Primer probe group, kit and device for quantitatively detecting V600E mutation of human BRAF gene based on digital PCR (Polymerase Chain Reaction)

Abstract

The invention relates to a primer for quantitatively detecting V600E mutation of a human BRAF gene based on digital PCR (Polymerase Chain Reaction). The primer comprises nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3. The invention also relates to a method for quantitatively detecting the V600E mutation of the human BRAF gene based on the digital PCR. Preferably, the probe comprises a wild type probe of the V600E gene, a mutation site (c.17991800delinsAT) of the V600E gene, a mutation site (c.17991800delinsAC) of the V600E gene, and / or a mutation probe (c.17981799delinsAA) of the mutation site of the V600E gene, and the mutation probe of the mutation site of the V600E gene can be used for detecting the mutation of the V600E gene. According to the method, a vibration microdroplet generation digital PCR (dPCR) technology is combined, and through innovative local law optimization (artificial sequence), remarkable technical advantages and clinical application value are shown in human BRAF gene V600E mutation detection.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection materials, and relates to a primer-probe set, a kit and a device for quantitatively detecting the V600E mutation of human BRAF gene based on digital PCR. Background Art

[0002] The BRAF gene is located on the long arm of human chromosome 7 (7q34) and encodes a serine / threonine protein kinase. As a core molecule of the MAPK (Ras / Raf / MEK / ERK) signaling pathway, it regulates key biological processes such as cell proliferation, differentiation and apoptosis. In tumors, BRAF mutations drive carcinogenesis by activating the MAPK pathway, among which mutations at the V600 locus (such as V600E / K / R) account for the highest proportion. The BRAF V600E mutation (c.1799T>A) accounts for more than 90% of all V600 mutations and is commonly found in melanoma, papillary thyroid carcinoma, colorectal cancer and non-small cell lung cancer. In addition, although the BRAF V600R mutation (valine → arginine) only accounts for 1-5%, its detection rate in malignant melanoma can reach 5%. Its kinase activity is similar to that of V600E / K, which also leads to abnormal activation of the MAPK pathway.

[0003] Currently, the clinical detection of BRAF mutations mainly relies on the following methods:

[0004] 1. Sanger sequencing: As the "gold standard", its sensitivity is only above 15%, and the throughput is limited (at most 96 sites can be detected at a time);

[0005] 2. Next-generation sequencing (NGS): It can detect multi-gene variations with high throughput, but it is costly and time-consuming, and is suitable for cancer types that require multi-gene joint detection;

[0006] 3. Allele-specific amplification (ARMS): A PCR-based mutation detection technology that analyzes known base substitutions or small fragment deletions and insertional mutations. In the primer design of PCR, a mismatched base is designed at the 3' end or in the middle of the primer according to the nature of the known mutation site, so that it can only be complementary to the mutant or wild-type gene and only amplify the mutant or wild-type gene; it is necessary to avoid non-specific amplification caused by G:T mismatches, and the applicable scenarios are limited;

[0007] 4. Fluorescent quantitative PCR: It depends on Ct value quantification, requires a standard curve and has a risk of false positives;

[0008] 5. Immunohistochemistry (IHC): The initial screening cost is low but the false positive rate is high, and it is only suitable for single-item detection.

[0009] The research shows that the sensitivity and consistency of NGS and multiplex RT-PCR are superior to Sanger sequencing in 138 non-small cell lung cancer samples, indicating that molecular detection techniques are developing towards high sensitivity and high throughput.

[0010] There are various mutations near the V600 position (nt 1797_1799) of the BRAF gene, such as 3 common mutations of V600R: c.1798_1799delinsAG, c.1798_1799delinsCG, c.1797_1799delinsGAG, the V600K mutation c.1798_1799delinsAA, the V600D mutation c.1799_1800delinsAC, c.1799_1800delinsAT. There is only 1 base difference between V600E (c.1799T>A) and V600D (c.1799_1800delinsAC), V600D (c.1799_1800delinsAT), V600K (c.1798_1799delinsAA), and there is only 1 base difference between V600E (c.1799T>A) and the wild-type sequence. Therefore, it is difficult to ensure the specificity of the designed probe for the V600E detection target. Currently, non-specific amplification is prone to occur in primer design for detecting the BRAF V600E mutation. For example, traditional fluorescence PCR results in cross-reactions due to the probe labeling method (such as a single quenching group), reducing the detection specificity. In addition, the existing methods have a high false-negative rate for low-abundance mutations (such as 1 copies / μL), and the detection cycle is difficult to meet the clinical rapid diagnosis requirements.

[0011] This application aims to form a primer pair with high specificity for BRAF V600E through probe modification optimization, digital PCR quantification technology, and specific selection of artificial sequences, thereby improving the detection efficiency.

[0012] In addition, on the one hand, there are differences in the understanding of those skilled in the art; on the other hand, although the inventors studied a large number of literatures and patents when making this invention, all details and contents are not listed in detail due to space limitations. However, this does not mean that this invention does not possess the features of these prior arts. On the contrary, this invention already possesses all the features of the prior arts, and the applicant reserves the right to add relevant prior arts in the background art. Summary of the Invention

[0013] Based on the above technical problems, the present invention relates to a method, primers and kits for quantitative detection of the V600E mutation of the human BRAF gene based on digital PCR. For samples with low-abundance mutations or low copies, the technical solutions involved in the present invention can improve the detection accuracy (reduce the probability of missed detection) while improving the detection efficiency (shorten the detection cycle and increase the detection throughput). The present invention optimizes the primer probes to improve their specificity. Specifically, the 5'-end of the reference gene is modified with HEX, and the 3'-end is modified with BHQ1. The 5'-end of the primer is modified with ROX at 16 bases on the right side of the partial 5'-end, and the 3'-end is modified with BHQ2. The 5'-end of the probe is modified with ROX at 16 bases on the right side of the partial 5'-end, and the 3'-end is modified with BHQ2.

[0014] To achieve the above object, the technical solution adopted by the present invention to solve its technical problems is:

[0015] A primer-probe set for quantitative detection of the V600E mutation of the human BRAF gene based on digital PCR, which comprises an upstream primer, a downstream primer and a probe for the V600E mutation sequence of the human BRAF gene. Among them, the upstream primer is set with the sequence shown in SEQ ID NO.20 from the 5'-end; the probe is set with the sequence shown in SEQ ID NO.21 from the 5'-end.

[0016] According to a preferred embodiment, the primer comprises the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0017] Preferably, V600E-F: GAGTGAGCGCAGACGAAACAGACAACTGTTCAAA CTGATGG (SEQ ID NO.1); V600E-R: TGAAGACCTCACAGTAAAAATAGGT (SEQ ID NO.2); V600E-P: CGTCTGCGCTCACTCTCTAGCTACAGAGAA (SEQ ID NO.3).

[0018] Preferably, the probe includes a wild-type probe of the V600E gene, the mutation site (c.1799_1800delinsAT) of the V600E gene, the mutation site (c.1799_1800delinsAC) of the V600E gene, and / or the mutation probe of the mutation site of the V600E gene (c.1798_1799delinsAA).

[0019] Preferably, the primers for amplifying the reference gene sequence comprise the nucleotide sequences shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0020] Preferably, ACTB-F: AACTGGAACGGTGAAGGTGACA (SEQ ID NO.4); ACTB-R: TCCTGTAACAACGCATCTCATA (SEQ ID NO.5); ACTB-P: AGCATCCCCCAAAGTTCACAATGT (SEQ ID NO.6).

[0021] According to a preferred embodiment, the 5'-end of the probe is labeled with a fluorophore and the 3'-end is labeled with a quencher.

[0022] Preferably, the fluorophore includes one or more of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705.

[0023] Preferably, the quencher includes one or more of DABCYL, BHQs, ECLIPSE, TAMRA. A kit for quantitatively detecting the V600E mutation of the human BRAF gene based on digital PCR, the kit includes the above primers. Preferably, the BHQs are BHQ-1 or BHQ-2.

[0024] According to a preferred embodiment, the kit further includes 1 part of template, 6 parts of forward primer and 1-6 parts of reverse primer in terms of molar concentration.

[0025] On the other hand, the present invention relates to the application of the above primers in detecting the V600E mutation of the human BRAF gene.

[0026] According to a preferred embodiment, the application includes detecting sample DNA with the above primers or a kit containing the above primers.

[0027] According to a preferred embodiment, the genome in the sample to be tested is derived from human blood, urine, cerebrospinal fluid, saliva, aqueous humor and / or feces.

[0028] On the other hand, the present invention relates to a method for quantitatively detecting the V600E mutation of the human BRAF gene based on digital PCR. As Figure 1 shown, the method comprises the following steps:

[0029] Mix the sample to be tested, the reaction solution and the primers.

[0030] Perform PCR reaction and detect the fluorescence signal.

[0031] According to a preferred embodiment, the PCR reaction procedure is as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 20 s, annealing at 56°C for 60 s, for a total of 45 cycles.

[0032] According to a preferred embodiment, the reaction solution includes 1 part of template, 6 parts of forward primer, and 1 - 6 parts of reverse primer in terms of molar concentration. Preferably, the reaction solution includes 600 nM of forward primer, 100 nM of reverse primer, and 100 nM of template.

[0033] According to a preferred embodiment, the reaction solution contains 2×PCR reaction buffer, DNA polymerase, probe, forward primer, reverse primer, nucleic acid template, and ultrapure water. Preferably, the reaction solution contains 12.5 μL of 2×PCR reaction buffer, 3 U of DNA polymerase, 250 nM of probe, 600 nM of forward primer, 100 nM of reverse primer, 6 - 10 μL of nucleic acid template, and ultrapure water to make up the remaining volume to 25 μL. More preferably, the reaction solution contains 12.5 μL of 2×PCR reaction buffer, 3 U of DNA polymerase, 250 nM of probe, 600 nM of forward primer, 100 nM of reverse primer, 6 μL of nucleic acid template, and ultrapure water to make up the remaining volume to 25 μL.

[0034] On the other hand, the present invention relates to a device for quantitative detection of human BRAF gene V600E mutation based on digital PCR. The device includes a data acquisition unit and a data processing unit;

[0035] The data acquisition unit is used to perform the following operations: using the genome in the sample to be tested as a template, performing digital PCR with the above-mentioned primer-probe set for quantitative detection of human BRAF gene V600E mutation based on digital PCR, and then performing fluorescence signal detection;

[0036] The data processing unit is used to perform the following operations: interpreting the result after digital PCR processing.

[0037] According to a preferred embodiment, the reaction system of digital PCR includes 1 part of template, 6 parts of forward primer, and 1 - 6 parts of reverse primer in terms of molar concentration.

[0038] According to a preferred embodiment, the reaction procedure of digital PCR includes:

[0039] Pre-denaturation at 95°C for 5 min;

[0040] Denaturation at 94°C for 20 s, annealing at 56°C for 60 s, for a total of 45 cycles.

[0041] According to a preferred embodiment, the genome in the sample to be tested is derived from human blood, urine, cerebrospinal fluid, saliva, aqueous humor, and / or feces.

[0042] The present invention combines the vibrating droplet generation digital PCR (dPCR) technology and demonstrates significant technical advantages and clinical application value in the detection of the V600E mutation of the human BRAF gene through innovative methodological optimization (artificial sequence).

[0043] 1. The present invention uses the vibrating droplet generation technology to divide the reaction system into thousands of independent reaction units and realizes the absolute quantification of target molecules through the Poisson distribution principle. Compared with traditional qPCR, the detection sensitivity of this technology for low-abundance mutations (such as ctDNA in liquid biopsy) is increased to 0.01%, which is particularly suitable for the accurate detection of low-frequency mutations such as BRAF V600E; at the same time, the independent enclosure of droplets effectively isolates the interference of PCR inhibitors (such as ethanol, EDTA, etc.) and enhances the detection stability for complex samples such as blood and sputum.

[0044] 2. The primer set involved in the present invention targets the conserved region of the BRAF gene, avoids cross-reaction with homologous sequences, and solves the compatibility problem in multiplex detection through artificial sequence optimization; in addition, through the annealing temperature gradient experiment (55 - 65°C) and cycle number optimization (35 - 45 cycles), the amplification efficiency and background signal control are balanced to ensure the effective amplification of low-concentration templates and avoid the accumulation of non-specific products.

[0045] The primer set and detection method involved in the present invention have targeted detection accuracy for tumor diseases caused by the V600E mutation of the BRAF gene, such as melanoma, papillary thyroid carcinoma, colorectal cancer, and non-small cell lung cancer.

[0046] Specifically, the mutation rate of BRAF V600E in melanoma is as high as 50 - 60%, and the mutation rate in skin-type patients can reach 88%; in particular, due to the restriction of the blood-brain barrier, the abundance of circulating tumor DNA (ctDNA) in brain metastasis lesions is extremely low, and traditional ARMS-PCR (sensitivity about 1%) is prone to missed detection. However, the present invention improves the sensitivity to 0.01% by optimizing the primer set and detection method, and can detect mutations as low as 0.13% in blood, thereby realizing the early detection and warning of tumors with metastases in special parts. In addition, the artificial sequence design shortens the probe binding length, reduces cross-reaction with wild-type sequences, and improves the detection specificity in mixed or poorly differentiated samples, which is of great significance for the typing of melanoma pathological subtypes with significantly different BRAF mutation rates and avoids false negatives caused by tissue heterogeneity.

[0047] For papillary thyroid carcinoma sampled by fine needle aspiration, single fine needle aspiration often results in failed Sanger sequencing due to insufficient sample volume (e.g., number of cells). The digital PCR involved in the present invention not only reduces the requirement for sample volume but also improves sensitivity and reduces the rate of secondary puncture.

[0048] In the field of colorectal cancer detection, 40% of BRAF - mutated colorectal cancer patients are accompanied by microsatellite - high instability (MSI - H). This correlation stems from the continuous activation of the MAPK pathway caused by BRAF mutation (e.g., indirectly triggering mismatch repair defects through epigenetic changes). The technical solution of the present invention synchronously analyzes BRAF mutation and MSI status (HEX\ROX\CY5 multi - channel highly specific quantitative PCR) in a single reaction system, avoiding sample loss in traditional step - by - step detection (e.g., detecting MMR protein by IHC and then verifying MSI by PCR). It is especially suitable for advanced patients with limited formalin - fixed paraffin - embedded tissues (multigene combined detection, e.g., BRAF+KRAS+NRAS). Brief Description of the Drawings

[0049] Figure 1 It is the specific implementation flowchart involved in the present invention;

[0050] Figure 2 It is the ROX - channel quantitative result graph of primer set 1 involved in the present invention;

[0051] Figure 3 It is the ROX - channel quantitative result graph of primer set 2 involved in the present invention;

[0052] Figure 4 It is the ROX - channel quantitative result graph of primer set 3 involved in the present invention;

[0053] Figure 5 It is the ROX - channel quantitative result graph of primer set 4 involved in the present invention;

[0054] Figure 6 It is the ROX - channel quantitative result graph of primer set 5 involved in the present invention;

[0055] Figure 7 It is the CY5 - channel quantitative result graph of the blank control, negative control, positive control, and sample of primer set 1 involved in the present invention;

[0056] Figure 8 It is the HEX - channel quantitative result graph of the blank control, negative control, positive control, and sample of primer set 1 involved in the present invention;

[0057] Figure 9 It is the CY5 - channel quantitative result graph of the sample after dilution using primer set 1;

[0058] Figure 10 Quantification result graph of the HEX channel using primer set 1 after sample dilution. Detailed implementation

[0059] In the description of the present invention, the terms are only for descriptive purposes and should not be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. In the description of the present invention, "a plurality of" means two or more, unless otherwise specifically defined.

[0060] The data acquisition unit includes a fluorescence signal detection component and a PCR injection component. It uses a vibrational microdroplet generation technique to divide the genomic DNA template to be tested into 20,000 - 100,000 independent microreaction units (such as water-in-oil microdroplets or microfluidic chip holes). Then, after the amplification process is completed, the endpoint fluorescence signal of each microdroplet is collected based on the fluorescence signal detection component (fully automatic optical scanning system).

[0061] The data processing unit is preferably a data processing integrated server, personal terminal or other device. The data processing unit is equipped with algorithms for the conversion and analysis of fluorescence signals for result interpretation.

[0062] In the methodology of the present invention, an artificial sequence is designed on the probe, and an artificial sequence is also involved on the upstream primer. The two artificial sequences are naturally complementary. When a single primer binds to the template, the two artificial sequences are more likely to bind due to the distance, and when it is easier to bind to the probe, mutations are more easily detected. At the same time, due to the design of the artificial sequences, the probe bound to the template is also shorter, without a stem-loop structure. On this basis, the sensitivity and specificity of the detection of the V600E mutation of the human BRAF gene based on the primer-probe set are significantly improved (100%).

[0063]

[0064] The design of the mutation sites in the following examples is based on SEQ ID NO.19.

[0065] The experimental purpose of the following examples is as follows: specific primers and fluorescence probes are designed for the V600E mutation of the human BRAF gene, and the droplet digital PCR technology is used to quantitatively detect the V600R mutation of the human BRAF gene in the pathological tissues or specimens of patients.

[0066] The artificial sequences substantially set in the present invention are a pair of complementary sequences: GAGTGAGCGCAGACG (SEQ ID NO.20); CGTCTGCGCTCACTCT (SEQ ID NO.21). This pair of artificial sequences is specifically suitable for the gene detection of the human BRAF gene.

[0067] Example 1

[0068] This example relates to the verification of the amplification efficiency of primer sets 1-5.

[0069] 1. Experimental method

[0070] In this example, the droplet digital PCR technology is used to divide the sample to be tested into many independent and parallel PCR reaction units. Some reaction units contain target molecules (positive), while other reaction units do not contain target molecules (negative). After the amplification period is completed, no signal accumulation occurs when there is no target sequence. The detection of the V600E mutation of the human BRAF gene is achieved by detecting the accumulation of the final fluorescence signal.

[0071] A total of 5 sets of primer sets formed by probes, forward primers, and reverse primers are shown in Table 1.

[0072] Table 1. Primer sets

[0073]

[0074] The samples (nucleic acid templates) corresponding to each primer set correspond to the sample numbers in Table 2 below, and the mutation sites of each sample number are shown in the positions in Table 2.

[0075] Table 2. Reaction systems for each group

[0076]

[0077]

[0078] Note: MT represents mutant; WT represents wild type.

[0079] Prepare a reaction system containing the primer-probe set of the present invention, and the specific system is shown in Table 2:

[0080] Table 3. Reaction system

[0081] Reagent components Concentration 2×PCR reaction buffer 1× DNA polymerase 3U Probe 250 nM Forward primer 600 nM Reverse primer 100 nM Nucleic acid template / Ultra-pure water Make up to 25 μL

[0082] After preparing the microreaction units on digital PCR, PCR amplification was carried out. The specific amplification program is shown in Table 3:

[0083] Table 4. PCR amplification program

[0084]

[0085] 2. Experimental results and analysis

[0086] (1) Using primer sets 1 - 5, digital PCR detection was performed on different test samples (without reverse transcription process), and each was detected 2 times repetitively.

[0087] Taking the V600E (c.1799T>A) mutant plasmid as the positive control and water as the blank control. Photos were taken under the condition of 40°C.

[0088] As shown in Table 5 and the figure representing the amplification of primer set 1 Figure 2 , in primer set 1, using V600E-MT as the template, the copy numbers detected through the ROX channel were 16.8 and 11.8 respectively, while using water and V600E-WT as the templates, the copy numbers detected through the ROX channel were both 0.

[0089] As shown in Table 5 and the figure representing the amplification of primer set 1 Figure 3 , in primer set 2, using V600E-MT as the template, the copy numbers detected through the ROX channel were 9.46 and 7.67 respectively, while using water as the template, the copy numbers detected through the ROX channel were 0.13 and 0.12; using V600E-WT as the template, the copy numbers detected through the ROX channel were 1.34 and 2.19.

[0090] As shown in Table 5 and the figure representing the amplification of primer set 1 Figure 4 , in primer set 3, using V600E-MT as the template, the copy numbers detected through the ROX channel were 27.56 and 28.57 respectively, while using water as the template, the copy numbers detected through the ROX channel were both 0.13; using V600E-WT as the template, the copy numbers detected through the ROX channel were 1.96 and 1.84.

[0091] As shown in Table 5 and the figure representing the amplification of primer set 1 Figure 5As shown, in primer set 4, using V600E-MT as the template, the copy numbers detected through the ROX channel were 19.37 and 17.37 respectively, while using water as the template, the copy numbers detected through the ROX channel were both 0; using V600E-WT as the template, the copy numbers detected through the ROX channel were 0.4 and 1.29.

[0092] As shown in Table 5 and Figure 6 As shown, in primer set 5, using V600E-MT as the template, the copy numbers detected through the ROX channel were 33.87 and 27.93 respectively, while using water as the template, the copy numbers detected through the ROX channel were both 0; using V600E-WT as the template, the copy numbers detected through the ROX channel were 0.99 and 1.08.

[0093] The above experimental results show that the V600E mutation detection primers designed according to this technical solution all showed certain detection effects. In particular, primer set 1 showed high specificity, and it was able to accurately identify and detect the mutation at the V600E site.

[0094] Table 5. Amplification results of each group

[0095]

[0096] Note: MT represents mutant; WT represents wild type.

[0097] Example 2

[0098] This example involves the verification of the amplification efficiency of primer set 1 at different sites.

[0099] 1. Experimental method

[0100] In this example, the vibration-based droplet digital PCR technology was applied. The sample to be tested was divided into many independent and parallel PCR reaction units. Some reaction units contained the target molecule (positive), while other reaction units did not contain the target molecule (negative). After the amplification period was completed, no signal accumulation occurred when there was no target sequence. The detection of the V600E mutation in the human BRAF gene was achieved by detecting the accumulation of the final fluorescence signal.

[0101] This example adopted the reaction system and amplification program in Example 1 above, used the primers of primer set 1, and introduced samples 1 to 4 respectively for digital PCR detection of different test samples (without reverse transcription process). Samples 1 to 4 were each detected 2 times, the blank control was detected 2 times, and the positive control and negative control were each detected 1 time. Based on the experiments in this example, the detection efficiency of primer set 1 designed according to this technical solution for the detection of V600E (especially c.1799T>A) mutation can be verified.

[0102] 2. Experimental Results and Analysis

[0103] (1) Sample 1 is BRAF V600 WT; Sample 2 is 50% mutated BRAF V600K (c.1798_1799delinsAA); Sample 3 is 50% mutated BRAF V600D (c.1799_1800delinsAC); Sample 4 is 50% mutated BRAF V600D (c.1799_1800delinsAT).

[0104] Using the V600E (c.1799T>A) mutant plasmid as the positive control, water as the blank control, and nucleic acid extracted from the 293T cell line as the negative control. Photos were taken under the photo-taking conditions at 40°C. As Figure 7 and 8 shown, the CY5 channels of Samples 1 - 4 were all detected as negative, and the HEX channels were all detected as positive; the CY5 channel of the positive control V600E (c.1799T>A) was detected as positive, and the HEX channel was not detected normally; the CY5 channel of the negative control was detected as negative, and the HEX channels were all detected as positive; both channels of the blank control were not detected normally. This result shows that the replacement of the fluorescent group does not affect the detection effect of the technical solution of the present invention. This result also shows that the fluorescent replacement of the primer-probe group has no effect on its amplification effect.

[0105] The result of the V600E mutant in the positive control was 18.3 (sample number 22); the results of the V600E mutant in other samples were 0, indicating no detection. The experimental results (Table 6) show that the V600E (c.1799T>A) mutant detection primers designed according to the present technical solution can specifically detect the V600E (c.1799T>A) mutation without cross-reacting with other similar sequences.

[0106] Table 6. Detection Results of V600E (c.1799T>A) Mutation

[0107]

[0108] Example 3

[0109] This example relates to a micro-detection verification experiment after diluting the sample volume.

[0110] Dilute the V600E (c.1799T>A) mutant plasmid to 1 copy / ul using the BRAF V600 WT sample, and perform digital PCR detection on the diluted sample using the reaction system shown in Table 1 of Example 1 [primer set 1, F: GAGTGAGCGCAGACGaaaCAGACAACTGTTCAAACTGATGG; R: TGAAGACCTCACAGTAAAAATAGGT; P: CGTCTGCGCTCACTCT(ROX)CTAGCTACAGAGAA(BHQ2)] and the amplification program shown in Table 2, and repeat the detection 21 times.

[0111] Use water as the blank control and BRAF V600 WT as the negative control. Take pictures under the condition of 40°C. As Figure 9 and 10 shown, for 21 V600E (c.1799T>A) mutant plasmids of 1 copy / ul, both the CY5 channel and the HEX channel are detected as positive; both channels of the blank control are normal and no detection is made; for the negative control BRAF V600 WT, the CY5 channel is detected as negative and the HEX channel is detected as positive.

[0112] The table shown in Table 7 indicates that the V600E (c.1799T>A) mutant detection primers designed according to this technical solution have good detection sensitivity.

[0113] Table 7. V600E (c.1799T>A) mutant detection results

[0114]

[0115]

[0116] It should be noted that the above specific embodiments are exemplary. Those skilled in the art can come up with various solutions inspired by the disclosure of the present invention, and these solutions also belong to the disclosure scope of the present invention and fall within the protection scope of the present invention. Those skilled in the art should understand that the specification and drawings of the present invention are illustrative and do not constitute a limitation to the claims. The protection scope of the present invention is defined by the claims and their equivalents.

Claims

1. A primer-probe combination for quantitative detection of human BRAF gene V600E mutation based on digital PCR, characterized in that: The primer-probe combination comprises an upstream primer, a downstream primer and a probe targeting the V600E mutation sequence of the human BRAF gene, wherein: The upstream primer has a sequence as shown in SEQ ID NO.20 from the 5' end; The probe has a sequence as shown in SEQ ID NO. 21 from the 5' end.

2. The primer-probe combination for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 1, characterized in that: The primer-probe combination includes the nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

3. The primer-probe combination for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 1 or 2, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group; The fluorescent group includes one or more of ALEX-350, FAM, VIC, TET, CAL FluorGold 540, JOE, HEX, CAL FluorOrange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL FluorRed 635, Quasar 670, CY3, CY5, CY5.5, and Quasar 705; The quenching group includes one or more of DABCYL, BHQ, ECLIPSE, and TAMRA.

4. The primer-probe combination for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to any one of claims 1 to 3, characterized in that: The right 16 bases of the 5' end of the probe are modified with a fluorescent group; the right 16 bases of the 5' end of the probe are modified with a fluorescent group.

5. A kit for quantitative detection of human BRAF gene V600E mutation based on digital PCR, characterized in that: The kit comprises the primer probe set for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to any one of claims 1 to 4.

6. The kit for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 4, characterized in that: The kit also contains 1 part of a template, 6 parts of a forward primer and 1 to 6 parts of a reverse primer in terms of substance concentration.

7. Use of the primer probe set for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to any one of claims 1 to 4, or the kit according to claim 5 or 6 in clinical auxiliary diagnosis and prognosis detection, characterized in that: The application includes melanoma, papillary thyroid cancer, colorectal cancer or non-small cell lung cancer caused by BRAF gene V600E mutation.

8. A device for quantitative detection of human BRAF gene V600E mutation based on digital PCR, characterized in that: The device comprises a data acquisition unit and a data processing unit; The data acquisition unit is used to perform the following steps: Using the genome in the sample to be tested as a template, digital PCR is performed using the primer probe set for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to any one of claims 1 to 4, and then fluorescent signal detection is performed; The data processing unit is used to perform the following operations: Interpret the results after digital PCR processing.

9. The device for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 8, characterized in that: The digital PCR reaction procedure comprises: Pre-denaturation at 95°C for 5 min; Denaturation at 94°C for 20 s and annealing at 56°C for 60 s were performed for a total of 45 cycles.

10. The device for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 8 or 9, characterized in that: The genome in the sample to be tested is derived from human blood, urine, cerebrospinal fluid, saliva, aqueous humor and / or feces.

Images