Molecular marker for screening EBV positive gastric cancer and application of molecular marker

Abstract

The invention relates to a molecular marker for screening EBV positive gastric cancer and application of the molecular marker, the molecular marker is OLFM4 protein in a patient sample, and the sample comprises at least one of the following samples: blood, gastric cancer tissue and blood microbubbles; the EBV activates a cGAS-STING signal, and the cGAS-STING effect protein IRF3 is combined with a promoter sequence of the OLFM4 protein, so that the expression of the OLFM4 is induced; the OLFM4 protein regulates a membrane receptor protein of a target cell Hippo pathway as FAT1, and the OLFM4 protein and the FAT1 protein are combined with each other, so that the Hippo signal activity is inhibited, the expression of YAP downstream target genes CTGF and CYR61 is promoted, the cell proliferation is promoted, and the tumor growth is promoted; specifically, an interaction region is formed by an extracellular Cadherin structure of OLFM4 protein and membrane protein FAT1, and the interaction region can be used as a specific drug target of EBV infected diseases. The OLFM4 protein can be used as a molecular marker for preparing an EBV positive gastric cancer diagnostic reagent and can be used as a drug target for screening drugs for treating EBV infected tumors, and the application has extremely high clinical application value.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to a molecular marker for screening EBV-positive gastric cancer and its application. Background Art

[0002] Microbial infection is an important pathogenic factor for many cancers including gastric cancer. Viruses are an important part of the human microbiota, and studies have shown that about 15-20% of cancers are caused by viruses. As the third most common cancer, gastric cancer, among which Epstein–Barr virus (EBV)-positive gastric cancer (EBV associated gastric carcinoma, EBVaGC) has a global incidence rate of nearly 10%, is a unique subtype of gastric cancer. It mostly occurs in the proximal (cardia) position and has relatively less lymph node metastasis. However, there is currently a lack of early molecular diagnostic markers and drug targets for EBV-positive subtype gastric cancer. EBV-positive gastric cancer patients are as difficult to detect and treat early as other types of gastric cancer patients. Once detected, it is basically in the advanced stage, and there is no special treatment method for EBVaGC. Most patients need to undergo surgical resection.

[0003] Extracellular vesicles are important carriers for cell communication in the tumor microenvironment and play an important role in shaping the tumor microenvironment and the occurrence and development of tumors. Specific molecules of some extracellular vesicles have also been found to be important diagnostic indicators for cancers. The modification of EBV-positive gastric cancer extracellular vesicles and their regulation of the tumor microenvironment are hot topics in this field, but so far, no molecular markers for early diagnosis and drug targets for precision treatment have been found. The Hippo signaling pathway is a key tumor suppressor pathway and plays an extremely important role in the occurrence and development of various cancers including gastric cancer. Abnormalities in the Hippo signaling pathway are usually present in gastric cancer, but the signal regulation mechanism of Hippo pathway abnormalities in EBV-positive gastric cancer has not been elucidated.

[0004] Aiming at the problems in the prior art, such as the lack of early molecular diagnostic markers and drug targets for EBV-positive subtype gastric cancer and the lack of effective specific precision treatment targeted drugs, no effective solution has been proposed. Summary of the Invention

[0005] The purpose of the present invention is to provide a molecular marker for screening EBV-positive gastric cancer and its application to address at least one deficiency in the prior art, such as the lack of early molecular diagnostic markers and drug targets for EBV-positive subtype gastric cancer and the lack of effective specific precision treatment targeted drugs.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is:

[0007] The first aspect of the present invention is to provide a molecular marker for the screening of EBV-positive gastric cancer. The molecular marker is OLFM4 protein in a patient sample, and the sample includes at least one of the following samples: blood, gastric cancer tissue, blood microvesicles.

[0008] Preferably, the above-mentioned molecular marker is OLFM4 protein in blood microvesicles.

[0009] Furthermore, the EBV virus activates the cGAS-STING signal, and the cGAS-STING effector protein IRF3 binds to the promoter sequence of the OLFM4 protein, thereby inducing the expression of OLFM4; wherein, the sequence of the promoter sequence of the OLFM4 protein is as shown in SEQ ID NO: 1.

[0010] The specific sequence of the above SEQ ID NO: 1 is: CCAAGTGGGAAACCAAATATT.

[0011] The second aspect of the present invention is to provide the application of OLFM4 protein as a molecular marker in the preparation of a diagnostic reagent for EBV-positive gastric cancer.

[0012] Furthermore, the diagnostic reagent is used to detect the expression level of OLFM4 protein in a patient sample, and the sample includes at least one of the following samples: blood, gastric cancer tissue, blood microvesicles.

[0013] Preferably, the sample is blood microvesicles.

[0014] The third aspect of the present invention is to provide the application of OLFM4 protein as a drug target in the screening of drugs for the treatment of EBV-infected tumors.

[0015] Furthermore, the membrane receptor protein of the Hippo pathway regulated by the OLFM4 protein in target cells is FAT1; wherein, the OLFM4 protein binds to the FAT1 protein, thereby inhibiting the activity of the Hippo signal, promoting the expression of YAP downstream target genes CTGF and CYR61, promoting cell proliferation, and promoting the growth of tumors.

[0016] Furthermore, the membrane protein FAT1 is an upstream regulatory protein of the Hippo signaling pathway.

[0017] Furthermore, the drug target is the region where the FAT1 protein interacts with the OLFM4 protein, denoted as the OLFM4-FAT1 interaction region.

[0018] Furthermore, the OLFM4-FAT1 interaction region includes the 10-18 and 28-33 regions of the extracellular Cadherin structure of FAT1; among them, the sequence of the 10-18 region of the Cadherin structure is shown in SEQ ID NO: 2, and the sequence of the 28-33 region of the Cadherin structure is shown in SEQ ID NO: 3.

[0019] The specific sequences of the above SEQ ID NO: 2 and SEQ ID NO: 3 are shown in the following table.

[0020]

[0021]

[0022] Furthermore, the binding between OLFM4 protein and the 28-33 region of Cadherin is the strongest.

[0023] Furthermore, the drug target is a drug that specifically inhibits the abnormal Hippo pathway caused by EBV infection.

[0024] Furthermore, the EBV-infected tumors include gastric cancer, nasopharyngeal carcinoma, oral squamous cell carcinoma, etc. caused by EBV infection.

[0025] The present invention adopts the above technical solutions, and compared with the prior art, has the following technical effects:

[0026] By analyzing the protein characteristics of extracellular vesicles secreted by EBV-positive gastric cancer, the present invention first proposes that EBV infection can induce high expression of OLFM4 (Olfactomedin-4) protein in gastric epithelial cells, and the OLFM4 in extracellular vesicles of human plasma samples from EBV-positive gastric cancer patients is also significantly upregulated. The OLFM4 protein is secreted through microvesicles (Large extracellular vesicles, or Microvesicle, MV), and the OLFM4 carried by microvesicles can bind to the outer membrane protein FAT1 (FAT atypical cadherin 1) of target cells, and promote the occurrence and development of gastric cancer by regulating the activity of the Hippo signaling pathway in target cells. The drug target is determined as the region where the extracellular segment of FAT1 interacts with OLFM4. The interaction target of the outer membrane protein avoids the disadvantage that drug molecules targeting intracellular targets are difficult to penetrate the cell membrane to exert their effects, provides a good molecular target for drug development, and can be used to early evaluate the potential risk of EBV-positive gastric cancer. Therefore, taking the expression level of blood microvesicle OLFM4 as an early diagnostic marker for EBV-infected gastric cancer, developing drugs that specifically inhibit the abnormal Hippo pathway caused by EBV infection, blocking the malignant hyperplasia and carcinogenesis of infected tissues, and providing a highly specific and easily deliverable drug target for the specific and precise treatment of EBV-infected gastric cancer and even other EBV-infected lesions such as nasopharyngeal carcinoma, which has important research significance and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The drawings described herein are used to provide a further understanding of the present invention, and constitute a part of the present invention. The schematic embodiments of the present invention and their descriptions are only used to explain the present invention, and do not constitute an improper limitation of the present invention. In the drawings:

[0028] Figure 1 is a result diagram of EBV infection inducing high expression of OLFM4 in an embodiment of the present invention;

[0029] Figure 2 is a result diagram of the cGAS-STING effector protein IRF3 binding to OLFM4 in an embodiment of the present invention;

[0030] Figure 3 is a result diagram of the positive correlation experiment between high expression of OLFM4 and EBV infection in an embodiment of the present invention;

[0031] Figure 4 is a result diagram of OLFM4 promoting the proliferation of tumor cells in an embodiment of the present invention;

[0032] Figure 5 is a result diagram of OLFM4 binding to the FAT1 cadherin domain in an embodiment of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0033] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts belong to the scope of protection of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually determined according to national standards. The experimental materials not indicated in the following embodiments are all commercially available raw materials. The equipment used in each step in the following embodiments is all conventional equipment. If there is no corresponding national standard, it is carried out according to the general international standard, conventional conditions, or the conditions recommended by the manufacturer. Unless otherwise stated, all parts are by weight and all percentages are by mass percentage. Unless otherwise defined or explained, all professional and scientific terms used in the present invention have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the method of the present invention.

[0034] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but it is not a limitation of the present invention.

[0035] For those embodiments without special marking of the manufacturer, they can be obtained conventionally through commercial purchase.

[0036] In the following embodiments, the basic experimental methods and steps involved include:

[0037] 1. Cell culture:

[0038] Cell lines such as gastric cancer cell HGC-27, gastric epithelial cell GES-1, and HEK293T were all purchased from the ATCC Biological Resource Center.

[0039] HGC-27 and GES-1 cells were respectively cultured in RPMI1640 medium (Invitrogen). HEK293T was cultured in DMEM medium (Invitrogen). 10% serum, 100 μg / mL penicillin, and 100 μg / mL streptomycin were added to the culture medium. The cells were cultured in an incubator at 37 °C and 5% CO 2 concentration.

[0040] 2. Immunoblotting:

[0041] Prepare the corresponding protein samples according to specific experimental requirements, add 4×SDS loading buffer, boil in a boiling water bath for 10 minutes, centrifuge at 12,000 rpm for 5 minutes, and take an equal amount of the supernatant and add it to the loading wells of a 10-12% SDS-PAGE gel. When the sample is in the stacking gel, electrophorese at 80 V for 10 minutes, and when in the separating gel, electrophorese at 150 V for 60 minutes.

[0042] After the electrophoresis is completed, remove the gel and soak it in the electrotransfer buffer. According to the requirements of the electrotransfer equipment, install the electrotransfer device in sequence: (cathode), filter paper, SDS-PAGE gel, PVDF membrane, filter paper, (anode). Electrotransfer: Place the electrotransfer device in an ice bath at 4°C, and electrotransfer at a constant current of 300 mA and 90 V for 1.5 h.

[0043] After the electrotransfer is completed, take out the PVDF membrane and block it in 5% skim milk prepared in PBS buffer for 1 h. Primary antibody: Add the primary antibody diluted with 5% BSA solution (use the dilution ratio according to the antibody instructions), and incubate overnight on a shaker in a 4°C cold storage. Take out the membrane, wash the membrane with PBS buffer, 5 min / time, for a total of 3 times. Add the secondary antibody (with HRP) diluted with 5% skim milk, and incubate on a shaker at room temperature for 1 h. Remove the secondary antibody solution, wash the PVDF membrane with PBS buffer 3 times, 15 minutes each time. Prepare the ECL luminescent reagent, cover the PVDF membrane with the ECL developing solution, and take pictures with a chemiluminescence imager.

[0044] 3. Microbubble extraction:

[0045] Culture and treat cells according to the experiment, and take the cell culture supernatant. For tissues, first cut them into small pieces in PBS with scissors and transfer them to an EP tube. Then centrifuge the cell culture supernatant or the minced tissue sample at 500 g for 5 min at 4°C, transfer the supernatant to a new centrifuge tube, centrifuge at 12,500 g for 5 min with a 4°C centrifuge, and then transfer the supernatant to a new centrifuge tube and centrifuge at 16,500 g for 45 min at 4°C to collect the precipitate to obtain microbubbles, and store them in an -80°C refrigerator.

[0046] The following exemplarily illustrates the present invention.

[0047] Example 1 - EBV virus infection can induce gastric cancer cells to express OLFM4 protein and secrete it through microbubbles

[0048] This example verified whether EBV infection can induce the expression and secretion of OLFM4 protein, specifically including the following steps:

[0049] (1) Experimental method:

[0050] a) Protein immunoblotting experiment:

[0051] The HGC-27 and GES-1 cells were cultured in 1640 medium until they reached 80% density, and then treated with 10 MOI of EBV virus for 0, 24, and 48 hours. After the cells were washed 3 times with PBS, they were digested with 0.25% Trypsin to collect the cells. The cells were lysed on ice with RIPA lysis buffer for 30 minutes and then centrifuged at 12,000 g for 5 minutes. The supernatant of the cell culture medium after virus treatment was used for microbubble extraction. After the microbubbles were obtained, they were lysed with RIPA lysis buffer for 30 minutes.

[0052] The supernatant of the cell lysate was added with 4× protein electrophoresis loading buffer, boiled in a metal bath at 99 °C for 10 minutes, and then subjected to SDS-PAGE electrophoresis and membrane transfer. Among them, the primary antibodies were: OLFM4 antibody (14369, Cell signaling technology, 1:1000), EBNA-1 antibody (sc-81581, Santa Cruz, 1:1000), MMP2 antibody (ab92536, abcam, 1:1000), β-actin antibody (#A5441, Sigma, 1:5000); the secondary antibodies were: Goat anti-Rabbit IgG (31460, ThermoScientific, 1:10000), Goat anti-Mouse IgG (31430, Thermo Scientific).

[0053] b) qPCR experiment: The HGC-27 or GES-1 cells were treated with 10 MOI of EBV virus for 0, 6, 12, and 24 hours. The cells were digested with trypsin to obtain the cells, and RNA was extracted with RNAisolater reagent (R401-01, Vazyme), and then reverse transcribed into cDNA with a reverse transcription kit (R212-01, Vazyme).

[0054] Forward primer for OLFM4: ACTGTCCGAATTGACATCATGG;

[0055] Reverse primer sequence for OLFM4: TTCTGAGCTTCCACCAAAACTC;

[0056] Forward primer for the internal reference gene GAPDH: GGAGCGAGATCCCTCCAAAAT;

[0057] Reverse primer sequence for the internal reference gene GAPDH: GGCTGTTGTCATACTTCTCATGG.

[0058] (2) Experimental results and analysis:

[0059] As Figure 1As shown, the expression of OLFM4 in gastric cancer cells HGC-27 and normal gastric epithelial cells GES-1 was significantly upregulated after EBV treatment and increased with the time gradient ( Figure 1 part a). The content of OLFM4 in the extracted microvesicles was also significantly increased ( Figure 1 part b), indicating that after OLFM4 was upregulated, it could be secreted through microvesicles.

[0060] Furthermore, the RNA of gastric cancer cells HGC-27 and normal gastric epithelial cells GES-1 after EBV treatment was extracted and detected. It was found that the mRNA level of OLFM4 in cells was significantly upregulated after EBV stimulation, indicating that EBV stimulation promoted the expression of the OLFM4 gene at the gene transcription level ( Figure 1 part c).

[0061] Example 2 - cGAS - STING binds to and promotes the transcriptional expression of OLFM4

[0062] In this example, in order to find the molecular mechanism by which cGAS - STING regulates OLFM4, the specific experiments adopted included the following steps:

[0063] (1) Experimental method:

[0064] a) Western blot assay: HGC-27 cells were cultured in 1640 medium until 80% confluence, and then treated with STING agonist (cGAMP) and cGAS inhibitor (RU.521) for 24 h. The concentration gradients of the agonist and inhibitor were 0, 2.5, and 10 μM; among them, the primary antibodies were: OLFM4 antibody (14369, Cell signaling technology, 1:1000), β-actin antibody (#A5441, Sigma, 1:5000).

[0065] b) qPCR assay: After HGC-27 cells were treated with STING agonist cGAMP for 0, 6, 12, and 24 h, the cells were digested with trypsin to obtain cells, and RNA was extracted with RNAisolater reagent (R401-01, Vazyme), and then reverse transcribed into cDNA with a reverse transcription kit (R212-01, Vazyme). SYBR Green fluorescence quantitative PCR reagent SYBR qPCR Master Mix (Vazyme) was used for quantitative PCR detection by the two-step method.

[0066] Forward primer for OLFM4: ACTGTCCGAATTGACATCATGG;

[0067] Reverse primer sequence of OLFM4: TTCTGAGCTTCCACCAAAACTC;

[0068] Forward primer of reference gene GAPDH: GGAGCGAGATCCCTCCAAAAT;

[0069] Reverse primer sequence of reference gene GAPDH: GGCTGTTGTCATACTTCTCATGG.

[0070] c) ChIP-qPCR experiment: HGC-27 cells were treated with 10 MOI of EBV for 0 and 6 h, 37% formaldehyde was added for cross-linking for 15 min, then glycine was added to a final concentration of 125 mM. After 5 min, the cells were washed with cold PBS. ChIP lysis buffer (50 mM Hepes / KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton-X100, 0.1% sodium deoxycholate, protease inhibitor mixture) was added to the cells, and the cells were collected with a cell scraper. The supernatant was removed by centrifugation at 500 g, and the cells were resuspended in 300 μL of CHIP lysis buffer. The cells were lysed and the DNA was fragmented using an ultrasonic crusher (420 W, on 30 s, off 30 s, 10 min). The samples were centrifuged at 10,000×g for 5 min at 4 °C. CHIP-grade IRF3 antibody (PA5-88077, Thermo Scientific) was added to the supernatant and incubated overnight.

[0071] Pre-washed Protein A / G-sepharose beads were added and incubated for 2 h, and then washed with ChIP lysis buffer, lysis buffer containing 0.5 M NaCl, Tris / LiCl buffer (10 mM Tris, 0.25 M LiCl, 0.5% NP40, 0.5% sodium deoxycholate, 1 mM EDTA), and Tris / EDTA buffer (10 mM Tris, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM ethylenediaminetetraacetic acid) for 5 min each. 100 μL of 10% chelate (1422822, Biorad) was directly added to the washed beads, and the samples were boiled for 10 min. Proteinase K was added and heated at 55 °C for 30 min. The samples were boiled for 10 min, centrifuged, and the supernatant was collected and stored in a -80 °C refrigerator.

[0072] qPCR assay of OLFM4: The qPCR primers for OLFM4 detection are shown below:

[0073] Primer F: AGACTACTTTGGTCTCATCTC, Primer R: CTCCAAACATTAACTCAATG.

[0074] The JASPAR software predicted the binding site of IRF3 on OLFM4, that is, the promoter sequence of OLFM4 is shown in SEQ ID NO: 1: CCAAGTGGGAAACCAAATATT.

[0075] (2) Experimental results and analysis:

[0076] It is known that EBV virus treatment can activate the cGAS-STING signal. In this example, HGC-27 cells were directly stimulated with the STING agonist cGAMP, and the results are as Figure 2 shown. It was found that OLFM4 was also significantly induced to express, while the cGAS inhibitor RU.521 inhibited the expression of OLFM4 ( Figure 2 part a). At the same time, in this example, it was detected at the mRNA level that cGAMP could induce the mRNA transcription of OLFM4 ( Figure 2 part b). Thus, the binding site of the cGAS-STING effector protein IRF3 on the OLFM4 promoter was predicted, and primers were designed according to this site for ChIP-qPCR experiments, and it was found that IRF3 could bind to the promoter region of OLFM4 ( Figure 2 part c).

[0077] Example 3 - The expression of OLFM4 in EBV-positive patient tissues and blood microvesicles was significantly upregulated

[0078] In this example, in order to determine whether there is a correlation between EBV infection in gastric cancer and the expression of OLFM4 protein, the specific experiments adopted included the following steps:

[0079] (1) Experimental method:

[0080] a) Tissue chip experiment: The gastric cancer tissue chip experiment was completed by Shanghai Outdo Biotech Co., Ltd. The EBER-1 probe of EBV was used for fluorescence in situ hybridization (FISH), and the sequence: 5'-CTCCTCCCTAGCAAAACCCAGGACGGCC-3'. Using the same gastric cancer tissue chip array as the FISH experiment, OLFM4 immunohistochemistry detection used the antibody OLFM4 (14369, Cell signaling technology).

[0081] b) Western blot assay: Total proteins and microvesicles were extracted from tumor resection tissue samples of gastric cancer patients, as well as microvesicles from the corresponding blood samples of the patients. Protein samples were lysed with RIPA lysis buffer, electrophoresed by SDS-PAGE, and transferred to a PVDF membrane; among them, the primary antibodies were: OLFM4 antibody (14369, Cell signaling technology, 1:1000), EBNA-1 antibody (sc-81581, Santa Cruz, 1:1000), MMP2 antibody (ab92536, abcam, 1:1000), β-actin antibody (#A5441, Sigma, 1:5000).

[0082] (2) Experimental results and analysis:

[0083] The results are as Figure 3 shown. Through FISH detection with the EBER-1 probe of the gastric cancer tissue microarray, the EBV infection rate was found to be approximately 14.9% ( Figure 3 parts a and b), and the proportion of EBV infection in the cardia reached 64% ( Figure 3 part c). At the same time, the expression of OLFM4 in the gastric cancer tissue microarray was detected using antibodies, and it was found that the probability of high expression of OLFM4 in the cardia was higher than that in non-cardia, reaching approximately 29% ( Figure 3 parts d and e). By comprehensively analyzing the FISH results and OLFM4 immunohistochemical detection results of gastric cancer tissues, it was found that the higher the expression of OLFM4 in gastric cancer tissues with more severe EBV infection, and there was a high correlation between the two ( Figure 3 parts f and g).

[0084] Meanwhile, in this example, total proteins of 17 gastric cancer tissues were extracted and detected, and the proteins in the blood microvesicles of these patients were also detected. It was found that the expression level of OLFM4 in the tissues of 7 EBV-positive patients was significantly up-regulated, and among them, the expression level of OLFM4 in the blood microvesicles of 6 patients was also significantly up-regulated ( Figure 3 parts h and i). Thus, it can be known that OLFM4 is a potential biomarker for EBV infection, and blood microvesicle OLFM4 is a potential early diagnostic marker for EBV-infected tumors.

[0085] Example 4 - Microvesicle OLFM4 can inhibit the Hippo signaling activity of recipient cells and promote cell proliferation

[0086] In this example, to clarify the functional mechanism of OLFM4 in tumorigenesis and development, the experiments adopted specifically included the following steps:

[0087] (1) Experimental method:

[0088] a) Western blot assay: Plasmid pcDNA3.1+OLFM4 was transfected into HEK293T cells to overexpress OLFM4. The cell culture supernatant was collected and microvesicles were extracted. The microvesicles from the cell culture supernatant of HEK293T cells transfected with pcDNA3.1+empty plasmid served as the control group. HGC-27 cells were treated with 3×10 8 microvesicle particles for 8 h. After washing the cells with PBS, the cells were collected and lysed with RIPA lysis buffer to extract proteins for Western blot detection. Among them, the primary antibodies were: YAP antibody (sc-101199, Santa Cruz, 1:1000), p-YAP(s127) antibody (4911S, Cell signaling technology, 1:2000), MOB1 antibody (13730S, Cell signaling technology, 1:2000), p-MOB1 antibody (14969, Cell signaling technology, 1:2000), β-actin antibody (#A5441, Sigma, 1:5000).

[0089] b) qPCR assay: Microvesicles overexpressing OLFM4 were prepared and extracted. The treatment of HGC-27 cells was the same as in step a). The treated HGC-27 cells were used to extract RNA with RNA isolater for qPCR detection. The methods for RNA extraction, reverse transcription PCR, and quantitative PCR refer to Example 2.

[0090] Forward primer sequence of CTGF: ACCGACTGGAAGACACGTTTG;

[0091] Reverse primer sequence of CTGF: CCAGGTCAGCTTCGCAAGG;

[0092] Forward primer sequence of CYR61: CTCGCCTTAGTCGTCACCC;

[0093] Reverse primer sequence of CYR61: CGCCGAAGTTGCATTCCAG;

[0094] Forward primer of internal reference gene GAPDH: GGAGCGAGATCCCTCCAAAAT;

[0095] Reverse primer sequence of internal reference gene GAPDH: GGCTGTTGTCATACTTCTCATGG.

[0096] c) Colony formation assay: HGC-27 cells were cultured, digested and counted with a cell counter. The cells were seeded into 6-well plates at 2000 cells per well with 2 mL of 1640 culture medium. At 37 °C in CO2 Cultivate for one week in a cell incubator. Change the culture medium every other day and add new microbubbles. After culturing the cells for one week, remove the culture medium, wash the cells with PBS, then add 1 mL of 4% formaldehyde fixative to fix the cells for 30 min, wash the cells once with PBS for 5 min, add crystal violet staining solution (C0121, Beyotime) to stain for 30 min, wash the cells twice with PBS, and finally take pictures and count the number of colony formations using ImageJ software.

[0097] d) Subcutaneous tumor formation experiment in mice: Male nude mice (3 - 4 weeks old) used in the experiment were obtained from the Shanghai Laboratory Animal Center and maintained under pathogen - free conditions according to the guiding principles of the Institutional Animal Care and Use Committee of the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (SIBCB, Shanghai). The animal use license number is No.SIBCB - SIBCB - NAF - 14 - 004 - S329 - 023.

[0098] Inject HGC - 27 cells (1×10 6 cells, 100 μL) subcutaneously into the back of 4 - week - old nude mice. Subcutaneous tumors began to appear one week later. Start injecting microbubbles derived from OLFM4 - overexpressing HEK293T cells or microbubbles of HEK293T cells expressing empty vector (3×10 8 particles in 10 μL PBS) into the tumors every other day. After 21 days, euthanize the mice, take out the tumor tissues for photographing, and measure the weight of the tumors. The tumor tissues are ground and broken for RNA extraction and quantitative PCR detection.

[0099] (2) Experimental results and analysis:

[0100] The results are as Figure 4 shown. It was found by Western blot detection that microbubbles overexpressing OLFM4 could significantly inhibit the Hippo signaling activity of gastric cancer cells HGC - 27 ( Figure 4 part a), and promote the expression of YAP downstream target genes CTGF and CYR61 ( Figure 4 part b). The cell colony formation experiment showed that microbubbles overexpressing OLFM4 had the effect of promoting cell proliferation ( Figure 4 part c), and the subcutaneous tumor formation experiment in mice also showed that microbubbles overexpressing OLFM4 could promote tumor growth ( Figure 4 parts d, e, f).

[0101] Example 5 - OLFM4 can bind to the FAT1 cadherin domain of the receptor cell membrane protein

[0102] In this example, in order to identify the receptor protein of OLFM4 on target cells, the specific experiment includes the following steps:

[0103] (1) Experimental method:

[0104] a) Immunofluorescence co-localization experiment: HGC-27 cells were cultured in a confocal dish with a glass bottom (NEST). 3×10 8 Microbubbles obtained from overexpressing pcDNA3.1-HA-OLFM4 in HEK293T cells were added. After 12 hours of treatment, the cells were washed 3 times with PBS, fixed with 4% PFA for 30 minutes, then treated with PBS containing 0.1% Triton X-100 for 5 minutes, and blocked with 3% BSA (prepared with PBS) for 1 hour. The primary antibodies were added and incubated overnight at 4°C. The next day, the cells were taken out, washed 3 times with PBS; the secondary antibody was added and incubated at room temperature for 1 hour. After washing 3 times with PBS, pictures were taken with a confocal microscope (Zeiss LSM900) under a 63× oil immersion lens; among them, the primary antibodies were: HA Tag antibody (3724T, Cell signaling Technology, 1:200), FAT1 antibody (sc-53283, Santa Cruz, 1:200).

[0105] b) Pull-down experiment: According to the structures of OLFM4 and FAT1, they were designed and constructed into the pET28a vector respectively. Through the BL21(DE3) prokaryotic expression system, GST-OLFM4 and 6×His-FAT1 fragment proteins were induced to express by IPTG and purified. The purified proteins were used for the Pull-down experiment. 20 μg of GST-labeled OLFM4 protein and 20 μg of 6×His-FAT1 cadherin fragment protein were added to PBS containing 0.5% Triton X-100 and 1 mM PMSF and mixed, and then added to Glutathione Sepharose 4B beads that had been blocked with 5% BSA for 1 hour, and bound at 4°C for 4 hours. After binding, it was washed three times with PBS, and then the bound protein was eluted with PBS containing 10 mM reduced glutathione. The eluted protein was used for SDS-PAGE and membrane transfer; among them, the primary antibodies were: 6×His antibody (HRP-66005, Proteintech, 1:2000), OLFM4 antibody (14369, Cell signalingtechnology, 1:1000).

[0106] c) Co-immunoprecipitation experiment: Construct the pcDNA3.1-3×FLAG-FAT1 plasmid and co-transfect it with the pcDNA3.1-HA-OLFM4 plasmid into HEK293T cells. After 48 h, collect the cells. Treat the cells with the cross-linking agent DSP (22586, Thermo Scientific) at 4°C for 2 h, and then lyse the cells in NP40 lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% NP-40, 10 mM NaF, 1 mM EDTA, Protease inhibitor cocktail) in an ice bath for 30 min. Then centrifuge at 12,000 g for 10 min at 4°C. Block the FLAG beads (M8823, Merk) with 5% BSA for 1 h, and then wash them three times with NP40 lysis buffer. Add the cell lysate to the FLAG beads and incubate at 4°C for 2 h. Centrifuge at 2,000 g for 2 min, wash the magnetic beads three times with NP40 lysis buffer, and then add the loading buffer to boil the samples for SDS-PAGE and Western blot detection. Among them, the primary antibodies are: FLAG Tag antibody (66008-4-Ig, Proteintech, 1:2000), HA Tag antibody (3724T, Cell signaling Technology, 1:2000), LATS1 antibody (9153, Cell Signaling Technology, 1:1000), MOB1 antibody (13730S, Cell Signaling Technology, 1:2000), MST1 antibody (3682S, Cell Signaling Technology, 1:2000).

[0107] (2) Experimental results and analysis:

[0108] The results are as Figure 5 shown. The results of immunofluorescence confocal experiments show that the HA-OLFM4 protein in microbubbles has significant co-localization with the target cell membrane protein FAT1 ( Figure 5 part a). Through prokaryotic expression, GST-OLFM4 and different FAT1 fragments labeled with 6×His are obtained ( Figure 5 part b), and the expression effect is determined by Coomassie Brilliant Blue staining ( Figure 5 part c). The results of GST Pull down experiments show that OLFM4 can bind to the Cadherin 10-18 fragment and Cadherin 28-33 fragment of FAT1 ( Figure 5part d), wherein the sequence of the Cadherin 10-18 fragment is as shown in SEQ ID NO: 2, and the sequence of the Cadherin 28-33 fragment is as shown in SEQ ID NO: 3.

[0109] Furthermore, in this example, HA-OLFM4 and FLAG-FAT1 proteins were co-expressed in HEK293T cells ( Figure 5 part e). Through co-immunoprecipitation experiments, it was found that overexpression of OLFM4 could inhibit the binding of FAT1 to MST1 ( Figure 5 part f). It is known that FAT1 is an upstream kinase of the Hippo pathway and can activate the Hippo pathway by binding to MST1, LATS1, etc. to form a Hippo signal complex (signalome). The binding of OLFM4 to FAT1 affects the assembly of the signalome, thereby inhibiting the activation of the Hippo pathway. Thus, it was determined that the membrane receptor protein of the OLFM4-regulated Hippo pathway in target cells is FAT1.

[0110] In summary, the present invention proposes OLFM4, a key specific protein that promotes atypical malignant proliferation and carcinogenesis of tissues by EBV virus, as a molecular marker based on the expression level of blood microbubble OLFM4. Among them, OLFM4 can inhibit the Hippo signal activity of receptor cells and promote cell proliferation, and can be used to evaluate the carcinogenic risk of EBV infection in the early stage of infection; the membrane receptor protein of OLFM4 on target cells is FAT1, and the OLFM4-FAT1 interaction region can be used as a drug target specific for EBV infection diseases, providing a very promising specific molecular drug target for EBV-positive gastric cancer and other EBV infection-related diseases such as nasopharyngeal carcinoma and oral squamous cell carcinoma. The OLFM4 protein can be used as a molecular marker to prepare a diagnostic reagent for EBV-positive gastric cancer, the OLFM4 protein can be used as a drug target to screen drugs for treating EBV-infected tumors, and can also be used to prepare reagents for promoting the growth, proliferation and / or migration of tumor cells. Its application has extremely high clinical application value, providing an opportunity for early detection and early treatment of current EBV-positive gastric cancer patients.

[0111] The above are only preferred embodiments of the present invention, and do not limit the implementation manner and protection scope of the present invention. For those skilled in the art, it should be able to realize that any equivalent replacement and obvious changes made by using the description and drawings of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker for EBV-positive gastric cancer screening, characterized in that: The molecular marker is OLFM4 protein in a patient sample, and the sample includes at least one of the following samples: blood, gastric cancer tissue, and blood microvesicles.

2. The molecular marker according to claim 1, characterized in that EBV virus activates cGAS-STING signal, and cGAS-STING effector protein IRF3 binds to the promoter sequence of OLFM4 protein, thereby inducing the expression of OLFM4; wherein, the sequence of the promoter sequence of the OLFM4 protein is shown in SEQ ID NO:

1.

3. Application of OLFM4 protein as a molecular marker in the preparation of EBV-positive gastric cancer diagnostic reagents.

4. The use according to claim 3, characterized in that: The diagnostic reagent is used to detect the expression level of OLFM4 protein in a patient sample, and the sample includes at least one of the following samples: blood, gastric cancer tissue, and blood microvesicles.

5. Application of OLFM4 protein as a drug target in screening drugs for treating EBV-infected tumors.

6. The use according to claim 5, characterized in that: The membrane receptor protein of the Hippo pathway of the target cell regulated by the OLFM4 protein is FAT1; wherein, the OLFM4 protein binds to the FAT1 protein, thereby inhibiting the Hippo signaling activity, promoting the expression of the YAP downstream target genes CTGF and CYR61, promoting cell proliferation, and promoting tumor growth.

7. The use according to claim 6, characterized in that: The drug target is the region where the FAT1 protein interacts with the OLFM4 protein, which is denoted as the OLFM4-FAT1 interaction region.

8. The use according to claim 7, characterized in that: The OLFM4-FAT1 interaction region includes the 10-18 and 28-33 regions of the FAT1 extracellular Cadherin structure; wherein the sequence of the 10-18 region of the Cadherin structure is shown in SEQ ID NO: 2, and the sequence of the 28-33 region of the Cadherin structure is shown in SEQ ID NO:

3.

9. The use according to any one of claims 5 to 8, characterized in that: The drug target is a drug that specifically inhibits the abnormality of the Hippo pathway caused by EBV infection.

10. The use according to any one of claims 5 to 8, characterized in that: The EBV-infected tumors include gastric cancer, nasopharyngeal carcinoma, and oral squamous cell carcinoma caused by EBV infection.

Images