Protein marker for lung metastasis of primary liver cancer and application of protein marker

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a protein marker for lung metastasis of primary liver cancer and application of the protein marker. The invention discloses a protein marker for lung metastasis of primary liver cancer. The protein marker is selected from at least one of rs2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein and mospd2 protein. According to the invention, mass spectrometry is carried out by using an HPLC-MS / MS mass spectrometry system and an unlabeled quantitative proteomics method; and then searching mass spectrum data by utilizing a non-limited amino acid protein modification analysis method, and verifying whether differential protein substances have significance or not according to P-value, so as to finally obtain six proteins with significant difference, namely, the rs2 protein, the rcsd1 protein, the rbbp9 protein, the prl6a1 protein, the ubxn4 protein and the mospd2 protein. The protein marker provided by the invention has higher sensitivity and specificity, and the combination of the six proteins has better detection efficacy.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to a protein biomarker for pulmonary metastasis of primary liver cancer and its application. Background Art

[0002] China is a country with a high incidence of liver cancer. According to the data released by the National Cancer Center, in 2015, the number of new liver cancer cases in China was 370,000, ranking the 4th among malignant tumors, and the number of death cases was 326,000, ranking the 2nd among malignant tumors. Liver cancer mostly occurs in middle-aged men, and the male-female incidence ratio is about 3.5:1. Liver cancer can be divided into primary liver cancer and secondary liver cancer according to the etiology. Among them, secondary liver cancer mainly refers to the cancer metastasized from the gastrointestinal tract and other digestive tracts through the portal vein. The high incidence of liver cancer in China is mainly related to factors such as hepatitis B infection, alcohol abuse, and aflatoxin intake. Liver cancer often has no symptoms in the early stage. When symptoms such as abdominal pain, abdominal distension, and weight loss appear, it often reaches the advanced stage. Advanced liver cancer mainly refers to liver cancer with distant metastasis. The most common distant metastatic organs of liver cancer are the lungs and bones. The pathological types of liver cancer can be divided into hepatocellular carcinoma, cholangiocarcinoma, and mixed liver cancer, and are divided into 4 grades according to the degree of differentiation. Due to the different pathological types and degrees of differentiation, the probability of distant metastasis is also different.

[0003] When liver cancer has distant metastasis, the main treatment method is chemotherapy. When there is no distant metastasis, the treatment methods are mainly surgical resection and radiofrequency ablation. Therefore, evaluating whether liver cancer has distant metastasis has a decisive impact on the treatment method and long-term treatment effect of patients. However, at present, evaluating whether there is distant metastasis mostly relies on chest CT or MRI. Since both CT and MRI are tomographic scans, that is, each layer is scanned every 3-5 mm. For early metastatic liver cancer with a volume less than 3 mm, the current imaging examination results cannot detect it. Therefore, the current examination and treatment methods have a high missed diagnosis rate and misdiagnosis rate, which leads to the remaining of cancer cells in the distant part after surgical treatment for some patients with already metastasized cancer.

[0004] The invention patent CN202010928818.5 discloses a biomarker for predicting pulmonary metastasis of liver cancer and its application, that is, predicting pulmonary metastasis of liver cancer by detecting the expression level of the Sgk1 gene. However, a single diagnostic marker often has low diagnostic efficacy, and more diagnostic markers are needed to improve the diagnostic efficacy. Therefore, it is of great significance to provide a diagnostic reagent that can determine whether there is pulmonary metastasis in the distant part of liver cancer. Summary of the Invention

[0005] One of the objectives of the present invention is to provide a protein biomarker for pulmonary metastasis of primary liver cancer. The rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein have high sensitivity and specificity, and the combination of these six proteins has better diagnostic efficacy, higher sensitivity, and specificity.

[0006] The technical solution of a protein biomarker for pulmonary metastasis of primary liver cancer of the present invention is as follows: A protein biomarker for pulmonary metastasis of primary liver cancer, wherein the protein biomarker is selected from at least one of the rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein.

[0007] Another objective of the present invention is to provide an application of a protein biomarker for pulmonary metastasis of primary liver cancer. The expression of the rcsd1 protein, prl6a1 protein, rbbp9 protein, and rars2 protein increases in pulmonary metastasis of primary liver cancer, while the expression of the mospd2 protein and ubxn4 protein decreases in pulmonary metastasis of primary liver cancer. These six proteins can be used as targets for the screening and preparation of diagnostic reagents, kits, or therapeutic drugs for pulmonary metastasis of primary liver cancer.

[0008] The technical solution of an application of a protein biomarker for pulmonary metastasis of primary liver cancer of the present invention is as follows: An application of a protein biomarker for pulmonary metastasis of primary liver cancer in the preparation of diagnostic reagents, kits, or therapeutic drugs for pulmonary metastasis of primary liver cancer, wherein the protein biomarker is selected from at least one of the rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein.

[0009] Preferably, the diagnostic reagent or kit contains a reagent for specifically detecting the expression level of the protein biomarker.

[0010] More preferably, the diagnostic reagent or kit diagnoses whether pulmonary metastasis of primary liver cancer has occurred by detecting the expression level of the protein biomarker in primary liver cancer tissues.

[0011] Even more preferably, the expression levels of the rcsd1 protein, prl6a1 protein, rbbp9 protein, and rars2 protein are positively correlated with pulmonary metastasis of primary liver cancer. Even further preferably, the expression levels of the mospd2 protein and ubxn4 protein are negatively correlated with pulmonary metastasis of primary liver cancer.

[0012] Preferably, at least one of the rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, andmospd2 protein is used as a target for screening or preparing a therapeutic drug for pulmonary metastasis of primary liver cancer.

[0013] More preferably, the drug comprises a reagent that inhibits the expression of the rcsd1 protein, prl6a1 protein, rbbp9 protein, and / or rars2 protein.

[0014] Even more preferably, the drug comprises a reagent that promotes the expression of the mospd2 protein and / or ubxn4 protein.

[0015] Beneficial effects: In the present invention, liver cancer tissue specimens were first collected from 30 liver cancer patients with and 30 without pulmonary metastasis, and then 15 pairs of them were subjected to in-depth mass spectrometry analysis using an HPLC-MS / MS mass spectrometry system and a label-free quantitative proteomics method; then, the non-limiting amino acid protein modification analysis method was used to search the mass spectrometry data, and the analyzed proteins were displayed using a volcano plot, and the differential proteins were verified for significance according to the P-value. Proteins with a multi-dimensional statistical analysis Fold change > 2 or < 0.5 and a univariate statistical analysis P value < 0.05 were selected as significantly different proteins. The results showed that the expressions of the rcsd1 protein, prl6a1 protein, rbbp9 protein, and rars2 protein increased, while the expressions of the mospd2 protein and ubxn4 protein decreased.

[0016] In the present invention, the screened differential proteins (rcsd1 protein, prl6a1 protein, rbbp9 protein, rars2 protein, mospd2 protein, and ubxn4 protein) were verified by PCR and WB. In addition, blood specimens were collected from 37 liver cancer patients with and 37 without pulmonary metastasis for verification, and an ROC curve was plotted. An equation was calculated through linear regression, and the ROC curve was obtained using the equation. The area under the AUC curve was 0.9869, indicating better detection efficacy. Description of the Drawings

[0017] Figure 1 It is a volcano plot of differential proteins of liver cancer tissue specimens of 15 pairs of liver cancer patients with / without pulmonary metastasis analyzed by mass spectrometry; Figure 2To verify the differential proteins in liver cancer tissue specimens of 30 liver cancer patients with / without lung metastasis by PCR. Among them, A is the PCR verification diagram of rars2 protein, B is the PCR verification diagram of rcsd1 protein, C is the PCR verification diagram of rbbp9 protein, D is the PCR verification diagram of prl6a1 protein, E is the PCR verification diagram of ubxn4 protein, and F is the PCR verification diagram of mospd2 protein; Figure 3 To verify the differential proteins by Western blot. Among them, A is the WB band of 6 differential proteins, and B - G are the statistical graphs of the gray values of the WB bands of rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein respectively; Figure 4 For the ROC curve, among which A - F are the ROC results of rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein respectively, and G is the ROC curve of the application equation obtained by linear regression. Specific implementation manner

[0018] The embodiments of the present invention will be described in detail below. The examples of the embodiments are shown in the accompanying drawings. The embodiments described below by referring to the drawings are exemplary and are intended to explain the present invention and should not be construed as a limitation to the present invention.

[0019] I. Experimental part 1. Tissue / blood proteomic analysis Take out the liver cancer tissue / blood samples stored at -80°C, and after completely thawing on ice, wash them twice with PBS pre-cooled at 4°C. Then add 200 μL of ddH 2 O to each sample and homogenize it with a homogenizer. Add 800 μL of methanol:acetonitrile solution (1:1), vortex for 60 s, and ultrasonically disrupt it twice at 4°C, each time for 30 min. After incubating at -20°C for 1 h, centrifuge at 4°C and 15000 rcf for 20 min. Take out the supernatant and freeze-dry it in a vacuum low-temperature freeze dryer. Store the freeze-dried powder at -80°C.

[0020] The samples were separated using an ultra-high performance liquid chromatography system (UHPLC) combined with a HILIC column. Among them, the parameter settings of the liquid chromatography system were as follows: the column temperature was 25 °C, the flow rate was 0.3 mL / min, and the sample injection volume was 2 μL. The mobile phase composition was as follows: mobile phase A was an aqueous solution containing 25 mM ammonium acetate and 25 mM ammonia water, and mobile phase B was pure acetonitrile. The samples were eluted by gradient elution, and the elution program was: 0 - 0.5 min, 95% B; 0.5 - 7 min, 95% B - 65% B; 7 - 8 min, 65% B - 50% B; 8 - 9 min, 50% B; 9 - 9.1 min, 50% B - 95% B; 9.1 - 12 min, 95% B. All samples were placed at 4 °C throughout the experiment. The samples dried by a freeze dryer were re-dissolved with 200 μL of acetonitrile: water (1:1) solution and the air bubbles were removed.

[0021] The samples to be tested were detected in the positive ion mode of electrospray ionization. After separation by UHPLC, the samples were detected and analyzed by a mass spectrometer. The parameter settings of the ESI source were as follows: Drying gas flow rate, 16 L / min; Gas temperature, 250 °C; Sheath gas temperature, 500 °C; Sheath Gas flow rate, 12 L / min; Nebulizer, 20 psig; Vcap, 3000 V; Nozzle voltage, 175 V; Mass Range, 50 - 1200 Da; Acquisition rate, 4 HZ; Time per cycle, 50 ms.

[0022] After the sample detection, the amino acid sequence was identified by AB Triple TOF 6600 mass spectrometer. At the same time, the first-order spectrum and second-order spectrum of the QC sample were collected. The parameter settings of the ESI source are as follows: Ion Source Gas1 (Gas1), 50; IonSource Gas2 (Gas2), 80; source temperature, 650 °C; Curtaingas (CUR), 30; IonSapary Voltage Floating (ISVF) ±5000 V (positive ion mode); the second-order mass spectrometry informationdependent acquisition (IDA) was obtained, and the acquisition was carried out in high-sensitivity mode. Declusteringpotential (DP): ±60 V (positive ion mode), Collision Energy: 35 ± 15 eV. The parameter settings of IDA are as follows: Exclude isotopes within 4 daltons, Candidateions to monitor per cycle: 10. The data acquisition mode was segmented according to the mass-to-charge ratio range, 50 - 300 m / z, 290 - 600 m / z, 590 - 900 m / z, 890 - 1200 m / z, in order to achieve the purpose of expanding the acquisition rate of the second-order spectrum.

[0023] 2. Data processing Based on reasonable experimental design and accurate experimental data, first check whether the experimental data is complete. If the experimental data is missing, supplement the missing data. Finally, perform normalization processing between molecules and between samples to ensure the comparability of the data.

[0024] The raw data was converted into.mzXML format by ProteoWizard, and the structure of small molecules was identified by means of accurate mass number matching (<25 ppm) and second-order spectrum matching. Multidimensional statistical analysis methods mainly include unsupervised principal component analysis, supervised partial least squares discriminant analysis and orthogonal partial least squares discriminant analysis. At the same time, unidimensional statistical analysis methods were also used to analyze the data preprocessed by Pareto-scaling. The unidimensional statistical analysis methods mainly used fold change analysis, Student's t-test and the production of volcano plots combining the first two analysis methods.

[0025] 3. Differential protein screening When performing differential molecule analysis between two groups of samples, unidimensional statistical analysis can intuitively show the significance of molecular changes between the two groups of samples, thereby screening out potential biomarker molecules. The principle for screening differential molecules by unidimensional statistical analysis is FC > 1.5 and P value < 0.05. The functions of proteins were understood by referring to the Uniprot website (https: / / www.uniprot.org / ), and by referring to databases such as NCBI and Wanfang, the reported differential proteins were excluded, and the innovation of the proposed differential proteins was evaluated.

[0026] 4. Western blot (1)Extraction of tissue proteins. The formula for the compound lysis buffer: 100 μL of lysis buffer + 1 μL of PMSF reagent (protease inhibitor mixture). Weigh 50 mg of tissue, add it to 300 μL of the above compound lysis buffer, grind it in liquid nitrogen, then supplement the above compound lysis buffer to 1000 μL, and add 250 μL of 5× Loading Buffer reagent. 5× Loading Buffer (at 2.5 μL of Buffer / 10 μL of protein) is boiled at 95 °C for 10 min, with one oscillation during this period. Centrifuge at 12000 g and 4 °C for 15 min, and collect the supernatant into another 1.5 mL tube.

[0027] (2)Used for measuring protein concentration by the BCA method.

[0028] (3)Prepare a 10% SDS-PAGE polyacrylamide gel electrophoresis.

[0029] (4)Place the polyacrylamide gel into the electrophoresis tank, add 1× electrophoresis buffer (add 3.03 g of tris(hydroxymethyl)aminomethane, 18.77 g of glycine, and 1.0 g of sodium dodecyl sulfate into 1 L of water) to both the upper and lower tanks, and add 5 μL of protein marker (Novizan, catalog number: MP102-01) or the above protein sample.

[0030] (5)Electrophoresis: Start with a constant voltage of 80 V for 30 min. When it runs through the stacking gel, increase the current to 120 V for 60 - 80 min. The electrophoresis time is determined according to the size of the target protein and the position of the protein marker. Generally, it is okay when the target protein runs to two-thirds of the separating gel.

[0031] (6)Transfer the membrane. Cut the gel according to the Marker indication and the position of the target band (note to mark the cut corner of the gel). After marking the PVDF membrane number, immerse it in methanol for 1 min first, and then immerse it together with 4 pieces of 3 mm filter paper and the sponge in the transfer buffer for 15 min. The order is as follows: fiber pad - filter paper - PVDF membrane - gel - filter paper - fiber pad. Align each added item to ensure no air bubbles. Transfer the membrane at a constant current of 300 mA for 60 - 90 min.

[0032] (7) Incubation: After transferring the membrane, incubate it with 5 mL of milk powder blocking solution at room temperature for 2 h or gently shake it overnight at 4°C. Wash the membrane 3 times with 10 mL of TBS / T, 5 min each time. Add 5 mL of primary antibody dilution buffer (the primary antibody is diluted 1:1000), incubate at room temperature for 2 h or gently shake it overnight at 4°C. Recover the primary antibody, wash the membrane 3 times with 10 mL of TBS / T, 5 min each time. Add the secondary antibody (diluted 1:10000), gently shake it at room temperature for 1 h. Wash the membrane 3 times with 10 mL of TBS / T, 5 min each time.

[0033] (8) Development: Apply ECL luminescent solution to the bands to be developed and develop them on the film scanner.

[0034] 5. PCR (Polymerase Chain Reaction) Design primers for the corresponding protein through NCBI (https: / / www.ncbi.nlm.nih.gov / ), and after blast (Basic Local Alignment Search Tool), they are determined to be effective. The primer sequences are shown in Table 1.

[0035] Table 1 Primer Sequence Table Protein Name Sequence rcsd1 Forward primer GCTGCAGCCAAGGAGAAATC rcsd1 Reverse primer GAGGGAGGGCGCCTTTTTAT prl6a1 Forward primer CCCACAGACGTGGTCATTTC prl6a1 Reverse primer ACAGCATCAGGAGAGTCCAGAA Rrbbp9 Forward primer ACATGCCCGACCCAATTACA Rrbbp9 Reverse primer GGTTTCCAACCTATCGGCCA rars2 Forward primer TCTGCAGTTCCAATTTCCCA rars2 Reverse primer ACTTGTTGTAGCACTGTCTTTGT mospd2 Forward primer CCAACTTCTCAGCAATGGTGT mospd2 Reverse primer ACTTCACCCTGATCCAGAACAA UBX4 Forward primer GAGACTACACACCGAGCGAG UBX4 Reverse primer AGGCAGGCTTCACTTTTGGT (1) Take the frozen tissue, grind it in liquid nitrogen. Add 500 μL of Trizol to every 50 mg and homogenize thoroughly. Let it stand at room temperature for 10 min, centrifuge at 12000 rpm and 4°C for 5 min, and take 400 μL of the supernatant into a new EP tube; add 80 μL of chloroform (0.2 times the volume of the supernatant), shake for 15 s, let it stand for 3 min, centrifuge at 2000 rpm and 4°C for 10 min, and take the supernatant (be careful not to aspirate the protein layer); add 0.8 times the volume of the supernatant of isopropanol, gently mix the liquid in the tube, let it stand at room temperature for 10 min, centrifuge at 4°C and 12000 rpm for 10 min, discard the supernatant; add 1 mL of 75% ethanol (DEPC water), gently wash the precipitate; centrifuge at 4°C and 12000 rpm for 5 min, discard the supernatant, and repeat once. Air dry at room temperature, add 30 - 50 μL of DEPC H 2 O to dissolve and measure the RNA concentration.

[0036] (2) Reverse transcription 16 μL system (RNA + dd H 2 O = 12 μL, 4 μL of wiperMix reagent), use a reverse transcription instrument at 42°C for 2 min to 4°C. Then add 4 μL of enzyme (5xHiscriptII qRTSuperMixII reagent) to the 16 μL reverse transcription system, incubate at 5°C for 15 min, 85°C for 5 s, finally cool to 4°C, and then add 180 μL of dd water.

[0037] (3)Amplification: Add 10 μL of the reaction system (5 μL of 2x SYBR Green PCR Master Mix reagent, 0.3 μL of forward primer, 0.3 μL of reverse primer, 0.2 μL of Rox, cDNA + ddH 2 O in total of 4.2 μL), place it in a PCR instrument, pre-denature at 95°C for 30 s, in the cycling reaction stage, denature at 95°C for 10 s, anneal at 60°C for 30 s, for 40 cycles, in the melting curve stage, denature at 95°C for 15 s, anneal at 60°C for 60 s, denature at 95°C for 15 s.

[0038] II. Results and Analysis Hepatocellular carcinoma tissue specimens of 15 pairs of hepatocellular carcinoma patients with / without lung metastasis were detected by mass spectrometry, and 992 differential proteins were found. As Figure 1 shown, by referring to the literature, the differentially expressed proteins were excluded from those that have been publicly published or reported. Further screen proteins with multi-dimensional statistical analysis Fold change > 2 or < 0.5 and univariate statistical analysis Pvalue < 0.05 as proteins with significant differences. Among them, the expressions of rcsd1 protein, prl6a1 protein, rbbp9 protein, and rars2 protein increased, while the expressions of mospd2 protein and ubxn4 protein decreased.

[0039] PCR verification was performed on hepatocellular carcinoma tissue specimens of 30 pairs of hepatocellular carcinoma patients with / without lung metastasis. The results are as Figure 2 shown. Figure 2 A - F are the PCR results of rars2 protein (P < 0.0001), rcsd1 protein (P < 0.0001), rbbp9 protein (P < 0.0001), prl6a1 protein (P < 0.0001), ubxn4 protein (P < 0.0001), and mospd2 protein (P < 0.0001) respectively. The differences are all statistically significant. Among them, the expressions of rars2 protein, rcsd1 protein, rbbp9 protein, and prl6a1 protein decreased, while the expressions of ubxn4 protein and mospd2 protein increased.

[0040] WB verification was performed on hepatocellular carcinoma tissue specimens of 4 pairs of hepatocellular carcinoma patients with / without lung metastasis. Figure 3 A shows the WB bands of 6 differential proteins. Figure 3 B - G are the statistical results of the WB band gray values of rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein respectively. From Figure 3As can be seen from B-G, the rars2 protein (P = 0.0148), rcsd1 protein (P = 0.0015), rbbp9 protein (P = 0.0140), prl6a1 protein (P = 0.0071), ubxn4 protein (P < 0.0001), and mospd2 protein (P = 0.0039) all showed statistical significance.

[0041] Using blood specimens from another 37 pairs of liver cancer patients with / without lung metastasis for verification, the ROC results of the rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein are as Figure 4 shown in A-F. As can be seen from Figure 4 A-F, the area under the AUC curve of the rars2 protein is 0.8780, the area under the AUC curve of the rcsd1 protein is 0.7319, the area under the AUC curve of the rbbp9 protein is 0.7779, the area under the AUC curve of the prl6a1 protein is 0.8495, the area under the AUC curve of the ubxn4 protein is 0.8882, and the area under the AUC curve of the mospd2 protein is 0.8276. In summary, the areas under the AUC curves of the rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein, and mospd2 protein are all greater than 0.7. The equation obtained by linear regression is: y = 0.183*rcsd1 + 0.202*prl6a1 + 0.129*rbbp9 + 0.265*rars2 - 0.148*mospd2 - 0.329*ubxn4. The ROC curve obtained by applying the equation is as Figure 4 shown in G. As can be seen from Figure 4 G, the area under the ROC curve is 0.9869, indicating that this equation has better detection efficacy.

[0042] In this invention, first, liver cancer tissue specimens from 30 liver cancer patients with and 30 without lung metastasis were collected, and then deep mass spectrometry analysis was performed on them using an HPLC-MS / MS mass spectrometry system and label-free quantitative proteomics method. Then, the non-limiting amino acid protein modification analysis method was used to search the mass spectrometry data, and the analyzed proteins were displayed using a volcano plot. The differential proteins were verified for significance according to the P-value. Proteins with both multidimensional statistical analysis Foldchange > 2 or < 0.5 and univariate statistical analysis P value < 0.05 were selected as significantly different proteins. The results showed that the expressions of the rcsd1 protein, prl6a1 protein, rbbp9 protein, and rars2 protein increased, while the expressions of the mospd2 protein and ubxn4 protein decreased.

[0043] The selected differential proteins (rcsd1 protein, prl6a1 protein, rbbp9 protein, rars2 protein, mospd2 protein, and ubxn4 protein) were verified by PCR and WB. Additionally, blood specimens from 37 pairs of liver cancer patients with and without lung metastasis were collected for verification, and an ROC curve was plotted. An equation was calculated through linear regression, and the ROC curve was obtained using the equation. The area under the AUC curve was 0.9869, indicating better detection efficacy.

[0044] In the present invention, the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples", etc. mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0045] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. Protein markers for pulmonary metastasis of primary liver cancer, wherein the protein markers are selected from at least one of rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein and mospd2 protein.

2. Use of the protein markers for pulmonary metastasis of primary liver cancer according to claim 1 in the preparation of diagnostic reagents, kits or therapeutic drugs for pulmonary metastasis of primary liver cancer.

3. According to the use described in claim 2, characterized in that, the diagnostic reagent or kit contains a reagent for specifically detecting the expression level of the protein marker.

4. According to the use described in claim 3, characterized in that, the diagnostic reagent or kit diagnoses whether pulmonary metastasis of primary liver cancer has occurred by detecting the expression level of the protein marker in primary liver cancer tissue.

5. According to the use described in claim 4, characterized in that, the expression levels of rcsd1 protein, prl6a1 protein, rbbp9 protein and rars2 protein are positively correlated with pulmonary metastasis of primary liver cancer.

6. According to the use described in claim 4 or 5, characterized in that, the expression levels of mospd2 protein and ubxn4 protein are negatively correlated with pulmonary metastasis of primary liver cancer.

7. According to the use described in claim 2, characterized in that, at least one of rars2 protein, rcsd1 protein, rbbp9 protein, prl6a1 protein, ubxn4 protein and mospd2 protein is used as a target for screening or preparing therapeutic drugs for pulmonary metastasis of primary liver cancer.

8. According to the use described in claim 8, characterized in that, the drug contains a reagent for inhibiting the expression of rcsd1 protein, prl6a1 protein, rbbp9 protein and / or rars2 protein.

9. According to the use described in claim 7 or 8, characterized in that, the drug contains a reagent for promoting the expression of mospd2 protein and / or ubxn4 protein.

Images