in the cell according to the homologous sequence of the donor plasmid, so that the DNA fragment corresponding to the donor plasmid was recombined into the ORF50 and ORF51 gene positions of the viral genome. Then, the recombinant strain emitting red fluorescence was purified through three consecutive rounds of plaque assays, and finally an rLSDV strain expressing both mCherry and Luciferase was obtained for subsequent experiments. The sequence of the donor plasmid is as follows:

[0038]

[0039] 1.2 Drug CC 50 Detection

[0040] Inoculate 2×10 4 MDBK or Vero cell suspension (100 μL / well) in a 96-well plate. Place the culture plate in an incubator for pre-incubation for 24 h (37 °C, 5% CO 2 ). Dilute the drug 3-fold serially with cell maintenance medium to make 8 dilutions (the maximum drug concentration is 100 μΜ). Treat the cells with the diluted drug solutions at each concentration for 72 h, and set up an equal-volume DMSO control group for each concentration. Add 10 μL of CCK-8 solution to each well, avoiding the formation of bubbles. Incubate the culture plate in the incubator for 2 h. Measure the absorbance at 450 nm using a microplate reader. Calculate the cell viability according to the following formula. Among them, cell viability = [OD (drug-treated group) - OD (blank group)] / [OD (control group) - OD (blank group)] × 100%. Experimental group: The OD value of the wells with cells, CCK-8 solution, and drug solution. Blank group: The OD value of the wells with maintenance medium and CCK-8 solution but without cells. Control group: The OD value of the wells with cells, CCK-8 solution, and DMSO solution. Finally, use GraphPad to plot the CC 50 curve of the drug.

[0041] 1.3 Drug IC 50 Detection

[0042] Inoculate 2×10 4 MDBK or Vero cell suspension (100 μL / well) in a 96-well plate. Place the culture plate in an incubator for 20 h. Dilute the drug 3-fold serially with cell maintenance medium to obtain drug dilutions, making a total of 8 dilutions (the maximum drug concentration is 100 μΜ). Take 30 μL of the drug dilution and add rLSDV virus solution with a multiplicity of infection (MOI) of 0.01 (200 TCID 50 , MOI = amount of TCID 50 at virus inoculation / number of cells) to obtain a mixed solution of drug and virus. Then discard the cell culture medium, add 30 μL of the incubated mixed solution of drug and virus, incubate at 37 °C for 2 h, then discard the mixed solution of drug and virus, carefully wash once with PBS, add 200 μL of the drug dilution to the wells, and continue to culture the cells for 72 h. At the same time, set up an equal-volume DMSO control group and an untreated blank group. Record the luminescence of the cells under a fluorescence microscope, then aspirate the cell culture medium, add 100 μL of cell lysis buffer to each well, and incubate on ice for 5 min to fully lyse the cells.

[0043] Take 20 μL of the lysis solution and add it to a black microplate. Dilute the firefly luciferase luciferin substrate (50×) and the Renilla luciferase luciferin substrate (50×) to 1× working solution with the corresponding buffer respectively, and incubate to room temperature. Add 100 μL of the firefly luciferase reaction solution to each well, shake the plate to mix evenly, and immediately detect the activity of firefly luciferase (completed within 30 min). Calculate the data according to the following formula: Inhibition rate = 1 - (experimental group value / control group value) × 100%. Among them, blank group: untreated cells of the same batch as the experimental group. Experimental group: cells treated with the mixed solution of the drug and the virus. Control group: cells treated with the mixed solution of DMSO and the virus. Experimental group value = experimental group reading - blank group reading. Control group value = control group reading - blank group reading. Finally, use GraphPad to plot the IC 50 curve.

[0044] 1.4 Western blot experiment

[0045] Inoculate 1×10 5 MDBK or Vero cell suspension (500 μL / well) in a 24-well plate. Place the culture plate in an incubator and culture for 20 h. Then discard the cell culture medium and add 200 μL containing 0.01 MOI (1000 TCID 50 ), and 0.1 MOI (10000 TCID 50)The maintenance fluid of LSDV and the drug was incubated at 37 °C for 2 h, then the liquid was completely discarded, and the cells were carefully washed once with PBS. 1000 μL of the maintenance fluid containing the drug was added to the wells, and the cells were cultured for another 72 h. Discard the cell culture medium in the culture dish, wash the cells twice with pre-cooled 1×PBS, add RIPA lysis buffer, and lyse the cells on ice for 10 min. Transfer the lysed mixture to a 1.5 mL EP tube and centrifuge at 12000 g at 4 °C for 10 min. Take 80 μL of the supernatant, add 20 μL of 5×Loading Buffer, mix well, heat at 95 °C for 5 min, and centrifuge briefly before loading for detection. Add an equal volume of the sample to be tested to the PAGE gel and perform SDS-PAGE electrophoresis under the condition of a constant voltage of 80 V. When the bromophenol blue moves to the bottom of the gel, use a semi-dry transfer apparatus for transfer, and soak the transfer filter paper with pre-cooled transfer buffer. Place them in order from bottom to top: filter paper, NC membrane, gel, and filter paper, and pay attention to removing air bubbles. The procedure is: constant current of 0.3 A, limited voltage of 25 V, and time of 33 min. After completion, block at room temperature with TBST containing 5% skim milk for 2 h. After blocking, wash with TBST at room temperature 3 times, 5 min each time. Add rabbit anti-LSDV polyclonal antibody and mouse anti-β-Tubulin monoclonal antibody and incubate at 4 °C for 12 h. Wash with TBST 3 times, 5 min each time. Add the corresponding HRP-labeled goat anti-rabbit and goat anti-mouse secondary antibodies and incubate at room temperature for 1 h. Wash with TBST 3 times, 5 min each time. Finally, after treatment with ECL luminescent solution, perform exposure in an exposure instrument.

[0046] 1.5 qPCR experiment

[0047] Sample preparation: Inoculate 1×10 5 MDBK cell suspension (500 μL / well) in a 24-well plate. Place the culture plate in an incubator and culture for 20 h. Then discard the cell culture medium, and add 200 μL of the maintenance fluid containing 0.01 MOI (1000 TCID 50 )The maintenance fluid of LSDV and the drug was incubated at 37 °C for 2 h, then the liquid was completely discarded, and the cells were carefully washed once with PBS. 1000 μL of the maintenance fluid containing the drug was added to the wells, and the cells were cultured for another 72 h.

[0048] DNA Extraction: Add 10 μL of Proteinase K to 400 μL of lysis buffer LB, mix well to obtain the DNA lysis buffer. Discard the supernatant of the cell culture medium and wash twice with PBS. Drain all the PBS, add 410 μL of the DNA lysis buffer. Let it stand for 30 s, pipette up and down 20 times, and transfer the cell lysis buffer to a 1.5 mL EP tube. Incubate at 55 °C for 10 min, shake well, and let it stand at room temperature for 5 min. Take out the EP tube and let it cool to room temperature, then gently shake well. Add 300 μL of deproteinization solution PL and 300 μL of binding solution BD in sequence, and shake vigorously. Centrifuge at 12000 rpm for 5 min. The solution separates into layers, the upper layer is the blue extraction layer, the lower layer is the transparent aqueous phase, and there may be a partial precipitation layer between the two layers of solution. The DNA is in the lower aqueous phase. Carefully aspirate the lower solution for column purification. Set the DNA adsorption column T1 into a 2 mL collection tube for standby. Add 200 μL of buffer AC to the DNA adsorption column T1, centrifuge at 12000 rpm for 1 min, and discard the waste liquid. Add the lower solution of the above sample pretreatment to the DNA adsorption column T1, centrifuge at 12000 rpm for 1 min, and discard the waste liquid. Put the DNA adsorption column T1 back into the collection tube, add 500 μL of wash solution W (add absolute ethanol according to the instruction manual before use), centrifuge at 12000 rpm for 30 s, and discard the waste liquid. Repeat the washing once with wash solution W. Put the DNA adsorption column T1 back into the collection tube, centrifuge the empty column at 12000 rpm at room temperature for 2 min to remove the residual wash solution W. Put the DNA adsorption column T1 into a new 1.5 mL centrifuge tube, add 25 μL of elution buffer preheated at 65 °C in the center of the adsorption column, and let it stand at room temperature for 2 min. Then centrifuge at 12000 rpm for 1 min. Collect the filtrate. Add another 25 μL of new elution buffer preheated at 65 °C and repeat the elution once to obtain about 50 μL of DNA solution in total. After measuring the concentration and quality of the DNA solution using Nano drop, store it at -20 °C for standby. Design the primer sequences for LSDV ORF72: F: AGGGTGATGGGAAGGGTGTT, R: ACTTGCCCGTATCCATCCAC, prepare the qPCR reaction system according to the dosage in Table 1, and detect the gene abundance of the sample according to the reaction procedure shown in Table 2.

[0049] Table 1: qPCR System

[0050]

[0051] Table 2: qPCR Program

[0052]

[0053] 1.6 TCID 50 Experiment

[0054] The sample preparation was the same as that for qPCR. TCID 50 Determination: Using the growth medium, inoculate 2×10 4 MDBK cell suspension (100 μL / well) in a 96-well plate. Place the culture plate in an incubator and incubate for 24 h (37 °C, 5% CO2). Dilute the virus solution 10-fold serially with the maintenance medium (DMEM containing 2% FBS), with 8 replicates for each dilution. Take 100 μL of the diluted virus solution and add it to the wells to maintain cell culture for 5 d. Finally, observe and count the number of wells with cytopathic effect under a microscope, and calculate the TCID of the virus solution according to the Reed-Muench method. 50 。

[0055] 1.7 Time of addition experiment

[0056] The process of virus infecting host cells can be chronologically divided into the stage before the virus contacts the cell, the stage where the virus binds to the host receptor and adsorbs on the surface of the host cell, the stage where the virus enters the cell through endocytosis and other means, and the replication stage after the virus enters the cell. To determine at which stage of LSDV infecting MDBK cells the drug exerts its antiviral effect, in this example, during the process of rLSDV infecting MDBK cells, the cells or the virus were treated with the drug, and the replication level of the virus was evaluated through the mCherry and Luciferase proteins expressed by the virus. Figure 9 The following is the design pattern diagram of the Time of addition experiment provided in the embodiment of the present invention:

[0057] Inoculate 2×10 4 MDBK cell suspension (100 μL / well) in a 96-well plate. Place the culture plate in an incubator and incubate for 24 h. According to different drug treatment time periods, four groups of experiments were set up.

[0058] Group 1 (neutralization stage): To determine whether the drug has a neutralizing effect on the virus before the virus contacts the cell, dilute the drug with the maintenance solution to a 2× drug concentration working solution. Mix 50 μL of the 2× drug concentration working solution with an equal volume of 200 TCID 50 rLSDV to obtain a 1× drug concentration working solution containing 200 TCID 50 rLSDV, and incubate at 37 °C for 1 h. Then inoculate the incubated liquid into the cells, incubate with MDBK cells for 2 h, discard the liquid, wash twice with 1×PBS, discard all the liquid, add 200 μL of the maintenance solution, and continue to maintain the culture for 72 h.

[0059] Group 2 (blocking stage): To determine whether the drug has the effect of competitively binding to host cell receptors during virus adsorption to cells, the drug was diluted into a 1× drug concentration working solution using maintenance medium. 100 μL of the 1× drug concentration working solution was added to the cells, incubated at 37 °C for 1 h, the liquid was discarded, washed twice with 1× PBS, and after discarding all the liquid, 100 μL of rLSDV containing 200 TCID 50 was added, incubated with MDBK cells for 2 h, the liquid was discarded, washed twice with 1× PBS, and after discarding all the liquid, 200 μL of maintenance medium was added, and the maintenance culture was continued for 72 h.

[0060] Group 3 (entry stage): To determine whether the drug has the effect of preventing virus entry into cells, the drug was diluted into a 2× drug concentration working solution using maintenance medium. 50 μL of the 2× drug concentration working solution was mixed with an equal volume of 200 TCID 50 rLSDV to obtain a 1× drug concentration working solution containing 200 TCID 50 rLSDV. 100 μL of the mixed liquid was inoculated into MDBK cells, incubated with MDBK cells for 2 h, the liquid was discarded, washed twice with 1× PBS, and after discarding all the liquid, 200 μL of maintenance medium was added, and the maintenance culture was continued for 72 h.

[0061] Group 4 (replication stage): To determine whether the drug has the effect of preventing virus replication after the virus enters host cells, the drug was diluted into a 1× drug concentration working solution using maintenance medium. After discarding all the liquid, 100 μL of rLSDV containing 200 TCID 50 was added, incubated with MDBK cells for 2 h, the liquid was discarded, and washed twice with 1× PBS. After discarding all the liquid, 200 μL of the 1× drug concentration working solution of the drug to be tested was added, and the incubation was continued at 37 °C for 72 h.

[0062] In the above four groups, DMSO was set as the control group. At 72 hpi, samples were collected for detection, and the Luciferase activity produced by the virus was detected.

[0063] 1.8 Observation of virus DNA / RNA synthesis by laser confocal microscopy

[0064] EdU is a thymidine deoxynucleoside analog. During DNA synthesis, EdU can be incorporated into newly synthesized DNA as a raw material, and through subsequent click reactions, EdU is labeled with Alexa Fluor488. Therefore, newly synthesized DNA emits green fluorescence under a fluorescence microscope.

[0065] At 1×10 6The density of cells per dish was used to seed MDBK cells into 6 cm2 cell culture dishes. After 24 h, 0.1 MOI of LSDV was inoculated, and a blank control group was set up. At 24 hpi, the cells were washed twice with PBS and then detached with trypsin digestion solution. 5 μL of PBS was added to each well of a 24-well plate, and the cell slides were laid flat in the 24-well plate. 5×10 4 cells per well were added. After 12 h, a drug solution was prepared with cell maintenance medium (DMEM containing 2% FBS), and the prepared drug solution was used to treat the cells for 30 min. Then, an EdU labeling solution (a mixture containing cell maintenance medium, drug, and EdU at a final concentration of 10 μM) was prepared. After mixing, the original drug solution in the wells was replaced with the EdU labeling solution, and the cells were cultured for an additional 60 min. After EdU labeling of the cells was completed, the culture medium was removed, and 1 mL of 4% paraformaldehyde fixative was added and fixed at room temperature for 15 min. The fixative was removed, and the cells in each well were washed 3 times with 1 mL of PBS, 5 min each time. The PBS was removed, and each well was incubated with 1 mL of permeabilization solution (PBS containing 0.3% Triton X-100) at room temperature for 15 min. The permeabilization solution was removed, and the cells in each well were washed 2 times with 1 mL of PBS, 5 min each time. The washing solution was removed, and each well was blocked with IFA blocking solution (PBS containing 3% BSA) at room temperature for 1 h. The blocking solution was discarded without washing, and incubated with LSDV rabbit polyclonal antibody (1:1000) at room temperature for 1 h, washed 3 times with PBS, 5 min each time. Incubated with Alexa Fluor594-conjugated goat anti-mouse IgG (Thermo Fisher, USA) at room temperature for 1 h, washed 3 times with PBS, 5 min each time. A click reaction working solution was prepared according to a system with 860 μL of Click Reaction Buffer, 40 μL of CuSO4, 2 μL of Azide488, and 100 μL of Click AdditiveSolution, with a total volume of 1 mL. The click reaction working solution was added to the wells of the 24-well plate at a volume of 100 μL / well. Incubated at room temperature in the dark for 30 min. The click reaction working solution was discarded, washed 3 times with PBS, and finally 100 μL of 1× Hoechst33342 solution was added to each well and incubated at room temperature in the dark for 10 min to label the total DNA. The 1× Hoechst33342 solution was aspirated, and washed 3 times with PBS, 5 min each time. Subsequently, fluorescence could be observed through a confocal microscope (Nikon A1 plus, Japan).

[0066] Similar to the principle of EdU labeling DNA, EU is a uridine analogue. During RNA synthesis, EU can be incorporated as a raw material into newly synthesized RNA and, through subsequent click reactions, EU is labeled with Alexa Fluor488. Therefore, newly synthesized RNA emits green fluorescence under a fluorescence microscope. The experimental procedures for detecting the effect of drugs on LSDV RNA synthesis are basically the same as those for studying the part of drug on DNA synthesis, except that the final concentration of EU used is 100 μM, which is different from EdU.

[0067] 2. Experimental Results

[0068] 2.1 Drug CC 50 Determination

[0069] To evaluate the cytotoxicity of drugs in vitro, we treated MDBK and Vero cells with different concentrations of drugs, measured the cell viability by CCK-8, and plotted the cytotoxicity curves of the drugs. As Figure 2 and Figure 3 shown, the CC 50 of cytarabine in the MDBK cell line was 3.24 μM, and the CC 50 of idoxuridine, non-arauridine, and vidarabine in MDBK were all greater than 100 μM. The CC 50 of idoxuridine, non-arauridine, cytarabine, and vidarabine in the Vero cell line were all greater than 100 μM.

[0070] 2.2 Drug IC 50 Determination

[0071] To evaluate the antiviral activity of drugs in vitro, during the process of rLSDV infecting MDBK and Vero cells, we treated the cells with different concentrations of drugs and labeled the proliferation of the virus in the cells through the mCherry protein expressed by the virus. By detecting the Luciferase activity expressed by the virus, we plotted the curves of drugs inhibiting LSDV replication in the two types of cells. The replication of LSDV by the 4 compounds in the two cell lines was dose-dependent. As Figure 2 and Figure 3 shown, the IC 50 of idoxuridine in the MDBK cell line was 1.61 μM, the IC 50 of non-arauridine in the MDBK cell line was 0.33 μM, the IC 50 of cytarabine in the MDBK cell line was 0.14 μM, and the IC 50 of vidarabine in the MDBK cell line was 3.32 μM. The IC 50 of idoxuridine in the Vero cell line was 12.68 μM, and the IC of non-arauridine in the Vero cell line50 was 3.17 μM, and the IC of cytarabine on the Vero cell line 50 was less than 0.05 μM, and the IC of vidarabine on the Vero cell line 50 was 6.80 μM.

[0072] The compound selectivity index (SI) is an important indicator for evaluating the efficacy and safety of drugs. The SI is defined as the ratio of the CC of the drug 50 to the IC 50 , that is, SI = CC 50 / IC 50 . The SI can help us understand at what concentration the drug can effectively inhibit pathogens while having less toxic effects on host cells. Generally, a selectivity index greater than 1.00 is considered effective, and the larger the selectivity index, the greater the safety range of the drug. The ratio calculation results of CC 50 to IC 50 showed that the selectivity indices of idoxuridine in the MDBK cell line were all greater than 62.11, and the selectivity indices of idoxuridine in the Vero cell line were all greater than 7.89; the selectivity indices of phloxuridine in the MDBK cell line were all greater than 303.03, and the selectivity indices of phloxuridine in the Vero cell line were all greater than 31.55; the selectivity indices of cytarabine in the MDBK cell line were all greater than 714.29, and the selectivity indices of cytarabine in the Vero cell line were all greater than 2000; the selectivity indices of vidarabine in the MDBK cell line were all greater than 30.12, and the selectivity indices of vidarabine in the Vero cell line were all greater than 14.71; this indicates that idoxuridine, phloxuridine, cytarabine, and vidarabine have a large safety range in inhibiting the proliferation of LSDV.

[0073] As Figure 4 , Figure 5 shown, the higher the concentrations of idoxuridine, phloxuridine, cytarabine, and vidarabine used in MDBK and Vero, the lower the protein expression level of mCherry of rLSDV, which indicates that the effects of idoxuridine, phloxuridine, cytarabine, and vidarabine in inhibiting the proliferation of rLSDV in MDBK and Vero are dose-dependent relationships with the drug concentrations.

[0074] 2.3 TCID 50 Verification of drug effectiveness

[0075] To evaluate the antiviral activity of the drugs in vitro, during the process of LSDV XJ wild-type virus infecting MDBK and Vero cells, the cells were treated with 20 μM idoxuridine, 5 μM phloxuridine, 0.5 μM cytarabine, and 20 μM vidarabine respectively. At 72 hpi, the TCID of LSDV in the cell samples was detected50 Content, the inhibitory effect of the drug on LSDV was evaluated. As Figure 6 shown, after treating the MDBK cell line with idoxuridine, nonaristeromycin, cytarabine, and vidarabine, the TCID 50 content of the virus in the cells decreased extremely significantly (analyzed by the independent samples t-test method, P < 0.01).

[0076] 2.4 qPCR verification of drug effectiveness

[0077] To evaluate the antiviral activity of the drug in vitro, during the infection of MDBK and Vero cells with LSDV XJ wild-type virus, the cells were treated with 20 μM idoxuridine, 5 μM nonaristeromycin, 0.5 μM cytarabine, and 20 μM vidarabine, respectively. The inhibitory effect of the drug on LSDV was evaluated by detecting the relative content of the LSDV gene in the cell samples at 72 hpi. As Figure 7 shown, after treating the MDBK cell line with idoxuridine, nonaristeromycin, cytarabine, and vidarabine, the relative expression level of the ORF72 gene of the virus in the cells decreased extremely significantly (analyzed by the independent samples t-test method, P < 0.01).

[0078] 2.5 Western blot analysis of drug effectiveness

[0079] To evaluate the antiviral activity of the drug in vitro, MDBK and Vero cells were infected with 0.01 MOI and 0.1 MOI of LSDV, and the cells were treated with 20 μM idoxuridine, 5 μM nonaristeromycin, 0.5 μM cytarabine, and 20 μM vidarabine, respectively. Whole cell lysates were collected at 72 hpi for Western blot. The results are as Figure 8 shown, idoxuridine, nonaristeromycin, cytarabine, and vidarabine all had good inhibitory effects on LSDV with different MOIs.

[0080] 2.6 Time of addition experiment: The compound mainly exerts its antiviral effect during the virus replication stage

[0081] To determine at which stage of LSDV infection of MDBK cells the drug exerts its antiviral effect, during the infection of MDBK cells with rLSDV, the cells were treated with 20 μM idoxuridine, 5 μM nonaristeromycin, 0.5 μM cytarabine, and 20 μM vidarabine, respectively. The replication level of the virus was evaluated by the mCherry and Luciferase proteins expressed by the virus at 72 hpi. As Figure 10 and Figure 11As shown, idoxuridine, nonoxuridine, cytarabine and vidarabine significantly inhibited LSDV replication at the viral replication stage (analyzed by independent sample t-test, P<0.01).

[0082] 2.7 Laser confocal microscopy observation: Compounds inhibit LSDV DNA synthesis

[0083] DNA replication is an essential biological process after LSDV enters the cell. To determine whether the compounds have an impact on DNA synthesis during the viral replication stage, we treated the cells with 20 μM idoxuridine, 5 μM nonoxuridine, 0.5 μM cytarabine and 20 μM vidarabine respectively during the process of LSDV infecting MDBK cells. At the same time, EdU was used to label the newly synthesized viral and host DNA within 1 h. As Figure 12 shown, idoxuridine, nonoxuridine, cytarabine and vidarabine can inhibit DNA synthesis during the LSDV replication stage.

Claims

1. Use of nucleotide analogs in the preparation of drugs for preventing and / or treating diseases caused by bovine nodular dermatosis virus, characterized in that: The nucleotide analogue is selected from any one or more of iodine, feralin, cytarabine and adenosine.

2. The use according to claim 1, characterized in that: The disease caused by the bovine lumpy skin disease virus is bovine lumpy skin disease caused by the bovine lumpy skin disease virus.

3. The use according to claim 1, characterized in that: The drug uses any one or more of iodine, fenarinuridine, cytarabine and adenosine as active ingredients.

4. The use according to claim 1, characterized in that: The concentration of iodine in the drug is 20 μM, the concentration of fenaruridine is 5 μM, the concentration of cytarabine is 0.5 μM, and the concentration of adenosine is 20 μM.

5. The use according to claim 1, characterized in that: The drug is a drug for inhibiting the replication stage of bovine nodular dermatosis virus.

6. Use of a nucleotide analogue in any one of the following (1) to (3), characterized in that: (1) Preparation of drugs for preventing and / or treating bovine lumpish skin disease virus infection; (2) Preparation of bovine nodular dermatosis virus inhibitors; (3) Preparation of drugs for inhibiting the proliferation of bovine nodular dermatitis virus; The nucleotide analogue is selected from any one or more of iodine, feralin, cytarabine and adenosine.

7. A drug for treating bovine nodular dermatosis, characterized in that: The drug contains an effective amount of the nucleotide analogue described in claim 1 as an active ingredient.

8. The drug for treating bovine nodular dermatosis according to claim 7, characterized in that: The medicament further comprises one or more pharmaceutically acceptable carriers.

9. The drug for treating bovine nodular dermatosis according to claim 7, characterized in that: The pharmaceutically acceptable carrier includes: an excipient, a filler, a binder, a wetting agent, a disintegrant, a diluent and / or a surfactant.

10. The drug for treating bovine nodular dermatosis according to any one of claims 7 to 9, characterized in that: The dosage form of the drug is any one or more of tablets, capsules, oral liquids, granules, pills or injections.

Images