Novel cyclopeptide configuration and library preparation method and application thereof
By fusing single domain antibodies with cyclic peptides and designing random polypeptide sequences as phage display libraries, the problem of high cost of screening and preparation of cyclic peptides in the prior art is solved, and efficient and low-cost polypeptide screening and purification is achieved.
Patent Information
- Application Number
- CN202311726504.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-06-17
AI Technical Summary
The prior art is difficult to predict pharmacokinetic properties when screening cyclic peptide drugs, and large-scale preparation and isolation and purification are expensive.
Fused high-affinity specific antigen binding molecules (such as single domain antibodies) with cyclic peptides, and random peptide sequences are designed as members of the phage display library, so as to facilitate screening of massive cyclic peptide sequences.
The phage display efficiency of the peptide is improved, the preparation of higher purity peptides is achieved, the cost is reduced, and environmental pollution and the toxicity and immunogenicity of the target peptides in chemical synthesis are avoided.
Smart Images

Figure CN120157769A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of molecular biology and bioengineering. Specifically, the present invention relates to a fusion polypeptide comprising a cyclic peptide and a single-domain antibody in a new configuration, a phage display library displaying the fusion polypeptide and a preparation method thereof, and uses of the fusion polypeptide and the phage display library. Background Art
[0002] The present invention belongs to the fields of molecular biology and bioengineering. Specifically, the present invention relates to a fusion polypeptide comprising a new cyclic peptide and a new single-domain antibody, a phage display library displaying the fusion polypeptide and a preparation method thereof, and uses of the fusion polypeptide and the phage display library.
[0003] The size of cyclic peptide drug molecules usually lies between small molecule drugs and biologic drugs. With unique and excellent properties such as low toxicity, metabolic stability, high membrane permeability, etc., they have very important application prospects in new drug research and development. Therefore, the research and development of ligand drugs targeting cyclic peptide compounds have attracted more and more attention. Currently, there are about 40 cyclic peptide drugs in clinical research, and the number of preclinical and clinical cyclic peptide drugs under research has been continuously increasing in recent years, with an average of one new cyclic peptide drug entering clinical trials every year. Currently, the marketed cyclic peptide drugs are mostly antimicrobial peptides or hormone analogs. In addition to the well-known oxytocin, vancomycin, cyclosporine, there are also the recently approved cyclic peptide drugs anidulafungin, lanreotide, linaclotide, etc. They are all derived from natural products and their derivatives. However, the naturally occurring cyclic peptide libraries that can be screened for specific biological activities are essentially limited. In addition, the complicated steps required for isolating and purifying cyclic peptides from natural sources make this screening costly and impractical.
[0004] Since the advent of phage display technology in the 1980s, this technology has become the most powerful strategy for discovering polypeptide ligands against numerous targets. To expand the diversity of phage display peptide libraries and improve the performance of polypeptide ligands, a large number of phage cyclic peptide libraries have been displayed and successfully applied to the screening of various targets. In 1992, O’Neil et al. (O’Neil, K.T., Hoess, R.H., Jackson, S.A., Ramachandran, N.S., Mousa, S.A., & DeGrado, W.F. Identification of novel peptide antagonists for GPIIb / IIIa from a conformationally constrained phage peptide library. Proteins: Struct., Funct., Genet. 14, 509 - 515 (1992)) constructed the first phage cyclic peptide display library (CysX6Cys form; Cys = cysteine; X = any random amino acid), which consisted of six random amino acids and cysteines on both sides. After the two cysteines were oxidized to form cyclic peptides, high-affinity cyclic peptide molecules were finally screened against platelet glycoprotein IIb / IIIa. Due to the good screening performance and wide application of this cyclic peptide, a commercial phage cyclic peptide library in the CysX7Cys form (Noren, K.A.; Noren, C.J. Construction of High-Complexity Combinatorial Phage Display Peptide Libraries. Methods 23, 169 - 178 (2001)) was subsequently developed. The phage cyclic peptide library based on disulfide bond cyclized polypeptides showed the advantages of simple operation technology and stable performance. Cysteines can form disulfide bonds through oxidation in the periplasmic space of bacteria, directly cyclizing polypeptides on the phage surface and eliminating the cumbersome operation of chemical post-translational modification.
[0005] However, the above screening strategy can only screen for protein-protein interactions. The pharmacokinetic properties of the obtained cyclic peptides are difficult to predict, and no advantages are shown in large-scale preparation and isolation and purification.
[0006] The present invention provides an improved screening platform based on cyclic peptides constructed by disulfide bond cyclization. Summary of the Invention
[0007] The present invention fuses a high-affinity specific antigen-binding molecule (preferably a smaller molecular weight one, such as a single-domain antibody) to a cyclic peptide, and designs a random polypeptide sequence as the sequence of the cyclic peptide part to construct a polypeptide phage display library, thereby facilitating the screening of a large number of cyclic peptide sequences.
[0008] Accordingly, in a first aspect, the present invention provides a fusion polypeptide. The fusion polypeptide comprises a cyclic peptide and a single-domain antibody as two polypeptide fragments. In some specific embodiments, the fusion polypeptide further comprises a linker fragment, wherein the cyclic peptide and the single-domain antibody are fused through the linker. In some specific embodiments, the fusion polypeptide further comprises a tag fragment, and the tag fragment can be an N-terminal tag sequence or a C-terminal tag sequence.
[0009] In some preferred embodiments, the fusion polypeptide has the structure of formula (I) from the N-terminus to the C-terminus:
[0010] R-(L)-V-(T) (I)
[0011] wherein, R is a cyclic peptide, preferably a cyclic peptide cyclized via an intramolecular disulfide bond formed between any two cysteines within the fragment, more preferably at least two amino acid residues are spaced between the two cysteines forming the disulfide bond, and most preferably at least four amino acid residues are spaced between the two cysteines forming the disulfide bond;
[0012] L is an optional linker;
[0013] V is a single-domain antibody (i.e., VHH domain);
[0014] T is an optional C-terminal tag sequence.
[0015] In some specific embodiments, the R fragment is derived from a human antibody CDR3 domain or a single-domain antibody CDR3 domain. In some specific embodiments, the R fragment has at least 80% sequence identity with a human antibody CDR3 domain or a single-domain antibody CDR3 domain, preferably at least 85%, at least 88%, at least 90%, at least 93%, at least 96%, at least 99% or 100% sequence identity.
[0016] In some specific embodiments, the R fragment comprises 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 amino acid residues.
[0017] In some specific embodiments, the first amino acid residue at the N-terminus and the first amino acid residue at the C-terminus of the R fragment are cysteines, and an intramolecular disulfide bond (i.e., an intramolecular disulfide bond) is formed between the two cysteines.
[0018] In some other specific embodiments, an intramolecular disulfide bond (i.e., an in-chain disulfide bond) is formed between any two cysteines within the R fragment, where the following conditions are met: the two cysteines forming the disulfide bond are located at any positions between the 1st and 14th positions at the N-terminus and any positions between the 1st and 14th positions at the C-terminus, respectively, and there are at least two and at most seventeen amino acid residues between them; preferably, the two cysteines forming the disulfide bond are located at any positions between the 1st and 12th positions at the N-terminus and any positions between the 1st and 12th positions at the C-terminus, respectively, and there are at least four and at most fifteen amino acid residues between them.
[0019] In some other specific embodiments, an intramolecular disulfide bond (i.e., an in-chain disulfide bond) is formed between any two cysteines within the R fragment, where the following conditions are met: the two cysteines forming the disulfide bond are located at any positions between the 2nd and 5th positions at the N-terminus and any positions between the 2nd and 5th positions at the C-terminus, respectively, and there are at least four amino acid residues between them.
[0020] In some more specific embodiments, the R fragment has the structure described in (a) or (b) below:
[0021] (a) CysX n Cys, where Cys = cysteine forming the disulfide bond; X = any random amino acid; n = any natural number between 6 and 17;
[0022] (b) X n1 CysX n2 CysX n3 , where Cys = cysteine forming the disulfide bond; X = any random amino acid; n1 is any integer from 0 to 11, n2 is any integer from 4 to 15, n3 is any integer from 0 to 11, and there is: the sum of n1, n2, and n3 is any integer between 7 and 15; preferably, where n1 = 1, 2, 3, or 4, n2 is any integer from 4 to 9, n3 = 1, 2, or 3, and there is: the sum of n1, n2, and n3 is any integer between 7 and 15.
[0023] In some specific embodiments, the V fragment is a VHH that specifically binds to human serum albumin (HSA).
[0024] In some embodiments, the fusion polypeptide further comprises a linker fragment L.
[0025] In some specific embodiments, L is a flexible linker that does not affect the three-dimensional structures of the two polypeptide fragments it connects. In some specific embodiments, L has (GGGGS) nThe amino acid sequence, where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4. In some specific embodiments, the L fragment has the amino acid sequence EPKSSDKTHTCPPCP. In some specific embodiments, the L fragment has (GGGGG) n The amino acid sequence, where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4. In some specific embodiments, the L fragment has A(EAAAP) n The amino acid sequence of A, where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4.
[0026] In some embodiments, the linker fragment L is absent.
[0027] In some specific embodiments, T is a Flag tag. In some specific embodiments, T is a His tag. In some specific embodiments, T is a Flag-His tag. For example, the T fragment has the amino acid sequence as set forth in SEQ ID NO:27. In some specific embodiments, the T fragment is absent.
[0028] The present invention also provides a polynucleotide encoding the fusion polypeptide of the present invention.
[0029] Thus, in another aspect of the present invention, the present invention also provides a random polypeptide library, wherein each member has the fusion polypeptide structure provided in the first aspect of the present invention, and preferably, the random polypeptide therein is the cyclic peptide (R fragment part) in the fusion polypeptide.
[0030] In a preferred embodiment, the sequence of the random polypeptide is designed following the naturally occurring high-affinity polypeptide sequence, so as to be expected to be more likely to obtain an active cyclic peptide through screening.
[0031] Therefore, in a preferred embodiment of the present invention, each polypeptide member of the polypeptide library respectively comprises an R fragment having a different amino acid sequence. In a preferred embodiment of the present invention, each polypeptide member has the same L fragment amino acid sequence, the same V fragment amino acid sequence and the same T fragment amino acid sequence.
[0032] The present invention also provides a polynucleotide encoding any polypeptide member of the polypeptide library of the present invention. In other words, the present invention provides a corresponding polynucleotide library.
[0033] In yet another aspect, as a preferred example of the fusion polypeptide V fragment, the present invention provides a single domain of an immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA). In some preferred embodiments, the anti-HSA VHH comprises CDR1-3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NOs: 9-21.
[0034] In some embodiments, the anti-HSA VHH comprises CDR1-3 of the sequences as shown in SEQ ID NOs: 6, 7, and 8, respectively.
[0035] In some embodiments, the anti-HSA VHH comprises the amino acid sequence as shown in any one of SEQ ID NOs: 9-21, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NOs: 9-21, or an amino acid sequence having one or more (preferably 1-10, more preferably 1-5) amino acid additions, deletions, and / or substitutions compared to any one of SEQ ID NOs: 9-21. For example, the VHH domain consists of the amino acid sequence shown in SEQ ID NO: 14.
[0036] In another aspect, the present invention also provides a fusion protein comprising the anti-HSA VHH of the present invention. In some embodiments, the anti-HSA VHH is located at the N-terminus of the fusion protein; in some embodiments, the anti-HSA VHH is located at the C-terminus of the fusion protein. In some embodiments, the fusion protein is a fusion protein of the anti-HSA VHH and a human antibody constant region or a fragment thereof. In some embodiments, the fragment of the human antibody constant region is the Fc region of a human antibody, preferably IgG1 Fc.
[0037] In some preferred embodiments, the fusion protein comprising the anti-HSA VHH of the present invention is the fusion polypeptide comprising a cyclic peptide of the present invention.
[0038] Furthermore, in another aspect, the present invention provides a phage display library for displaying a polypeptide library. Based on phage display technology, the phage display library of the present invention inserts a polynucleotide encoding the fusion polypeptide comprising a random cyclic peptide of the present invention into the phage structural genome, such that the fusion polypeptide can be expressed and presented on the phage surface in the correct three-dimensional structure with the reassembly of the progeny phages, and thus has biological activity.
[0039] Thus, in some embodiments, each phage particle in the phage display library of the present invention independently contains a polypeptide with a three-dimensional structure. In some embodiments, each phage particle in the phage display library of the present invention contains a polynucleotide encoding a polypeptide with a three-dimensional structure. That is, the phage display library of the present invention contains the polynucleotide library of the present invention.
[0040] In some embodiments, the capacity of the phage display library of the present invention reaches at least 1×10 6 unique cyclic peptides, preferably at least 1×10 7 species, at least 1×10 8 species, at least 1×10 9 species, at least 1×10 10 species, at least 1×10 11 species, at least 1×10 12 species. In some embodiments, the uniqueness of the phage display library of the present invention is higher than 90%, higher than 95%, higher than 96%, higher than 97%, higher than 98%, higher than 99%, higher than 99.5%, higher than 99.9% or 100%.
[0041] The present invention also provides a method for constructing a phage display library displaying cyclic peptides, comprising the steps of: (a) obtaining the polynucleotide library of the present invention; and (b) introducing it into the phage genome.
[0042] In a specific embodiment, the step (a) includes:
[0043] (a1) Acquisition of cyclic peptide coding fragment: Artificially synthesize a trinucleotide polynucleotide (Trimer polynucleotide) library as a template, obtain a nucleic acid sequence fragment encoding a cyclic peptide fragment by PCR amplification, and then recover the above product fragment as a cyclic peptide coding fragment, for example, by agarose gel electrophoresis;
[0044] (a2) Acquisition of single-domain antibody coding fragment: Synthesize a polynucleotide fragment encoding a single-domain antibody by gene synthesis as a single-domain antibody coding fragment, or use it as a template to obtain more identical nucleic acid sequence fragments by PCR amplification, and recover and purify them as single-domain antibody coding fragments, for example, by agarose gel electrophoresis;
[0045] (a3) Connect the two coding fragments obtained in (a1) and (a2) into a full-length single polynucleotide, for example, by ligation reaction or fusion PCR reaction.
[0046] In a specific embodiment, the 3'-end portion of the cyclic peptide coding fragment in step (a1) contains a coding sequence of a linker, so that in the full-length single polynucleotide after ligation, the cyclic peptide coding sequence and the single-domain antibody coding sequence are connected by the linker coding sequence.
[0047] In a more preferred embodiment, the 3'-end of the cyclic peptide-encoding fragment in (a1) and the 5'-end of the single-domain antibody-encoding fragment in (a2) respectively contain a part of the encoding sequence of the linker, so that in the full-length single polynucleotide after ligation, the cyclic peptide-encoding sequence and the single-domain antibody-encoding sequence are linked by the linker-encoding sequence, and optionally, the two parts of the linker-encoding sequence overlap.
[0048] In a more specific embodiment, the artificially synthesized trinucleotide polynucleotide (Trimer polynucleotide) in step (a1) contains a 5'-primer binding region of a fixed sequence, a cyclic peptide library-encoding region encoding 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 consecutive random amino acid residues, and an optional partial linker-encoding region or linker-encoding region of a fixed sequence.
[0049] Preferably, the cyclic peptide library-encoding region encoding 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 consecutive random amino acid residues is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 consecutive groups of random triplet codons (trinucleotides), and the 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 consecutive random amino acid residues contain two cysteine residues separated by at least two amino acid residues. In a more preferred embodiment, the first amino acid residue at the N-terminus and the first amino acid residue at the C-terminus of the 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 consecutive random amino acid residues are cysteine. In a more preferred embodiment, for the 9, 10, 11, 12, 13, 14, 15, 16 or 17 consecutive random amino acid residues, the amino acid residues at any position from the 1st to the 14th position at the N-terminus and at any position from the 1st to the 14th position at the C-terminus are cysteine, and the two cysteine residues are separated by at least two and at most fifteen amino acid residues. In a more preferred embodiment, for the 9, 10, 11, 12, 13, 14, 15, 16 or 17 consecutive random amino acid residues, the amino acid residues at any position from the 1st to the 12th position at the N-terminus and at any position from the 1st to the 12th position at the C-terminus are cysteine, and the two cysteine residues are separated by at least four and at most fifteen amino acid residues. In a more preferred embodiment, for the 9, 10, 11, 12, 13, 14, 15, 16 or 17 consecutive random amino acid residues, the amino acid residues at any position from the 2nd to the 5th position at the N-terminus and at any position from the 2nd to the 5th position at the C-terminus are cysteine, and the two cysteine residues are separated by at least four amino acid residues.
[0050] In some embodiments, the continuous random amino acid residues comprise two cysteines. In some embodiments, the continuous random amino acid residues comprise more than two cysteines.
[0051] Preferably, the 5'-primer binding region and / or the 5'-primer comprise a first restriction site and an optional prokaryotic signal peptide coding sequence.
[0052] In a specific embodiment, the single-domain antibody in step (a2) is a VHH that specifically binds human serum albumin (HSA).
[0053] In a more specific embodiment, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds human serum albumin (HSA) comprises CDR1-3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NOs: 9-21. In some more specific embodiments, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds human serum albumin (HSA) comprises CDR1-3 of the sequences shown in SEQ ID NOs: 6, 7, and 8, respectively. In some more specific embodiments, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds human serum albumin (HSA) comprises or consists of an amino acid sequence as shown in any one of SEQ ID NOs: 9-21, or comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% identity to any one of SEQ ID NOs: 9-21, or comprises or consists of an amino acid sequence having one or more (preferably 1-10, more preferably 1-5) amino acid additions, deletions, and / or substitutions compared to any one of SEQ ID NOs: 9-21. In some most preferred embodiments, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds human serum albumin (HSA) comprises or consists of the amino acid sequence shown in SEQ ID NO: 14.
[0054] In some more specific embodiments, optionally a sequence fragment encoding a C-terminal tag is included in the phage genome in step (b) or at the 3'-end of the single-domain antibody coding fragment in step (a2). Preferably, the C-terminal tag is a Flag tag, a His tag, a Flag-His tag, or absent. In some preferred embodiments, the C-terminal tag comprises or consists of the amino acid sequence shown in SEQ ID NO: 27.
[0055] In some more specific embodiments, the single-domain antibody coding fragment in step (a2) comprises a second restriction site sequence.
[0056] In some more specific embodiments, the polynucleotide fragment encoding a single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA) in step (a2) further comprises a linker encoding sequence at its 5' end, and at this time, the 3' end portion of the cyclic peptide encoding fragment in (a1) does not contain the encoding sequence of the linker, so that in the full-length single polynucleotide after ligation, the cyclic peptide encoding sequence and the single domain antibody encoding sequence are connected by the linker encoding sequence.
[0057] In some specific embodiments, the method further comprises the steps of: (c) expressing and / or assembling (progeny) phage particles in a prokaryotic cell (such as, Escherichia coli). In some specific embodiments, the method further comprises the step of: (d) harvesting (progeny) phage particles.
[0058] The present invention thus also provides the use of the polypeptide library / nucleotide library / phage display library of the present invention for screening / identifying / selecting cyclic peptides that bind to a specific target. Thus, a method for screening / identifying / selecting cyclic peptides that bind to a specific target is provided, comprising the steps of:
[0059] (a) contacting the phage display library of the present invention with the desired target,
[0060] (b) screening the phage particles against the desired target, wherein the result of the screening is to select phage particles having a cyclic peptide that binds to the desired
[0061] target; and
[0062] (c) identifying the amino acid sequence of the cyclic peptide of the selected phage particles.
[0063] In some embodiments, the target is bound to a solid support. In some embodiments, the target is expressed on the cell surface. In some embodiments, the target is dissolved in a solution and preferably carries a detectable moiety.
[0064] Therefore, the library designed and constructed in the present invention can be used as a platform for screening cyclic peptides that bind to a specific target, and based on various target combinations, continuously screen for cyclic peptide molecules that specifically bind.
[0065] The fusion protein of the present invention fuses a cyclic peptide and a single domain antibody, which can improve the phage display efficiency of the polypeptide, so as to express and prepare the polypeptide using a eukaryotic cell line. At the same time, the introduction of the single domain antibody realizes the purification of the polypeptide sample. Compared with the conventional chemical synthesis method for polypeptide preparation, this method can obtain a higher purity polypeptide, with lower cost, and at the same time avoid environmental pollution caused by the use of organic solvents in chemical synthesis, and reduce the toxicity and immunogenicity of the target polypeptide. BRIEF DESCRIPTION OF THE DRAWINGS
[0066] Figure 1 It shows that both the HSA antigen protein prepared by the present invention and the positive control antibody have good binding activity.
[0067] Figure 2 It shows that the affinity activity of the candidate anti-HSA antibody A20-Fc with huHSA-His at the ELISA level is better than that of the positive control antibody Alb23 (EC 50 = 0.00575 μg / mL vs 0.01 μg / mL).
[0068] Figure 3 It shows that the candidate anti-HSA antibody A20-Fc binds to CynoHSA-His ( Figure 3 A, EC 50 = 0.00462 μg / mL) and MSA-His ( Figure 3 B, EC 50 = 0.00578 μg / mL) with better binding activity than the positive control antibody Alb23 (EC 50 being 0.00718 μg / mL and 0.00983 μg / mL respectively).
[0069] Figure 4 It shows that the anti-HSA antibody of the present invention has good binding activity with huHSA-His after humanization.
[0070] Figure 5 It shows that the humanized anti-HSA antibody of the present invention has good binding activity with CynoHSA-His.
[0071] Figure 6 It shows that when binding to the target molecules huEPOR-His ( Figure 6 A) and huEPOR-hFc ( Figure 6 B), the EC 50 of EMP1-Linker1-A20-Flag-phage are all lower than those of EMP1-Linker1-Flag-phage and EMP1-Linker2-Fc-phage, and the upper plateau of the binding of EMP1-Linker1-A20-Flag-phage and EMP1-Linker1-Flag-phage to the target molecules is significantly higher than that of EMP1-Linker2-Fc-phage.
[0072] Figure 7 It shows the binding results at the lysate level and the prokaryotic protein level. At the lysate level ( Figure 7 A), the EC 50Both are superior to EMP1-Linker4-A20-Flag-lysate, EMP1-Linker1-Flag-lysate, and EMP1-Linker4-Flag-lysate, among which EMP1-Linker1-Flag-lysate and EMP1-Linker4-Flag-lysate bind weakly to the antigen; at the prokaryotic protein level ( Figure 7 B), the EC of the binding of EMP1-Linker1-A20-Flag-phage to the antigen 50 Both are superior to EMP1-Linker4-A20-Flag-phage, EMP1-Linker1-phage, and EMP1-Linker4-phage.
[0073] Figure 8 The results of statistical analysis of the CDR3 region sequences according to the amino acid length are shown. In the human heavy chain antibody sequences ( Figure 8 A), the CDR3 amino acid length distribution ranges from 1 to 34, showing an overall normal distribution, with the most at amino acid length 12, and most distributed between 6 and 21 amino acids. In the single-domain antibody sequences ( Figure 8 B), the CDR3 amino acid length distribution ranges from 1 to 32, also showing an overall normal distribution, with the most at amino acid length 14, and most distributed between 7 and 19 amino acids.
[0074] Figure 9 shows the fragment length design diagram of the random cyclic peptides of the present invention. Sub-figure A shows the polypeptide lengths designed according to the amino acid length rule of the human heavy chain antibody CDR3 region and the corresponding cysteine sites, and sub-figures B-I show the polypeptide lengths designed according to the amino acid length rule of the single-domain antibody CDR3 region and the corresponding cysteine sites.
[0075] Figure 10 It shows the configuration diagram of the fusion of the fragments of the random cyclic peptides of the present invention with the anti-HSA VHH fragment via a linker.
[0076] Figure 11 It shows that the candidate polypeptide molecules A023, A039, A002, and A017 all have good binding activities with the target protein huTROP2-His.
[0077] Figure 12 It shows that the purified polypeptide molecules can bind to huROR1-HEK293 cells, among which the polypeptide molecules A021 and A017-1 have certain binding activities with huROR1-HEK293, and the binding level (EC 50 ) is at the μM level.
[0078] Figure 13It shows an analysis chart of sequence alignment of polypeptide molecules that specifically bind to ROR1 and are screened from the polypeptide phage display library with hundreds of billions constructed according to the present invention. The analysis results are used to further optimize the sequences and affinity maturation. Figure 13 A shows the sequence alignment results of three polypeptides, A017-1, B003, and A013. The dark color indicates the same amino acid residues; Figure 13 B shows the design of the mutant library based on the above alignment results.
[0079] Figure 14 In the small figures A and B, it shows the results of the affinity activity detection of the screened affinity maturation candidate polypeptides with ROR1 by ELISA.
[0080] Figure 15 It shows the results of the affinity activity detection of the screened affinity maturation candidate polypeptides with ROR1 overexpressed on the cell surface by FACS.
[0081] Figure 16 It shows the result chart of identifying the purified polypeptide by SDS-PAGE electrophoresis after eukaryotic expression and extraction and purification of the polypeptide molecules that specifically bind to PD-L1 and are screened from the polypeptide phage display library with trillions constructed according to the present invention. Figure 16 A is the result chart of the polypeptide molecule A83-v2, Figure 16 B is the result chart of the polypeptide molecule A083-v3.
[0082] Figure 17 It shows the result chart of identifying the monomer purity of the polypeptide molecules that specifically bind to PD-L1 and are screened from the polypeptide phage display library with trillions constructed according to the present invention by SEC-HPLC. Small figure A is the result chart of the polypeptide molecule A083-v2, and small figure B is the result chart of the polypeptide molecule A083-v3.
[0083] Figure 18 It shows that the anti-PD-L1 polypeptide molecule A083 has good binding activity with the antigen protein huPD-L1-Fc.
[0084] Figure 19 It shows the results of the affinity activity detection of the candidate polypeptide molecule A083 that specifically binds to PD-L1 and is screened from the polypeptide phage display library with trillions constructed according to the present invention with PD-L1 overexpressed on the cell surface by FACS.
[0085] Figure 20 It shows the blocking activity of A083 on PD-L1 overexpressed on the cell surface by FACS.
[0086] Figure 21 It shows the alanine scanning design chart of anti-PD-L1.
[0087] Figure 22 Small figures A - C show the affinity activities of the polypeptides after alanine - scanning designed mutations with huPD - L1 - Fc; small figure A is the result graph of A083 - C1A, A083 - P2A, A083 - L3A, A083 - I4A, A083 - F5A, A083 - F6A, and A083 - R7A; small figure B shows the results of A083 - G8A, A083 - G9A, A083 - Y10A, A083 - Y11A, A083 - T12A, A083 - G13A, A083 - M15A, A083 - D16A, and A083 - V17A; small figure C is the result of A083 - C18A.
[0088] Figure 23 Shows the affinity activity of the polypeptide - fused Fc protein with huPD - L1 - His after affinity maturation.
[0089] Figure 24 Shows the affinity activity of the polypeptide - fused Fc protein with huPD - L1 - CHO - K after affinity maturation.
[0090] Figure 25 Shows the affinity activity of the small cyclic peptide with a cysteine separated by two amino acids. DETAILED DESCRIPTION OF THE INVENTION
[0092] I. Definitions
[0093] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting. Other features, objects, and advantages of the present invention will be apparent from this specification, the drawings, and the appended claims.
[0094] To explain this specification, the following definitions will be used, and terms used in the singular may also include the plural and vice versa where appropriate. It is to be understood that the terms used herein are only for describing specific embodiments and are not intended to be limiting.
[0095] The term "about", when used in conjunction with a numerical value, means to cover a numerical value within a range having a lower limit that is 10% less than the specified numerical value and an upper limit that is 10% greater than the specified numerical value.
[0096] As used herein, the term "and / or" means any one of the alternatives or two or more of the alternatives.
[0097] As used herein, the term "comprising" or "including" means including the stated elements, integers or steps, but does not exclude any other elements, integers or steps. In this text, when the term "comprising" or "including" is used, unless otherwise specified, it also covers the case of a combination of the stated elements, integers or steps. For example, when referring to an antibody variable region "comprising" a specific sequence, it is also intended to cover an antibody variable region consisting of that specific sequence.
[0098] The term "cyclic peptide" or "circular peptide" refers to a polypeptide that forms a ring or undergoes cyclization in its structure, and the ring or cyclization can be through the connection between the side chain groups of two amino acid residues, such as a chemical bond of direct interaction, or via other small molecule linkers. In this text, the term covers cyclic polypeptides that are joined end to end, and also covers polypeptides that contain only one or more ring structures formed by partial amino acid residues in their structure (i.e., containing both a cyclic peptide chain structure and a linear peptide chain structure). In a preferred embodiment of the present invention, the ring is an amino acid ring formed by an intramolecular disulfide bond between the sulfhydryl groups of two cysteines. Cyclization confers stronger conformational rigidity on the original linear peptide, and the shape of the ring is also closer to the interface of protein interaction, thus this may increase the binding affinity of the peptide for its possible target. In addition, cyclic peptides are significantly more resistant to proteolysis, which also brings better drugability.
[0099] The term "fusion polypeptide" encompasses the connection of multiple components such as a first amino acid sequence and a second amino acid sequence, a third amino acid sequence, a fourth amino acid sequence, and so on. Among them, the first, second,... amino acid sequences are not naturally linked in nature, and / or are usually present in different polypeptides / proteins. Therefore, although it is still a polypeptide molecule in terms of structure, in view of the above situation, and the first, second,... amino acid sequences and other multiple components usually still individually exhibit or are expected to exhibit their original properties / activities in a common protein molecule, the term "fusion polypeptide" emphasizes that the resulting polypeptide is a fusion / combination of multiple components. Multiple components can be linked and a fusion polypeptide can be produced by chemical synthesis or by recombinantly expressing polynucleotides in cells. In this text, "fusion polypeptide" and "fusion protein" can be used interchangeably.
[0100] The term "fragment" as used herein refers to a physically continuous portion of the primary structure of a biomolecule, particularly a biomacromolecule that can be described by multiple structural units, such as a protein molecule containing an amino acid sequence or a nucleic acid molecule containing a nucleotide sequence. In the case of a protein, the portion is defined as a continuous portion of the amino acid sequence of the protein and refers to at least 3 amino acids, such as 3 - 5 amino acids, at least 8 - 10 amino acids, at least 11 - 15 amino acids, at least 17 - 24 amino acids, at least 25 - 30 amino acids, or at least 30 - 45 amino acids, etc. In the case of a nucleic acid, the portion is defined as a continuous portion of the nucleotide sequence of the nucleic acid and refers to at least 9 nucleotides, such as 9 - 15 nucleotides, at least 18 - 30 nucleotides, at least 33 - 45 nucleotides, at least 48 - 72 nucleotides, at least 75 - 90 nucleotides, and at least 90 - 135 nucleotides, etc. In the context of the present invention, the term "fragment" can generally be used interchangeably with "portion", and a fragment also has its sequence. In the context of the present invention, the mention of a specific "fragment" is usually because this specific portion of the biomolecule is a portion having a specific biological function, such as the smallest portion, and preferably this function is distinct from the functions of other fragments. However, multiple fragments can also jointly form a larger "fragment" as long as they are physically continuous. In particular, in the context of the present invention, the term "fragment" can mean a component / part that constitutes a fusion polypeptide / fusion protein, especially a component / part that is structurally continuous with other components / parts but still exhibits an independent function / activity (e.g., binding specificity).
[0101] The term "specifically binds" or "binds specifically", when referring to the interaction of an antibody, binding protein, or peptide with a second chemical substance (e.g., a polypeptide, an antigen), means that the interaction depends on the presence of a specific structure (e.g., an antigenic determinant or epitope) on the second chemical substance and forms a complex that generates non-covalent interaction forces together with the binding protein or antibody. In the context of the present disclosure, a specific antigen-binding molecule (preferably, a single-domain antibody) binds to the corresponding antigen with a K D of 1 μM or lower, e.g., 0.5 μM or lower. The term "K D " refers to the equilibrium dissociation constant (the reciprocal of the equilibrium binding constant), which is used herein according to the following definition.
[0102] The term "antibody" is used herein in the broadest sense to refer to a protein containing an antigen-binding site, covering natural antibodies and artificial antibodies of various structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies, single-domain antibodies, intact antibodies, and antibody fragments. Preferably, the antibodies of the present invention are single-domain antibodies or heavy-chain antibodies.
[0103] The term "antibody fragment" refers to a molecule that is different from a full antibody, which contains a part of the full antibody and is capable of binding to the antigen that the full antibody binds to. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab’, Fab’-SH, F(ab’)2; diabodies; linear antibodies; single-chain antibodies (e.g., scFv); single-domain antibodies; bivalent or bispecific antibodies or fragments thereof; camelid antibodies (heavy-chain antibodies); and bispecific or multispecific antibodies formed from antibody fragments.
[0104] The term "variable region" or "variable domain" refers to the domain of the heavy or light chain of an antibody that participates in binding of the antibody to an antigen. The variable domains of the heavy and light chains of a native antibody generally have similar structures, each containing four conserved framework regions (FRs) and three complementarity-determining regions (CDRs) (see, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co. page 91 (2007)). A single VH or VL domain may be sufficient to confer antigen-binding specificity.
[0105] "Complementary determining region" or "CDR region" or "CDR" refers to the region in the variable domain of an antibody that is highly variable in sequence and forms structurally defined loops ("hypervariable loops") and / or contains antigen - contacting residues ("antigen - contact points"). CDRs are mainly responsible for binding to epitopes. The three CDRs of the heavy chain are usually referred to as HCDR1, HCDR2, and HCDR3; since the single - domain antibodies of the present invention do not contain a light chain, its three CDRs can also be referred to as CDR1, CDR2, and CDR3, numbered sequentially from the N - terminus. In a given amino acid sequence of a heavy - chain variable region, the precise amino - acid sequence boundaries of each CDR can be determined using any one or a combination of many well - known antibody CDR assignment systems, including, for example: Chothia, which is based on the three - dimensional structure of the antibody and the topology of the CDR loops (Chothia et al. (1989) Nature 342:877 - 883, Al - Lazikani et al., "Standard conformations for the canonical structures of immunoglobulins", Journal of Molecular Biology, 273, 927 - 948 (1997)), Kabat, which is based on antibody sequence variability (Kabat et al., Sequences of Proteins of Immunological Interest, 4th edition, U.S. Department of Health and Human Services, National Institutes of Health (1987)), AbM (University of Bath), Contact (University College London), the international ImMunoGeneTics database (IMGT) (http: / / imgt.cines.fr / ), and the North CDR definition, which is based on affinity propagation clustering using a large number of crystal structures.
[0106] For example, according to different CDR determination schemes, the residues of each CDR are as described below.
[0107]
[0108] Unless otherwise specified, the CDRs of the antibodies of the present invention can have their boundaries determined by those skilled in the art according to any scheme in the art (such as different assignment systems or combinations).
[0109] It should be noted that the boundaries of the CDRs of the variable regions of the same antibody obtained based on different assignment systems may vary. That is, the CDR sequences of the same antibody variable region defined under different assignment systems are different. Therefore, when referring to an antibody defined by a specific CDR sequence of the present invention, the scope of said antibody also encompasses such antibodies whose variable region sequences contain the specific CDR sequence, but whose claimed CDR boundaries are different from the specific CDR boundaries defined by the present invention due to the application of different schemes (such as different assignment systems or combinations).
[0110] Antibodies with different specificities (i.e., different binding sites for different antigens) have different CDRs. However, although the CDRs are different between antibodies, only a limited number of amino acid positions within the CDRs are directly involved in antigen binding. Using at least two of the Kabat, Chothia, AbM, Contact, and North methods, a minimal overlapping region can be determined, thus providing a "minimal binding unit" for antigen binding. The minimal binding unit can be a sub-part of a CDR. As will be appreciated by those skilled in the art, the residues of the remaining part of the CDR sequence can be determined by the structure and protein folding of the antibody. Therefore, the present invention also contemplates variants of any CDR given herein. For example, in a variant of a CDR, the amino acid residues of the minimal binding unit can remain unchanged, while the remaining CDR residues defined according to Kabat or Chothia can be replaced by conservative amino acid residues. Unless otherwise specified, in the present invention, the term "CDR" or "CDR sequence" encompasses the CDR sequences determined in any of the above ways.
[0111] CDRs can also be determined based on having the same AbM numbered positions as a reference CDR sequence (such as any of the CDRs exemplified in the present invention). In one embodiment, the CDRs of the antibodies of the present invention are determined for position according to the AbM numbering scheme.
[0112] Unless otherwise specified, in the present invention, when referring to the residue positions in the antibody variable region and CDRs (including the heavy chain variable region residues), it refers to the numbered positions according to the AbM numbering system.
[0113] The term "single-domain antibody" generally refers to an antibody in which a single variable domain (e.g., a heavy-chain variable domain (VH) or a light-chain variable domain (VL), a heavy-chain variable domain derived from a camelid heavy-chain antibody, a VH-like single-domain (v-NAR) derived from fish IgNAR) can confer antigen binding. That is, this single variable domain does not need to interact with another variable domain to recognize the target antigen. Examples of single-domain antibodies include single-domain antibodies derived from camelids (llamas and camels) and cartilaginous fish (e.g., nurse sharks) (WO 2005 / 035572). The single-domain antibodies derived from camelids are also abbreviated as "single-domain antibody" in this application, or referred to as "VHH domain" (or simply VHH) or "nanobody".
[0114] The term "VHH" or "VHH domain" is used herein to refer to a single heavy-chain variable domain derived from a heavy-chain antibody lacking a light chain, i.e., it consists only of a single heavy-chain variable region and contains only one chain FR4-CDR3-FR3-CDR2-FR2-CDR1-FR1 from the C-terminus to the N-terminus, also referred to as a single variable domain (sVD). Different from the conventional VH of a four-chain immunoglobulin, the VHH domain does not need to pair with a light-chain variable domain to form an antigen-binding site. The single-domain antibody is the smallest unit currently known to be able to bind to a target antigen. In some cases, for the therapeutic application of VHH, it is desirable to reduce its immunogenicity. Preferably, in one embodiment, the present invention provides an antibody comprising a humanized VHH domain.
[0115] The term "chimeric antibody" refers to an antibody molecule in which (a) the constant region or a part thereof is altered, replaced or exchanged so that the antigen-binding site is linked to a constant region of a different or altered class, effector function and / or species or a completely different molecule (e.g., an enzyme, a toxin, a hormone, a growth factor, a drug, etc.) that confers new properties to the chimeric antibody; or (b) the variable region or a part thereof is altered, replaced or exchanged with a variable region having a different or altered antigen specificity. For example, a camel antibody can be modified by replacing its constant region with a constant region from a human immunoglobulin. Due to the replacement with a human constant region, the chimeric antibody can retain its specificity in recognizing the antigen while having reduced antigenicity in humans compared to the original camel antibody.
[0116] The sequence identity between sequences is calculated as follows:
[0117] To determine the percent identity between two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of the first and second amino acid or nucleic acid sequences for optimal alignment or non-homologous sequences can be discarded for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the reference sequence being aligned is at least 30%, preferably at least 40%, more preferably at least 50%, 60% and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at the corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, then the molecules are identical at that position.
[0118] The sequence comparison between two sequences and the calculation of percent identity can be achieved using a mathematical algorithm. In a preferred embodiment, the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm incorporated into the GAP program in the GCG software package (available at http: / / www.gcg.com) is used, with a Blossum 62 matrix or PAM250 matrix and gap weights of 16, 14, 12, 10, 8, 6 or 4 and length weights of 1, 2, 3, 4, 5 or 6 to determine the percent identity between two amino acid sequences. In yet another preferred embodiment, the GAP program in the GCG software package (available at http: / / www.gcg.com) is used, with an NWSgapdna.CMP matrix and gap weights of 40, 50, 60, 70 or 80 and length weights of 1, 2, 3, 4, 5 or 6 to determine the percent identity between two nucleotide sequences. A particularly preferred set of parameters (and a set of parameters that should be used unless otherwise stated) is the Blossum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4 and a frameshift gap penalty of 5.
[0119] The percent identity between two amino acid sequences or nucleotide sequences can also be determined using the E. Meyers and W. Miller algorithm ((1989) CABIOS, 4:11-17) incorporated into the ALIGN program (version 2.0), with a PAM120 weighted residue table, a gap length penalty of 12 and a gap penalty of 4.
[0120] Additionally or alternatively, the nucleic acid sequences and protein sequences described herein can be further used as "query sequences" to perform a search against public databases to, for example, identify other family member sequences or related sequences.
[0121] "Affinity" refers to the strength of the sum of all non-covalent interactions between a single binding site of a molecule (especially a specific binding molecule, such as an antibody) and its binding partner (such as an antigen). Unless otherwise stated, when used herein, "binding affinity" refers to the intrinsic binding affinity reflecting the 1:1 interaction between the members of a binding pair (such as an antibody and an antigen). The affinity of molecule X for its partner Y is typically expressed by the binding dissociation equilibrium constant (KD). Affinity can be measured by conventional methods known in the art, including those known in the prior art and described herein.
[0122] As used herein, the term "k on " (also referred to as "Kon", "kon") means the binding rate constant at which a binding protein (e.g., an antibody) binds to an antigen to form a binding complex (e.g., an antibody / antigen complex) known in the art. "k on " is also referred to as the term "association rate constant" or "ka", and is used interchangeably herein. This value represents the binding rate of an antibody or binding protein to its target molecule or the rate of complex formation between an antibody or binding protein and its target molecule, as shown in the following equation:
[0123] Antibody / binding protein ("Ab") + antigen ("Ag") → Ab-Ag.
[0124] As used herein, the term "k off " (also referred to as "Koff", "koff") means the rate constant at which an antibody or binding protein dissociates from a binding complex, or the "dissociation rate constant", as known in the art. This value represents the dissociation rate of an antibody or binding protein from its target molecule, or the rate at which the Ab-Ag complex dissociates into free antibody or binding protein and its target molecule over time, as shown in the following equation:
[0125] Ab + Ag ← Ab-Ag.
[0126] As used herein, the term "K D " (also "K d ") is intended to represent the "equilibrium dissociation constant" and refers to the value obtained in a titration measurement at equilibrium, or the value obtained by dividing the dissociation rate constant (k off ) by the binding rate constant (k on ). The binding rate constant (k on ), the dissociation rate constant (k off ), and the equilibrium dissociation constant (K D)For representing the binding affinity of an antibody or binding protein to a target molecule. Methods for determining the association and dissociation rate constants are well known in the art. Fluorescence-based techniques can be used, providing high sensitivity and the ability to examine samples in physiological buffers at equilibrium, including but not limited to fluorescence titration, competitive ELISA, flow cytometry titration analysis (FACS titration). Other experimental methods and instruments can be used, such as calorimetry like isothermal titration calorimetry (ITC), (biomolecular interaction analysis) assays (e.g., instruments available from BIAcore International AB, GE Healthcare, Uppsala, Sweden). Using, for example, Biolayer interferometry (BLI) with the RED96 system (Pall FortéBio LLC) is another affinity assay technique. Additionally, the (kinetic exclusion assay) from Sapidyne Instruments (Boise, Idaho) can also be used.
[0127] The term "polypeptide library" refers to a collection of multiple polypeptides with different structures.
[0128] The term "phage display library" refers to a platform for expressing a multitude of polypeptides (e.g., the fusion polypeptides of the present invention) on the surface of a phage capsid. The platform for expressing polypeptides is suitable for screening for interacting / specifically binding molecules against a target molecule.
[0129] As used herein, "transformation" refers to any process by which exogenous DNA enters a host cell. Transformation can be carried out under natural or artificial conditions using various methods well known in the art. Transformation can rely on any known method for inserting an exogenous nucleic acid sequence into a prokaryotic or eukaryotic host cell. The method is selected based on the host cell to be transformed and can include, but not be limited to, transfection, viral infection, electroporation, lipofection, and particle bombardment. Such "transformed" cells include stably transformed cells in which the inserted DNA can replicate as an autonomous plasmid or as part of the host chromosome. Also included are cells that transiently express the inserted DNA or RNA for a limited time.
[0130] As used herein, "vector" refers to a construct that is capable of delivering one or more genes or sequences of interest into a host cell and preferably expressing the gene or sequence in the host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids, phage vectors (for phage display systems), yeast vectors (for yeast display systems), DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
[0131] The term "phagemid" is a DNA expression system that can replicate as a plasmid or be packaged as single-stranded DNA in a phage viral particle. A phagemid contains at least a portion of the phage genome, such as the capsid protein gene. A phagemid requires a helper phage to provide additional proteins to generate phage viral particles that display the recombinant protein encoded by the phagemid upon infection of bacteria.
[0132] The term "phage" refers to viral particles that infect bacteria and amplify.
[0133] The term "helper phage" refers to specific phage particles that provide all the proteins / substances required to generate functional phage viral particles.
[0134] The term "panning" refers to an affinity selection technique for selecting binders against a specific target / antigen.
[0135] In the present invention, the terms "host cell", "host cell line", and "host cell culture" are used interchangeably and refer to a cell into which exogenous nucleic acid has been introduced, including progeny of such cells. Host cells include "transformants" and "transformed cells", including primary transformed cells and progeny derived therefrom, regardless of the number of passages. The progeny may not be completely identical in nucleic acid content to the parental cell, but may contain mutations. Also included herein are mutant progeny having the same function or biological activity as the cells selected or screened in the originally transformed cell. In some embodiments, the host cells include prokaryotic and eukaryotic cells selected from any kingdom of life. In other embodiments, the eukaryotic cells include protists, fungi, plant, and animal cells. In another embodiment, the host cells include, but are not limited to, the prokaryotic cell line Escherichia coli; mammalian cell lines CHO, HEK 293, Jurkat, COS, NS0, SP2, and PER.C6; the insect cell line Sf9; and the fungal cell Saccharomyces cerevisiae.
[0136] The terms "linker", "linking peptide", "connector", "peptide linker", etc. are used interchangeably in the present application and refer to a peptide containing one or more consecutive amino acids, such as small amino acid residues or hydrophilic amino acid residues (e.g., glycine, serine, threonine, proline, aspartic acid, asparagine, etc.). The linking peptide generally contains from 5 to 50 amino acids in length, e.g., 10, 15, 20, 25, 30 amino acids in length. Those skilled in the art will appreciate that many commonly used linkers can be used in the embodiments of the present invention.
[0137] II. Anti-HSA VHH of the present invention
[0138] Human serum albumin (HSA) consists of 585 amino acids and has a molecular weight of approximately 66.5 KD. It is the most abundant protein in human plasma, accounting for about 60% of the total plasma protein (Ha C E, Bhagavan NV. Novel insights into the pleiotropic effects of human serum albumin in health and disease [J]. Biochimica et Biophysica Acta (BBA)-General Subjects, 2013, 1830(12):5486-5493.). Human serum albumin has the advantages of high activity, low immunogenicity, and low toxicity and side effects, and plays an increasingly important role in the treatment of clinical diseases. Under normal physiological conditions, at pH = 7.4, the binding ability of HSA to the FcRn receptor is weak; HSA enters the cell through natural endocytosis extracellularly. At pH = 6, HSA has a high affinity for FcRn to form an HSA-FcRn complex, preventing HSA from entering the lysosomal metabolic cycle. As FcRn circulates inside and outside the cell, HSA is released extracellularly to further play its role. Therefore, under normal circumstances, the average half-life of human serum albumin is 15 - 20 days (Schmidt, Michael M et al. “Crystal structure of an HSA / FcRn complex reveals recycling by competitive mimicry of HSA ligands at a pH-dependent hydrophobic interface.” Structure (London, England: 1993) vol. 21, 11(2013):1966-78.).
[0139] Unless otherwise specified in the context, terms such as "anti-HSA VHH", "anti-HSA single-domain antibody", "single domain of the immunoglobulin heavy chain variable region that specifically binds to human serum albumin", "VHH of the present invention", etc. refer to VHHs that can bind to the antigen human serum albumin with sufficient affinity.
[0140] The anti-HSA VHH domain according to the present invention comprises a VHH domain from an anti-HSA single-domain antibody.
[0141] In some preferred embodiments, the anti-HSA VHH comprises CDR1 - 3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NOs: 9 - 21.
[0142] In some embodiments, the anti-HSA VHH comprises CDR1-3 having the sequences shown in SEQ ID NO: 6, 7, and 8, respectively.
[0143] In some embodiments, the anti-HSA VHH comprises the amino acid sequence shown in any one of SEQ ID NO: 9-21, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NO: 9-21, or an amino acid sequence having one or more (preferably 1-10, more preferably 1-5) amino acid additions, deletions, and / or substitutions compared to any one of SEQ ID NO: 9-21. For example, the VHH domain consists of the amino acid sequence shown in SEQ ID NO: 14.
[0144] In some embodiments, the anti-HSA VHH of the present invention is a partially humanized or fully humanized VHH, a chimeric VHH. Compared with the VHH of camelids, the partially humanized or fully humanized VHH, chimeric VHH of the present invention has a reduced human anti-camelid antibody response in humans, improving the safety of application; and is an affinity matured VHH.
[0145] In some embodiments of the present invention, the amino acid changes described herein include amino acid substitutions, insertions, or deletions. Preferably, the amino acid changes described herein are amino acid substitutions, preferably conservative substitutions.
[0146] In a preferred embodiment, the amino acid changes of the present invention occur in regions outside the CDRs (e.g., in the FRs). More preferably, the amino acid changes of the present invention occur in regions outside the VHH. In some embodiments, the substitution is a conservative substitution. A conservative substitution means that one amino acid is replaced by another amino acid within the same category, e.g., an acidic amino acid is replaced by another acidic amino acid, a basic amino acid is replaced by another basic amino acid, or a neutral amino acid is replaced by another neutral amino acid. Exemplary substitutions are shown in the following table:
[0147] Original residue Exemplary substitution Preferred substitution Ala(A) Val; Leu; Ile Val Arg(R) Lys; Gln; Asn Lys Asn(N) Gln; His; Asp, Lys; Arg Gln Asp(D) Glu; Asn Glu Cys(C) Ser; Ala Ser Gln(Q) Asn; Glu Asn Glu(E) Asp; Gln Asp Gly(G) Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu, Val; Met; Ala; Phe; Norleucine Leu Leu(L) Norleucine; Ile; Val; Met; Ala; Phe Ile Lys(K) Arg; Gln; Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Trp; Leu; Val; Ile; Ala; Tyr Tyr Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Val; Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala; Norleucine Leu
[0148] The constant domain of an immunoglobulin, abbreviated as the "constant region" of an antibody, refers to the C-terminal sequence-conserved region in a single polypeptide chain of a natural antibody. The heavy-chain constant region contains multiple domains such as CH1, CH2, and CH3. The "Fc region" is used to define the C-terminal region of an immunoglobulin heavy chain that includes at least a portion of the constant region (e.g., CH2 and CH3 domains). The "Fc region" encompasses the native sequence Fc region and variant Fc regions. In some embodiments, the human IgG heavy-chain Fc region extends from Cys226 or Pro230 to the carboxyl terminus of the heavy chain. However, the C-terminal lysine (Lys447) of the Fc region may or may not be present (the numbering in this paragraph is according to the EU numbering system, also known as the EU index, such as Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991).
[0149] In some embodiments of the present invention, the anti-HSA VHH domain is linked to an immunoglobulin constant domain, such as an Fc region composed of the immunoglobulin constant regions CH2 and CH3, such as the Fc region of human IgG1, IgG2, IgG3, or IgG4.
[0150] In some embodiments, the anti-HSA VHH domain of the present invention binds to human / cynomolgus monkey HSA with high affinity, for example, exhibiting an EC 50 value not higher than 1000 ng / mL, an EC 50 value not higher than 950 ng / mL, an EC 50 value not higher than 900 ng / mL, an EC 50 value not higher than 850 ng / mL, an EC 50 value not higher than 800 ng / mL, an EC 50 value not higher than 750 ng / mL, an EC 50 value not higher than 700 ng / mL, an EC 50 value not higher than 650 ng / mL, an EC 50 value not higher than 600 ng / mL, an EC 50 value not higher than 550 ng / mL, an EC 50 value not higher than 500 ng / mL, an EC 50 value not higher than 450 ng / mL, an EC 50 value not higher than 400 ng / mL, an EC 50 value not higher than 350 ng / mL, an EC 50value, EC not higher than 250 ng / mL 50 value, EC not higher than 200 ng / mL 50 value, EC not higher than 180 ng / mL 50 value, EC not higher than 160 ng / mL 50 value, EC not higher than 150 ng / mL 50 value, EC not higher than 140 ng / mL 50 value, EC not higher than 130 ng / mL 50 value, EC not higher than 120 ng / mL 50 value, EC not higher than 110 ng / mL 50 value, EC not higher than 100 ng / mL 50 value, EC not higher than 95 ng / mL 50 value, EC not higher than 90 ng / mL 50 value, EC not higher than 85 ng / mL 50 value, EC not higher than 80 ng / mL 50 value, EC not higher than 75 ng / mL 50 value, EC not higher than 70 ng / mL 50 value, EC not higher than 65 ng / mL 50 value, EC not higher than 60 ng / mL 50 value, EC not higher than 55 ng / mL 50 value, EC not higher than 50 ng / mL 50 value, EC not higher than 45 ng / mL 50 value, EC not higher than 40 ng / mL 50 value, EC not higher than 35 ng / mL 50 value, EC not higher than 30 ng / mL 50 value, EC not higher than 25 ng / mL 50 value, EC not higher than 20 ng / mL 50 value, EC not higher than 18 ng / mL 50 value, EC not higher than 16 ng / mL 50 value, EC not higher than 15 ng / mL 50 value, EC not higher than 14 ng / mL 50 value, EC not higher than 13 ng / mL 50 value, EC not higher than 12 ng / mL 50 value, EC not higher than 11 ng / mL 50 value, EC not higher than 10 ng / mL 50 value, EC not higher than 8 ng / mL 50a value, an EC not higher than 6 ng / mL 50 a value, an EC not higher than 5.9 ng / mL 50 a value, an EC not higher than 5.8 ng / mL 50 a value, an EC not higher than 5.7 ng / mL 50 a value, or an EC lower than that 50 value.
[0151] In another aspect, the present invention provides an anti-HSA VHH domain having one or more of the following characteristics:
[0152] (1) binding to an epitope of human HSA that is the same as, or completely or partially overlaps with, that bound by any of the anti-HSA VHH domains of the present invention;
[0153] (2) competing with any of the anti-HSA VHH domains of the present invention for binding to an epitope of human HSA;
[0154] (3) exhibiting the same or similar binding affinity and / or specificity for human HSA as the anti-HSA VHH domain of the present invention;
[0155] (4) having one or more biological properties of the antibody of the present invention.
[0156] The fusion polypeptides and polypeptide libraries of the present invention
[0157] The following will describe each aspect of the present invention in detail. Those skilled in the art can understand that any combination of technical features of these aspects is within the scope of the present invention unless the context clearly indicates otherwise. And, those skilled in the art can understand that different aspects of the present invention can include any combination of features unless the context clearly indicates otherwise.
[0158] In a first aspect, the present invention provides a fusion polypeptide. The fusion polypeptide comprises two polypeptide fragments, a cyclic peptide and a specific antigen-binding molecule (preferably, a single-domain antibody). In some specific embodiments, the fusion polypeptide further comprises a linker fragment, wherein the cyclic peptide and the single-domain antibody are fused via the linker. In some specific embodiments, the fusion polypeptide further comprises a tag fragment, and the tag fragment can be an N-terminal tag sequence or a C-terminal tag sequence.
[0159] In another aspect, the present invention further provides a random polypeptide library, wherein each member has the structure of the fusion polypeptide provided in the first aspect of the present invention, and preferably, the random polypeptide therein is the cyclic peptide (R fragment part) in the fusion polypeptide.
[0160] In some preferred embodiments, the fusion polypeptide has the following structure of formula (I) from the N-terminus to the C-terminus:
[0161] R-(L)-V-(T) (I)
[0162] Wherein, R is a cyclic peptide, preferably a cyclic peptide cyclized via an intramolecular disulfide bond formed between two cysteines within a fragment, more preferably with at least two amino acid residues separating the two cysteines forming the disulfide bond, and most preferably with at least four amino acid residues separating the two cysteines forming the disulfide bond;
[0163] L is an optional linker;
[0164] V is a single domain antibody (i.e., VHH domain);
[0165] T is an optional C-terminal tag sequence.
[0166] Cyclic peptide (R fragment)
[0167] In the context of the present invention, the R fragment, as the core part of the fusion polypeptide and the random cyclic peptide library, is sequence-diverse. In a preferred embodiment, the sequence of the R fragment is designed following the composition rules of naturally occurring high-affinity polypeptide sequences, and thus is expected to be more likely to obtain active cyclic peptides through screening. The R fragment of the present invention, i.e., the cyclic peptide part, provides a candidate number far exceeding that of the natural cyclic peptide library and a potential for binding specificity higher than that of natural cyclic peptides for the library of the present invention, thereby making the random cyclic peptide library of the present invention have significant application value.
[0168] In some specific embodiments, the R fragment contains 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 amino acid residues. In some specific embodiments, the amino acid residues at the 1st position at the N-terminus and the 1st position at the C-terminus of the R fragment are cysteines, and a disulfide bond (i.e., an intramolecular disulfide bond) is formed between the two cysteines. In some other specific embodiments, a disulfide bond (i.e., an intramolecular disulfide bond) is formed between any two cysteines within the R fragment, wherein: the two cysteines forming the disulfide bond are respectively located at any position from the 1st to the 14th position at the N-terminus and any position from the 1st to the 14th position at the C-terminus, and there are at least two and at most seventeen amino acid residues separating the two; preferably, the two cysteines forming the disulfide bond are respectively located at any position from the 1st to the 12th position at the N-terminus and any position from the 1st to the 12th position at the C-terminus, and there are at least four and at most fifteen amino acid residues separating the two. In some other specific embodiments, a disulfide bond (i.e., an intramolecular disulfide bond) is formed between any two cysteines within the R fragment, wherein: the two cysteines forming the disulfide bond are respectively located at any position from the 2nd to the 5th position at the N-terminus and any position from the 2nd to the 5th position at the C-terminus, and there are at least four amino acid residues separating the two.
[0169] In some specific embodiments, the R fragment has a CysX n Cys form structure, where Cys = cysteine; X = any random amino acid; n = any integer from 6 to 17.
[0170] In some specific embodiments, the R fragment has a CysX6Cys form (NL6 form) structure, where Cys = cysteine; X = any random amino acid.
[0171] In some specific embodiments, the R fragment has a CysX7Cys form (NL7 form) structure, where Cys = cysteine; X = any random amino acid.
[0172] In some specific embodiments, the R fragment has a CysX8Cys form (NL8 form) structure, where Cys = cysteine; X = any random amino acid.
[0173] In some specific embodiments, the R fragment has a CysX9Cys form (NL9 form) structure, where Cys = cysteine; X = any random amino acid.
[0174] In some specific embodiments, the R fragment has a CysX 10 Cys form (NL10 form) structure, where Cys = cysteine; X = any random amino acid.
[0175] In some specific embodiments, the R fragment has a CysX 11 Cys form (NL11 form) structure, where Cys = cysteine; X = any random amino acid.
[0176] In some specific embodiments, the R fragment has a CysX 12 Cys form (NL12 form) structure, where Cys = cysteine; X = any random amino acid.
[0177] In some specific embodiments, the R fragment has a CysX 13 Cys form (NL13 form) structure, where Cys = cysteine; X = any random amino acid.
[0178] In some specific embodiments, the R fragment has a CysX 14 Cys form (NL14 form) structure, where Cys = cysteine; X = any random amino acid.
[0179] In some specific embodiments, the R fragment has a CysX 15Structure of the Cys form (NL15 form), where Cys = cysteine; X = any random amino acid.
[0180] In some specific embodiments, the R fragment has CysX 16 Structure of the Cys form (NL16 form), where Cys = cysteine; X = any random amino acid.
[0181] In some specific embodiments, the R fragment has CysX 17 Structure of the Cys form (NL17 form), where Cys = cysteine; X = any random amino acid.
[0182] In some in some specific embodiments, the R fragment has X n1 CysX n2 CysX n3 Structure of the form, where Cys = cysteine; X = any random amino acid; n1 is any integer from 0 to 14, n2 is any integer from 2 to 15, n3 is any integer from 0 to 14, and: the sum of n1, n2, and n3 is any integer from 7 to 15.
[0183] In some specific embodiments, the R fragment has X n1 CysX n2 CysX n3 Structure of the form, where Cys = cysteine; X = any random amino acid; n1 is any integer from 0 to 11, n2 is any integer from 4 to 15, n3 is any integer from 0 to 11, and: the sum of n1, n2, and n3 is any integer from 7 to 15.
[0184] In some specific embodiments, the R fragment has X n1 CysX n2 CysX n3 Structure of the form, where Cys = cysteine; X = any random amino acid; n1 = 1, 2, 3, or 4, n2 is any integer from 4 to 9, n3 = 1, 2, or 3, and the sum of n1, n2, and n3 is any integer from 7 to 15.
[0185] In some specific embodiments, the R fragment has a structure of the form XCysX4CysX2 (NB9-9 form), where Cys = cysteine; X = any random amino acid.
[0186] In some specific embodiments, the R fragment has a structure of the form XCysX5CysX2 (NB10-11 form), where Cys = cysteine; X = any random amino acid.
[0187] In some specific embodiments, the R fragment has a structure of the form X2CysX5CysX2 (NB11-19 form), where Cys = cysteine; X = any random amino acid.
[0188] In some specific embodiments, the R fragment has a structure of the form X2CysX6CysX2 (NB12-22 form), where Cys = cysteine; X = any random amino acid.
[0189] In some specific embodiments, the R fragment has a structure of the form X3CysX6CysX2 (NB13-32 form), where Cys = cysteine; X = any random amino acid.
[0190] In some specific embodiments, the R fragment has a structure of the form X3CysX7CysX2 (NB14-36 form), where Cys = cysteine; X = any random amino acid.
[0191] In some specific embodiments, the R fragment has a structure of the form X3CysX8CysX2 (NB15-40 form), where Cys = cysteine; X = any random amino acid.
[0192] In some specific embodiments, the R fragment has a structure of the form X4CysX8CysX2 (NB16-53 form), where Cys = cysteine; X = any random amino acid.
[0193] In some specific embodiments, the R fragment has a structure of the form X4CysX9CysX2 (NB17-58 form), where Cys = cysteine; X = any random amino acid.
[0194] In some specific embodiments, except for the two cysteines forming the intra-chain disulfide bond, the R fragment does not contain other cysteine residues. In some specific embodiments, except for the two cysteines forming the intra-chain disulfide bond, the R fragment further contains other cysteine residues.
[0195] In some specific embodiments, the R fragment is derived from the CDR3 domain of a human antibody or the CDR3 domain of a single-domain antibody. In some specific embodiments, the R fragment has at least 80% sequence identity with the CDR3 domain of a human antibody or the CDR3 domain of a single-domain antibody, preferably at least 85%, at least 88%, at least 90%, at least 93%, at least 96%, at least 99% or 100% sequence identity.
[0196] Single-domain antibody (V fragment)
[0197] The present invention provides cyclic peptides fused with single-domain antibodies. VHH (nanobody) is derived from the variable region of the heavy-chain antibody (VHH) of camelids. These VHHs represent some of the smallest antigen-binding antibody-derived proteins. Since the VHH has a relatively small molecular weight of about 20 kDa, it can be well displayed on phages. The present invention finds that fusing a nanobody at the C-terminus of a polypeptide can improve the display efficiency of the polypeptide on phages. VHH antibodies generally have a high expression level in eukaryotic cells (CHO / HEK293). Conventional purification of VHH antibody proteins requires purification using a nickel column with a fused His tag. However, there are purity problems with the nanobodies purified by the nickel column. Some researchers have modified Protein A to obtain a protein that can bind both VHH protein and Fc protein (Fridy et al. 2015. Engineered high-affinity nanobodies recognizing staphylococcal Protein A and suitable for native isolation of protein complexes. Analytical Biochemistry 477, 92–94. Henry et al. 2016. A Rational Engineering Strategy for Designing Protein A-Binding Camelid Single-Domain Antibodies. PLOS ONE.). Such Protein A fillers include MabSelect SuRe from Cytiva TM LX and Amsphere from JSR life science TM A3 Protein A resin can all be used to purify VHH antibodies. Compared with purifying VHH antibodies with a His tag using a nickel column, this method of directly binding VHH with a filler to purify VHH antibody proteins can obtain antibody proteins with higher purity. The design of the single-domain antibody-fused cyclic peptide provided by the present invention can not only improve the phage display efficiency of the polypeptide, but also use eukaryotic cell lines to express and prepare the polypeptide.
[0198] In some preferred embodiments, the V fragment is a VHH that specifically binds to human serum albumin (HSA), for example, the anti-HSA VHH domain of the present invention. Similar to traditional recombinant protein and polypeptide drugs, it can be predicted that if an active cyclic peptide is screened out, its half-life in human serum may also be relatively short, which will lead to a relatively high dosing frequency. The anti-HSA VHH has the advantages of high affinity, good thermal stability, small molecular weight, and strong specificity. The present invention provides a cyclic peptide fused with a VHH that binds to human serum albumin (HSA). It can be predicted that the fusion polypeptide will have an extended half-life.
[0199] Linker
[0200] In the polypeptide according to the present invention, the respective functional parts can optionally be connected by a linker. The linker is preferably a flexible linker that does not affect the three-dimensional structures of the two polypeptide fragments being connected. There is no specific limitation on the linker that can be used in the antibodies of the present invention. Those skilled in the art can easily determine the available linker sequences according to the components to be connected and the connection positions.
[0201] In a preferred embodiment of the present invention, the linker is a flexible linking peptide preferably 5 - 50 amino acids in length, more preferably containing glycine (G) and / or serine (S) and / or threonine (T) residues. In some specific embodiments, the linker has a length of 5 - 50 amino acids, for example, 10, 15, 20, 25, or 30 amino acids in length, or has an amino acid length falling between any two integers. In some embodiments, the linker is an immunoglobulin Fc hinge region sequence having EPKSSDKTHTCPPCP. In some embodiments, the linker is (GGGSG)n; (GGSGG)n; (GSGGG)n; (SGGGG)n; (GGTGS)n; (GTSPGG)n; (GNGGGS)n; (GGG)n; (DGGGS)n; (TGEKP)n; (GGRR)n; (EGKSSGSGSESKVD)n; (KESGSVSSEQLAQFRSLD)n; (GGRRGGGS)n; (LRQRDGERP)n; (LRQKDGGGSERP)n; (GSTSGSGKPGSGEGSTKG)n and / or G4S - GGSGG - G4S - SGGGG, etc., where n is an integer equal to or greater than 1, for example, n is an integer of 1, 2, 3, 4, 5, 6, 7, 8, 9. In one embodiment, the linker comprises the amino acid sequence (G4S)n, where n is an integer equal to or greater than 1, for example, n is an integer of 2, 3, 4, 5, 6, or 7. In a most preferred embodiment, the linker consists of the amino acid sequence (G4S)3.
[0202] Preferably, the linker contained in the fusion polypeptide of the present invention does not affect the activity and / or binding properties of the fusion polypeptide (in particular, the R fragment and the V fragment).
[0203] In some specific embodiments, the linker L is absent.
[0204] Tag
[0205] The fusion polypeptide of the present invention may optionally contain any commonly used tag in the art, or may optionally not contain a tag sequence. The tag may be an N-terminal tag or a C-terminal tag, such as a C-terminal tag (T fragment).
[0206] The tag contained in the fusion polypeptide of the present invention has the composition, properties and uses of a tag sequence well known in the art. Preferably, the tag contained in the fusion polypeptide of the present invention does not affect the activity and / or binding properties of the fusion polypeptide (in particular, the R fragment and the V fragment).
[0207] In some specific embodiments, the T fragment is a Flag tag, a His tag, or a Flag-His tag, for example, having the amino acid sequence as set forth in SEQ ID NO: 27.
[0208] In some specific embodiments, the T fragment is absent.
[0209] In a preferred embodiment of the present invention, each polypeptide member of the polypeptide library respectively contains an R fragment having a different amino acid sequence. In a preferred embodiment of the present invention, each polypeptide member has the same L fragment amino acid sequence, the same V fragment amino acid sequence and the same T fragment amino acid sequence.
[0210] IV. Polynucleotides, vectors and host cells of the present invention
[0211] The present invention provides a polynucleotide encoding any polypeptide member of the fusion polypeptide or polypeptide library of the present invention.
[0212] Thus, the present invention also provides a corresponding polynucleotide library. An expression vector containing the polynucleotide is also provided, preferably, the vector is a phage vector.
[0213] In addition, the present invention also provides a polynucleotide encoding the anti-HSA VHH of the present invention, and the polynucleotide molecule may contain a nucleic acid sequence encoding all or at least a part of its amino acid sequence, or a nucleic acid sequence encoding all or at least a part of the amino acid sequence of the fusion protein.
[0214] For example, the polynucleotide molecule of the present invention comprises a nucleic acid encoding an amino acid sequence selected from any one of SEQ ID NO: 9-21, or comprises a nucleic acid encoding an amino acid sequence having at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence shown in any one of SEQ ID NO: 9-21.
[0215] In yet another aspect, in addition to phage vectors, the present invention also provides other expression vectors comprising the polynucleotide. Preferably, the vector is a eukaryotic expression vector, such as pcDNA3.4-TOPO. In some embodiments, the polynucleotide molecules as described herein are comprised in one or more expression vectors.
[0216] In yet another aspect, the present invention provides a host cell comprising the polynucleotide molecule as described herein or the expression vector as described herein. Preferably, the host cell is prokaryotic or eukaryotic, more preferably selected from Escherichia coli cells, yeast cells, mammalian cells, and most preferably, the host cell is 293 cells or CHO cells.
[0217] In yet another aspect, the present invention provides a method for preparing an anti-HSA VHH or a fusion protein comprising the same as described herein, the method comprising expressing the antibody or fusion protein in the host cell of the present invention under conditions suitable for the expression of the antibody or fusion protein, and recovering the expressed antibody or fusion protein from the host cell.
[0218] In some embodiments, the polynucleotide library as described herein is comprised in a phage library.
[0219] V. Preparation of the phage display library of the present invention
[0220] Furthermore, in another aspect, the present invention provides a phage display library for displaying a polypeptide library. Based on phage display technology, the phage display library of the present invention inserts a polynucleotide encoding a fusion polypeptide comprising a random cyclic peptide of the present invention into the phage structural genome, such that the fusion polypeptide can be expressed and presented on the phage surface in the correct three-dimensional structure along with the reassembly of progeny phages, and thus has biological activity.
[0221] Thus, in some embodiments, each phage particle in the phage display library of the present invention independently comprises a polypeptide having a three-dimensional structure. In some embodiments, each phage particle in the phage display library of the present invention comprises a polynucleotide encoding a polypeptide having a three-dimensional structure thereof. That is, the phage display library of the present invention comprises the polynucleotide library of the present invention.
[0222] In some embodiments, the capacity of the phage display library of the present invention reaches at least 1×10 6 unique cyclic peptides, preferably at least 1×10 7 species, at least 1×10 8 species, at least 1×10 9 species, at least 1×10 10 species, at least 1×10 11 species, at least 1×10 12 species. In some embodiments, the uniqueness of the phage display library of the present invention is higher than 95%, higher than 96%, higher than 97%, higher than 98%, higher than 99%, higher than 99.5%, higher than 99.9% or 100%.
[0223] The present invention also provides a method for constructing a phage display library displaying cyclic peptides, comprising the steps of: (a) obtaining the polynucleotide library of the present invention; and (b) introducing it into the phage genome.
[0224] In a specific embodiment, step (a) includes:
[0225] (a1) Amplification of the cyclic peptide coding fragment: Using an artificially synthesized trinucleotide polynucleotide (Trimer polynucleotide) library as a template, a nucleic acid sequence fragment encoding the cyclic peptide fragment is obtained by PCR amplification, and then the above product fragment is recovered as the cyclic peptide coding fragment, for example, by agarose gel electrophoresis;
[0226] (a2) Synthesizing a polynucleotide fragment encoding a single-domain antibody and an optional C-terminal tag as the single-domain antibody coding fragment, or using it as a template, obtaining more identical nucleic acid sequence fragments by PCR amplification, and recovering and purifying them as the single-domain antibody coding fragment, for example, by agarose gel electrophoresis;
[0227] (a3) Connecting the two coding fragments obtained in (a1) and (a2) into a full-length single polynucleotide, for example, by a ligation reaction or a fusion PCR reaction.
[0228] In a more specific embodiment, the 3'-end portion of the cyclic peptide coding fragment in step (a1) further contains the coding sequence of a linker, so that in the connected full-length single polynucleotide, the cyclic peptide coding sequence and the single-domain antibody coding sequence are connected by the linker coding sequence.
[0229] In a preferred embodiment, the 3'-end of the cyclic peptide coding fragment in (a1) and the 5'-end of the single-domain antibody coding fragment in (a2) respectively contain a part of the coding sequence of the linker, so that in the connected full-length single polynucleotide, the cyclic peptide coding sequence and the single-domain antibody coding sequence are connected by the linker coding sequence, preferably, there is an overlap between the two parts of the linker coding sequence.
[0230] The term "Trimer polynucleotide library" in this article refers to a diverse oligonucleotide molecular coding sequence used to encode diverse amino acid sequences (e.g., containing mutation or randomization sites). Since such polynucleotide molecules are often used as primers, they are commonly referred to as "Trimer primers". See, for example, Paul Gaytán et al., TrimerDimer: an oligonucleotide-based saturation mutagenesis approach that removes redundant and stop codons, Nucleic Acids Res. 2009 Oct; 37(18):e125 and Blagovesta Popova et al., A Robust and Versatile Method of Combinatorial Chemical Synthesis of Gene Libraries via Hierarchical Assembly of Partially Randomized Modules, PLoS One. 2015; 10(9):e0136778. In evolutionary and combinatorial protein engineering, there is a need to generate random amino acid residues at more than one site and preferably simultaneously perform functional assays on polypeptides / proteins containing any kind of mutation (or combination of mutations), which requires the construction of protein mutant libraries (e.g., phage display libraries), for example, by generating gene libraries through random mutagenesis at the DNA level and expressing to obtain protein libraries. To better control the probability of randomization, the simplest method is to use a mixture of the four standard nucleotides at each random position in the coding sequence synthesis, but this will result in an astronomical number of sequence variants, including stop codons and codons for unwanted amino acids, as well as preferences caused by codon redundancy. An improved strategy is to not need to randomize all nucleotide positions. For example, for a DNA fragment encoding N random amino acids, only the nucleotide triplets (i.e., codons for 20 amino acids) need to be changed at N positions, and thus the preferences caused by stop codons and codon redundancy can be avoided. Based on considering the ligation efficiency of each trinucleotide synthon in chemical DNA synthesis, a trinucleotide mixture is prepared such that it can ensure that each trinucleotide ligates with the same statistical probability, or the trinucleotide mixture is adjusted to the desired amino acid distribution at each position with the required statistical probability. Therefore, the application of trinucleotide building blocks to synthesize gene libraries helps to achieve fully controlled all or partial randomization at any predefined number and position of codons in a given coding gene.In a preferred embodiment of the present invention, according to the distribution law of cyclic peptide amino acid sequences (the occurrence probability of specific amino acid residues at specific positions) analyzed by the present invention, a library of trinucleotide polynucleotides (i.e., the coding gene of the cyclic peptide) required is synthesized, so that the diversity of the library enables it to contain the coding sequences of all or most of the R fragments of the present invention. In a preferred embodiment of the present invention, fixed sequences are added to both ends of the random sequence when synthesizing the trinucleotide polynucleotide library for primer binding. Thus, in subsequent PCR amplification, the trinucleotide polynucleotide library is used as a template, and amplification products with the same randomized variant distribution are obtained and used as a gene library for the next step of cloning construction and / or expression. The trinucleotide polynucleotide (Trimer polynucleotide) library according to the present invention can be custom-synthesized by any service provider / company that provides trinucleotide primer (Trimer primer) synthesis services.
[0231] In a more specific embodiment, the artificially synthesized trinucleotide polynucleotide (Trimer polynucleotide) in step (a1) includes a 5' primer binding region with a fixed sequence, a cyclic peptide library coding region encoding 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive random amino acid residues, and a partial linker coding region.
[0232] In a more specific embodiment, the artificially synthesized trinucleotide polynucleotide (Trimer polynucleotide) in step (a1) includes a 5' primer binding region with a fixed sequence containing a first restriction site, a cyclic peptide library coding region encoding 8 - 19 consecutive random amino acid residues, and a 3' primer binding region with a fixed sequence.
[0233] In a more specific embodiment, the artificially synthesized trinucleotide polynucleotide (Trimer polynucleotide) in step (a1) includes a 5' primer binding region with a fixed sequence containing a first restriction site, a cyclic peptide library coding region encoding 8 - 19 consecutive random amino acid residues, an optional (partial) linker coding region with a fixed sequence, and a 3' primer binding region with a fixed sequence.
[0234] Preferably, the cyclic peptide library coding region encoding 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive random amino acid residues is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive groups of random triplet codons (trinucleotides), and the 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive random amino acid residues contain two cysteine residues with at least two amino acid residues in between.
[0235] In a more preferred embodiment, the first amino acid residue at the N-terminus and the first amino acid residue at the C-terminus of the consecutive 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 random amino acid residues are cysteine.
[0236] In a more preferred embodiment, the amino acid residues at any position from the 1st to the 14th position at the N-terminus and at any position from the 1st to the 14th position at the C-terminus of the consecutive 9, 10, 11, 12, 13, 14, 15, 16 or 17 random amino acid residues are cysteine, and there are at least two and at most fifteen amino acid residues between the two cysteines.
[0237] In a more preferred embodiment, the amino acid residues at any position from the 1st to the 12th position at the N-terminus and at any position from the 1st to the 12th position at the C-terminus of the consecutive 9, 10, 11, 12, 13, 14, 15, 16 or 17 random amino acid residues are cysteine, and there are at least four and at most fifteen amino acid residues between the two cysteines.
[0238] In a more preferred embodiment, the amino acid residues at any position from the 2nd to the 5th position at the N-terminus and at any position from the 2nd to the 5th position at the C-terminus of the consecutive 9, 10, 11, 12, 13, 14, 15, 16 or 17 random amino acid residues are cysteine, and there are at least four amino acid residues between the two cysteines.
[0239] In some embodiments, the consecutive random amino acid residues contain two cysteines. In some embodiments, the consecutive random amino acid residues contain more than two cysteines.
[0240] Preferably, the 5' primer binding region and / or the 5' primer contain a first restriction site and an optional prokaryotic cell signal peptide coding sequence.
[0241] In a specific embodiment, the single-domain antibody in step (a2) is a VHH that specifically binds human serum albumin (HSA).
[0242] In a more specific embodiment, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA) comprises CDR1-3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NOs: 9-21. In some more specific embodiments, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA) comprises CDR1-3 of the sequences as shown in SEQ ID NOs: 6, 7, and 8, respectively. In some more specific embodiments, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA) comprises or consists of an amino acid sequence as shown in any one of SEQ ID NOs: 9-21, or comprises or consists of an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% identity to any one of SEQ ID NOs: 9-21, or comprises or consists of an amino acid sequence having one or more (preferably 1-10, more preferably 1-5) amino acid additions, deletions, and / or substitutions compared to any one of SEQ ID NOs: 9-21. In some most preferred embodiments, the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA) comprises or consists of the amino acid sequence shown in SEQ ID NO: 14.
[0243] In some more specific embodiments, optionally include a sequence fragment encoding a C-terminal tag in the phage genome in step (b) or at the 3' end of the single-domain antibody-encoding fragment in step (a2). Preferably, the C-terminal tag is a Flag tag, His tag, Flag-His tag, or absent. In some preferred embodiments, the C-terminal tag comprises or consists of the amino acid sequence shown in SEQ ID NO: 27.
[0244] In some more specific embodiments, the polynucleotide fragment encoding the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA) in step (a2) comprises a second restriction site sequence.
[0245] In some more specific embodiments, the polynucleotide fragment encoding the single domain of the immunoglobulin heavy chain variable region (VHH) that specifically binds to human serum albumin (HSA) in step (a2) further comprises a linker-encoding sequence at its 5' end, and at this time, the 3' end portion of the cyclic peptide-encoding fragment in (a1) does not contain the encoding sequence of the linker, so that in the full-length single polynucleotide after ligation, the cyclic peptide-encoding sequence and the single-domain antibody-encoding sequence are connected by the linker-encoding sequence.
[0246] In some specific embodiments, the method further comprises the steps of: (c) expressing and / or assembling (progeny) phage particles in a prokaryotic cell (e.g., Escherichia coli) or in a eukaryotic cell (e.g., yeast, mammalian cell). In some specific embodiments, the method further comprises the step of: (d) harvesting (progeny) phage particles.
[0247] VII. USES OF THE PHAGE DISPLAY LIBRARY OF THE INVENTION AND SCREENING / IDENTIFICATION / SELECTION METHODS
[0248] Any polypeptide library / phage display library of the present invention can be used to screen for cyclic peptides having binding specificity to a specific / selected target molecule. The random cyclic peptides / fusion polypeptides in the cyclic peptide library of the present invention can be expressed and displayed using a suitable expression / display system, such as a cell-free display system (e.g., ribosome display system), a phage display system, a prokaryotic cell-based display system (e.g., bacterial display system), or a eukaryotic cell-based display system (e.g., yeast display system or mammalian cell display system). Preferably, a phage display system, such as the phage display system of the present invention.
[0249] Phage display is a technique for displaying variant polypeptides as fusion proteins with coat proteins on the surface of phages (e.g., filamentous phage particles), see Phage Display of Peptides and Proteins, edited by B.K. Kay, J. Winter, J. McCafferty 1996, Academic Press. There are usually a large number of diverse variant polypeptides contained in a large number of phages for high-throughput screening simultaneously. The term "coat protein" refers to a protein that is at least partially present on the surface of phage particles. The coat protein can be a major coat protein or can be a minor coat protein.
[0250] For recombinant display on the surface of phage, the coding sequence of the polypeptide to be displayed needs to be introduced into a phage vector, preferably into the coding region of the coat protein of the phage vector. A phage vector refers to a phage in double-stranded replicative form that contains a heterologous gene within its vector genome and is capable of replication. The phage vector has at least a portion of the phage genome and an origin of replication, thereby allowing phage replication and the formation of new phage particles. The phage is preferably a filamentous phage, such as M13 phage or its derivatives, lambda-like phages such as but not limited to phi80, phage 21, 82, 424, 432, lambda.imm343, lambda.imm21, lambda.EMBL or lamdab.gt, or all of their derivatives, genetically engineered derivatives and hybrids. In some preferred embodiments, the phage vector contains a tag coding sequence such that the introduced exogenous target polypeptide / protein is displayed on the phage surface after fusion with the tag fragment. In some more specific embodiments, the tag is a Flag tag, a His tag or a Flag-His tag. In some embodiments, the phage vector further contains other functional sequences known in the art, for example, a sequence encoding a selection marker.
[0251] In some preferred embodiments, the polypeptide library is expressed and displayed on phage particles (phage display).
[0252] Phage display is the use of phages (e.g., phage f1, fd and M13) for protein display. In this display system, the fusion polypeptide containing the cyclic peptide of the present invention is usually recombinantly linked / covalently conjugated to a phage coat protein (e.g., gene III protein, gene VIII protein or major coat protein), or recombinantly inserted into the phage coat protein (i.e., further forms a fusion protein with the phage coat protein).
[0253] To screen the polypeptide library of the present invention to isolate cyclic peptides / fusion polypeptides capable of binding to a target molecule, the polypeptide library can be contacted with the target molecule under suitable conditions allowing binding to the target molecule.
[0254] If desired, the phage particles or host cells that bind to the target molecule can be subsequently isolated, for example, by using a solid support to which the target molecule is immobilized. The solid support can be a plate, an immunotube or magnetic beads. It is also possible to subsequently isolate or detect the phage particles or host cells that bind to the target molecule by attaching a detectable moiety to the target molecule.
[0255] The screening of the polypeptides from the polypeptide library described herein can be carried out by any suitable method. For example, the binding activity can be evaluated by standard immunoassays and / or affinity chromatography. For example, BIACORE can be used TMThe instrument analyzes the ability of a candidate polypeptide to bind to a target molecule in vitro, and the BIACORE TM The instrument measures the binding rate of a polypeptide to a specific target molecule based on surface plasmon resonance method.
[0256] Embodiments
[0257] The present invention may exemplarily include the following embodiments:
[0258] 1. A fusion polypeptide comprising the following structure of formula (I) from the N-terminus to the C-terminus:
[0259] R-(L)-V-(T) (I)
[0260] Wherein,
[0261] R is a cyclic peptide, preferably a cyclic peptide cyclized via an intramolecular disulfide bond formed between any two cysteines within the fragment, more preferably the two cysteines forming the disulfide bond are separated by at least two amino acid residues, and most preferably the two cysteines forming the disulfide bond are separated by at least four amino acid residues;
[0262] L is an optional linker;
[0263] V is a single-domain antibody (VHH domain);
[0264] T is an optional C-terminal tag sequence.
[0265] 2. The fusion polypeptide according to embodiment 1, wherein the R fragment is any one of the following (a) and (b):
[0266] (a) (i) contains 8-19 amino acid residues; and (ii) the first amino acid residue at the N-terminus and the first amino acid residue at the C-terminus are cysteines, and a disulfide bond (i.e., an intramolecular disulfide bond) is formed between the two cysteines;
[0267] (b) (i) contains 9-17 amino acid residues; and (ii) a disulfide bond (i.e., an intramolecular disulfide bond) is formed between any two cysteines, wherein the two cysteines forming the disulfide bond are located at any position from the 1st to the 14th position at the N-terminus and any position from the 1st to the 14th position at the C-terminus respectively, and are separated by at least two to at most fifteen amino acid residues, preferably the two cysteines forming the disulfide bond are located at any position from the 1st to the 12th position at the N-terminus and any position from the 1st to the 12th position at the C-terminus respectively, and are separated by at least four to at most fifteen amino acid residues.
[0268] 3. The fusion polypeptide according to embodiment 1 or 2, wherein the R fragment has the structure of any one of the following (a) and (b):
[0269] (a) CysXn Cys, where Cys = cysteine forming a disulfide bond; X = any random amino acid; n = any natural number between 6 and 17;
[0270] (b)X n1 CysX n2 CysX n3 , where Cys = cysteine forming a disulfide bond; X = any random amino acid; n1 is any integer from 0 to 11, n2 is any integer from 4 to 15, n3 is any integer from 0 to 11, and there is: the sum of n1, n2, and n3 is any integer between 7 and 15.
[0271] 4. The fusion polypeptide according to embodiment 3, wherein the R fragment has the structure described in (b), and wherein n1 = 1, 2, 3, or 4, n2 is any integer from 4 to 9, n3 = 1, 2, or 3, and there is: the sum of n1, n2, and n3 is any integer between 7 and 15.
[0272] 5. The fusion polypeptide according to any one of embodiments 1 - 4, wherein the R fragment has at least 80% sequence identity with the human antibody CDR3 domain or the single - domain antibody CDR3 domain, preferably at least 85%, at least 88%, at least 90%, at least 93%, at least 96%, at least 99%, or 100% sequence identity.
[0273] 6. The fusion polypeptide according to any one of embodiments 1 - 5, wherein the V fragment is a VHH that specifically binds to human serum albumin (HSA), preferably a human or humanized VHH.
[0274] 7. The fusion polypeptide according to embodiment 6, wherein the V fragment comprises CDR1 - 3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NO: 9 - 21.
[0275] 8. The fusion polypeptide according to embodiment 6 or 7, wherein the V fragment comprises CDR1 - 3 having sequences as shown in SEQ ID NO: 6, 7, and 8 respectively.
[0276] 9. The fusion polypeptide according to any one of embodiments 1 - 8, wherein the V fragment comprises the amino acid sequence shown in any one of SEQ ID NO: 9 - 21, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NO: 9 - 21, or an amino acid sequence having one or more (preferably 1 - 10, more preferably 1 - 5) amino acid additions, deletions, and / or substitutions compared to any one of SEQ ID NO: 9 - 21. For example, the V fragment consists of the amino acid sequence shown in SEQ ID NO: 14.
[0277] 10. The fusion polypeptide according to any one of embodiments 1-9, which comprises linker L, and the L fragment has an amino acid sequence as described in any of the following:
[0278] (i) (GGGGS) n , where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4;
[0279] (ii) EPKSSDKTHTCPPCP;
[0280] (iii) (GGGGG) n , where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4;
[0281] (iv) A(EAAAP) n A, where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4.
[0282] 11. The fusion polypeptide according to any one of embodiments 1-10, wherein: the L fragment has the amino acid sequence of (GGGGS) n , where n = 3 or 4, and / or the V fragment has the amino acid sequence as described in SEQ ID NO:14.
[0283] 12. The fusion polypeptide according to any one of embodiments 1-9, wherein the L fragment is absent.
[0284] 13. The fusion polypeptide according to any one of embodiments 1-12, wherein the T fragment is a Flag tag, a His tag or a Flag-His tag.
[0285] 14. The fusion polypeptide according to embodiment 13, wherein the T fragment has the amino acid sequence as described in SEQ ID NO:27.
[0286] 15. The fusion polypeptide according to any one of embodiments 1-12, wherein the T fragment is absent.
[0287] 16. A polynucleotide encoding the fusion polypeptide according to any one of embodiments 1-15.
[0288] 17. A polypeptide library, wherein each polypeptide member comprises the following structure of formula (I) from the N-terminus to the C-terminus: R-(L)-V-(T) (I)
[0289] wherein,
[0290] R is a cyclic peptide, preferably a cyclic peptide cyclized via an intramolecular disulfide bond formed between any two cysteines inside it, more preferably the two cysteines forming the disulfide bond are separated by at least four amino acid residues;
[0291] L is an optional linker;
[0292] V is a single-domain antibody (VHH domain);
[0293] T is an optional C-terminal tag sequence,
[0294] wherein each polypeptide member has a different amino acid sequence of the R fragment.
[0295] 18. The polypeptide library according to embodiment 17, wherein each polypeptide member has the same amino acid sequence of the L fragment, the same amino acid sequence of the V fragment, and the same amino acid sequence of the T fragment.
[0296] 19. The polypeptide library according to embodiment 17 or 18, wherein the R fragment is as described in any one of (a) and (b):
[0297] (a) (i) contains 8-19 amino acid residues; and (ii) the first amino acid residue at the N-terminus and the first amino acid residue at the C-terminus are cysteines, and a disulfide bond is formed between the two cysteines (i.e., an intramolecular disulfide bond);
[0298] (b) (i) contains 9-17 amino acid residues; and (ii) a disulfide bond is formed between any two cysteines (i.e., an intramolecular disulfide bond), wherein the two cysteines forming the disulfide bond are located at any position from the 1st to the 14th position at the N-terminus and any position from the 1st to the 14th position at the C-terminus respectively, and there are at least two and at most fifteen amino acid residues between them, preferably the two cysteines forming the disulfide bond are located at any position from the 1st to the 12th position at the N-terminus and any position from the 1st to the 12th position at the C-terminus respectively, and there are at least four and at most fifteen amino acid residues between them.
[0299] 20. The polypeptide library according to any one of embodiments 17-19, wherein the R fragment has the structure as described in any one of (a) and (b) below:
[0300] (a) CysX n Cys, where Cys = cysteine forming the disulfide bond; X = any random amino acid; n = any natural number between 6 and 17;
[0301] (b) X n1 CysX n2 CysX n3 , where Cys = cysteine forming the disulfide bond; X = any random amino acid; n1 is any integer from 0 to 11, n2 is any integer from 4 to 15, n3 is any integer from 0 to 11, and there is: the sum of n1, n2, and n3 is any integer between 7 and 15.
[0302] 21. The polypeptide library as described in embodiment 20, wherein the R fragment has the structure described in (b), and wherein n1 = 1, 2, 3 or 4, n2 is any integer from 4 to 9, n3 = 1, 2 or 3, and there is: the sum of n1, n2, and n3 is any integer between 7 and 15.
[0303] 22. The polypeptide library as described in any one of embodiments 17-21, wherein the R fragment has at least 80% sequence identity with the human antibody CDR3 domain or the single-domain antibody CDR3 domain, preferably at least 85%, at least 88%, at least 90%, at least 93%, at least 96%, at least 99% or 100% sequence identity.
[0304] 23. The polypeptide library as described in any one of embodiments 17-22, wherein the V fragment is a VHH that specifically binds to human serum albumin (HSA), preferably a human or humanized VHH.
[0305] 24. The polypeptide library as described in embodiments 17-23, wherein the V fragment comprises CDR1-3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NOs: 9-21.
[0306] 25. The polypeptide library as described in embodiment 23 or 24, wherein the V fragment comprises CDR1-3 of the sequences shown in SEQ ID NOs: 6, 7 and 8 respectively.
[0307] 26. The polypeptide library as described in embodiment 24 or 25, wherein the V fragment comprises the amino acid sequence shown in any one of SEQ ID NOs: 9-21, or an amino acid sequence having at least 80%, 85%, 90%, 95% or 99% identity with any one of SEQ ID NOs: 9-21, or an amino acid sequence having one or more (preferably 1-10, more preferably 1-5) amino acid additions, deletions and / or substitutions compared to any one of SEQ ID NOs: 9-21. For example, the V fragment consists of the amino acid sequence shown in SEQ ID NO: 14.
[0308] 27. The polypeptide library as described in any one of embodiments 17-26, wherein the L fragment has the amino acid sequence described in any of the following:
[0309] (i) (GGGGS) n , where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4;
[0310] (ii) EPKSSDKTHTCPPCP;
[0311] (iii) (GGGGG) n, where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4;
[0312] (iv) A(EAAAP) n A, where n = 1, 2, 3, 4, 5 or 6, preferably n = 3 or 4.
[0313] 28. The polypeptide library according to any one of embodiments 17 - 27, wherein: The L fragment has the amino acid sequence of (GGGGS) n where n = 3 or 4, and / or the V fragment has the amino acid sequence as set forth in SEQ ID NO:14.
[0314] 29. The polypeptide library according to any one of embodiments 17 - 26, wherein the L fragment is absent.
[0315] 30. The polypeptide library according to any one of embodiments 17 - 29, wherein the T fragment is a Flag tag, a His tag or a Flag - His tag.
[0316] 31. The polypeptide library according to embodiment 30, wherein the T fragment has the amino acid sequence as set forth in SEQ ID NO:27.
[0317] 32. The polypeptide library according to any one of embodiments 17 - 29, wherein the T fragment is absent.
[0318] 33. A polynucleotide encoding any polypeptide member of the polypeptide library described in any one of embodiments 17 - 32.
[0319] 34. A phage display library, wherein each phage particle independently contains a polypeptide having a three - dimensional structure, wherein the polypeptide is any polypeptide member of the polypeptide library described in any one of embodiments 17 - 32, and the phage display library contains different amino acid sequences of the R fragment.
[0320] 35. The phage display library according to embodiment 34, wherein each phage particle contains a polynucleotide encoding the polypeptide having a three - dimensional structure thereof.
[0321] 36. The phage display library according to embodiment 34 or 35, which contains at least 1×10 6 unique cyclic peptides (i.e., R fragments), preferably at least 1×10 7 species, at least 1×10 8 species, at least 1×10 9 species, at least 1×10 10 species, at least 1×10 11 species, at least 1×10 12 species.
[0322] 37. A method for constructing a phage display library for presenting cyclic peptides, comprising the following steps:
[0323] (a) Obtain the polynucleotide as described in Embodiment 33;
[0324] (b) Introduce the nucleic acid fragment in (a) into the phage genome.
[0325] 38. The method as described in Embodiment 37, wherein step (a) specifically comprises:
[0326] (a1) Acquisition of cyclic peptide coding fragment: Synthesize an artificial trinucleotide polynucleotide (Trimer polynucleotide) library as a template, and obtain a nucleic acid sequence fragment encoding a cyclic peptide fragment by PCR amplification. Subsequently, recover the above product fragment as a cyclic peptide coding fragment, for example, by agarose gel electrophoresis;
[0327] (a2) Acquisition of single-domain antibody coding fragment: Synthesize the polynucleotide fragment encoding a single-domain antibody by gene synthesis as a single-domain antibody coding fragment, or use it as a template to obtain more identical nucleic acid sequence fragments by PCR amplification, and recover and purify them as single-domain antibody coding fragments, for example, by agarose gel electrophoresis;
[0328] (a3) Link the two coding fragments obtained in (a1) and (a2) into a full-length single polynucleotide, for example, by a ligation reaction or a fusion PCR reaction.
[0329] 39. The method as described in Embodiment 38, wherein a part of the coding sequence of the linker is respectively included at the 3' end of the cyclic peptide coding fragment in (a1) and at the 5' end of the single-domain antibody coding fragment in (a2), and optionally, there is an overlap between the two parts of the linker coding sequences, so that in the connected full-length single polynucleotide, the cyclic peptide coding sequence and the single-domain antibody coding sequence are connected by the linker coding sequence.
[0330] 40. The method as described in Embodiment 39, wherein the 3' end of the cyclic peptide coding fragment in step (a1) includes the coding sequence of the linker, so that in the connected full-length single polynucleotide, the cyclic peptide coding sequence and the single-domain antibody coding sequence are connected by the linker coding sequence.
[0331] 41. The method as described in Embodiment 39, wherein the 5' end of the single-domain antibody coding fragment in step (a2) includes the coding sequence of the linker, so that in the connected full-length single polynucleotide, the cyclic peptide coding sequence and the single-domain antibody coding sequence are connected by the linker coding sequence.
[0332] 42. The method as described in any one of Embodiments 38 - 41, wherein in step (a2), the single-domain antibody is a VHH that specifically binds to HSA and is as described in any one of the following (i) - (v):
[0333] (i) CDR1-3 of a VHH domain comprising an amino acid sequence as shown in any one of SEQ ID NOs: 9-21;
[0334] (ii) CDR1-3 comprising sequences as shown in SEQ ID NOs: 6, 7, and 8, respectively;
[0335] (iii) comprising or consisting of an amino acid sequence as shown in any one of SEQ ID NOs: 9-21;
[0336] (iv) comprising or consisting of an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NOs: 9-21;
[0337] (v) comprising or consisting of an amino acid sequence having one or more (preferably 1-10, more preferably 1-5) amino acid additions, deletions, and / or substitutions compared to any one of SEQ ID NOs: 9-21.
[0338] 43. The method according to any one of embodiments 38-42, wherein a sequence fragment encoding a C-terminal tag is optionally included in the phage genome in step (b) or at the 3' end of the single-domain antibody-encoding fragment in step (a2).
[0339] 44. The method according to embodiment 43, wherein the C-terminal tag is a Flag tag, a His tag, a Flag-His tag, or absent.
[0340] 45. The method according to any one of embodiments 38-44, wherein the synthetic trinucleotide polynucleotide (Trimer polynucleotide) library in step (a1) comprises a 5' primer-binding region of a fixed sequence, a trinucleotide (Trimer) cyclic peptide library-encoding region encoding 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive random amino acid residues, and an optional partial linker-encoding region or linker-encoding region of a fixed sequence.
[0341] 46. The method according to embodiment 45, wherein the 5' primer-binding region and / or the 5' primer of the synthetic trinucleotide polynucleotide in step (a1) comprise a first restriction enzyme site and an optional prokaryotic cell signal peptide-encoding sequence.
[0342] 47. The method according to any one of embodiments 38-46, wherein the single-domain antibody-encoding fragment in step (a2) comprises a second restriction enzyme site sequence.
[0343] 48. The method according to any one of embodiments 37-47, optionally further comprising the step of:
[0344] (c) expressing and / or assembling phage particles in a prokaryotic cell (such as, Escherichia coli); and optionally
[0345] (d) harvesting the phage particles.
[0346] 49. A method for selecting a cyclic peptide that binds to a desired target, the method comprising the steps of:
[0347] (a) contacting the phage display library of any one of embodiments 34-36 with a specific target molecule,
[0348] (b) screening the phage particles for the desired target, wherein the result of the screening is the selection of phage particles having a cyclic peptide that binds to the desired target; and
[0349] (c) identifying the amino acid sequence of the cyclic peptide of the selected phage particles.
[0350] 50. An immunoglobulin heavy chain variable domain single domain (VHH) or an antigen-binding fragment thereof that specifically binds to human serum albumin (HSA), comprising CDR1-3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NOs: 9-21.
[0351] 51. A VHH or an antigen-binding fragment thereof that specifically binds to human serum albumin (HSA), comprising CDR1-3 of the sequences shown in SEQ ID NOs: 6, 7, and 8, respectively.
[0352] 52. The VHH or an antigen-binding fragment thereof according to embodiment 50 or 51, comprising the amino acid sequence shown in any one of SEQ ID NOs: 9-21, or an amino acid sequence having at least 80%, 85%, 90%, 95%, or 99% identity with any one of SEQ ID NOs: 9-21, or an amino acid sequence having one or more (preferably 1-10, more preferably 1-5) amino acid additions, deletions, and / or substitutions compared to any one of SEQ ID NOs: 9-21. For example, the VHH domain consists of the amino acid sequence shown in SEQ ID NO: 14.
[0353] 53. A fusion protein comprising the VHH or an antigen-binding fragment thereof according to any one of embodiments 50-52, for example, a fusion protein with an antibody Fc region.
[0354] 54. An isolated polynucleotide encoding the VHH or an antigen-binding fragment thereof according to any one of embodiments 50-52 or the fusion protein of embodiment 37.
[0355] 55. A vector, which comprises the polynucleotide of embodiment 54, preferably, the vector is an expression vector.
[0356] 56. A host cell, which comprises the polynucleotide of embodiment 54 or the vector of embodiment 55, preferably, the host cell is prokaryotic or eukaryotic, more preferably selected from yeast cells, mammalian cells (for example, the host cell is a CHO cell, such as CHO-K1 cell or expiCHO cell, or the host cell is a 293 cell, such as HEK293 cell) or other cells suitable for preparing antibodies or their antigen-binding fragments.
[0357] 57. A method for preparing a VHH that binds to HSA or its antigen-binding fragment or a fusion protein comprising a VHH that binds to HSA or its antigen-binding fragment, the method comprising culturing, under conditions suitable for antibody expression, a host cell comprising a nucleic acid encoding a VHH or its antigen-binding fragment of any one of embodiments 50-52 or a fusion protein of embodiment 53, optionally, the method further comprises recovering the antibody or its antigen-binding fragment or fusion protein from the host cell. Examples
[0358] The following examples are described to assist in understanding the present invention. It is not intended and should not in any way be construed as limiting the scope of protection of the present invention.
[0359] Example 1. Screening of HSA single-domain antibodies
[0360] 1.1 Preparation of raw materials
[0361] 1.1.1 Preparation of antigen proteins and control antibodies
[0362] By genetic manipulation at the coding gene level, His or human IgG1 Fc (SEQ ID NO: 4) tags were added to the C-terminus of the sequences of human serum albumin (HSA, Uniprot: P02768, AA25-609, SEQ ID NO: 1), cynomolgus monkey albumin (Uniprot: A2V9Z4, AA19-608, SEQ ID NO: 2), and mouse serum albumin (MSA, Uniprot: P07724, AA25-608, SEQ ID NO: 3), respectively. The obtained nucleic acid sequences were respectively constructed into the pcDNA3.3-TOPO (Invitrogen) vector, and then transformed into Escherichia coli SS320, cultured overnight at 37 °C, and then the plasmid was extracted using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01).
[0363] The positive control antibody is as follows: The nanobody Alb23 (SEQ ID NO: 5) whose sequence is obtained from WO2004041865. After converting the above sequence into a gene sequence, General Biosciences Co., Ltd. was used for gene synthesis of the target fragment. Each target fragment was amplified by PCR, and then constructed into the eukaryotic expression vector pcDNA3.3-TOPO (Invitrogen) by homologous recombination. Each constructed recombinant protein expression vector was transformed into Escherichia coli SS320 respectively, cultured overnight at 37 °C, and then plasmid extraction was carried out using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01) to obtain endotoxin-free plasmids for eukaryotic expression use.
[0364] The positive control antibody was expressed through the ExpiCHO transient expression system (Thermo Fisher, A29133). The specific method is as follows: On the day of transfection, confirm that the cell density is 7×10 6 -1×10 7 viable cells / mL and the cell viability > 98%. At this time, adjust the cells to a cell density of 6×10 6 cells / mL with fresh ExpiCHO expression medium pre-warmed at 37 °C. Dilute the target plasmid with OptiPRO TM SFM (ThermoFisher) (add 1 μg of plasmid to 1 mL of OptiPRO TM SFM), meanwhile, dilute ExpiFectamine TM CHO with OptiPRO TM SFM, then mix the two in equal volumes and gently pipette to mix evenly to prepare the ExpiFectamine TM CHO / plasmid DNA mixture, incubate at room temperature for 1 - 5 min, slowly add it to the prepared cell suspension, and gently shake at the same time. Finally, place it in a cell culture shaker and culture at 37 °C and 8% CO2 conditions.
[0365] At 18 - 22 h after transfection, add ExpiCHO TM Enhancer and ExpiCHO TM Feed to the culture medium, and place the shake flask on a shaker at 32 °C and 5% CO2 conditions for continued culture. On the 5th day after transfection, add the same volume of ExpiCHO TMFeed while gently mixing the cell suspension slowly. 7 - 15 days after transfection, centrifuge the cell culture supernatant expressing the target protein at 15,000 g for 10 min. Purify the obtained supernatant by affinity chromatography using MabSelect SuRe LX (GE, 17547403). Then elute the target protein with 100 mM sodium acetate (pH 3.0), neutralize it with 1 M Tris - HCl, and finally replace the obtained protein into PBS buffer through an ultrafiltration concentrator tube (Millipore, UFC901096) to obtain the control antibody Alb23.
[0366] The related antigen in this example was expressed through the Expi293 transient expression system (ThermoFisher, A14635). The specific method is as follows:
[0367] On the day of transfection, confirm that the cell density is about 4.5×10 6 to 5.5×10 6 viable cells per milliliter, and the cell viability > 95%. At this time, adjust the cells to a final concentration of 3×10 6 cells per milliliter with fresh Expi293 expression medium pre - warmed at 37°C. Dilute the target plasmid with Opti - MEM TM pre - cooled at 4°C (add 1 μg plasmid to 1 mL Opti - MEM TM ), and at the same time dilute ExpiFectamine TM 293 reagent with Opti - MEM TM . Then mix the two in equal volumes and gently pipette to prepare an ExpiFectamine TM 293 reagent / plasmid DNA mixture. Incubate at room temperature for 10 - 20 min, slowly add it to the prepared cell suspension, and gently shake at the same time. Finally, place it in a cell culture shaker and culture at 37°C and 8% CO2.
[0368] Add ExpiFectamine TM 293 Transfection Enhancer 1 and ExpiFectamine TM293 Transfection Enhancer 2. The shake flasks were placed on a shaker at 32 °C and cultured continuously under 5% CO2. 5 - 7 days after transfection, the cell culture supernatant was centrifuged at 15,000 g for 10 min at high speed. The obtained supernatant of Fc-tagged protein was affinity purified using MabSelect SuRe LX (GE, 17547403), and then the target protein was eluted with 100 mM sodium acetate (pH 3.0), followed by neutralization with 1 M Tris-HCl; the obtained supernatant of His-tagged protein was affinity purified using Ni Smart Beads 6FF (Changzhou Tiandi Renhe Biotechnology Co., Ltd., SA036050), and then the target protein was eluted with gradient concentrations of imidazole. Each eluted protein was replaced into PBS buffer using an ultrafiltration concentrator tube (Millipore, UFC901096). After being qualified by SDS-PAGE identification and activity identification, it was stored at -80 °C for later use.
[0369] 1.2 Detection of Physicochemical Properties and Activity of Antigen Protein
[0370] In this example, SDS-PAGE was used to detect the purity of the antigen protein and ELISA was used to detect the activity of the antigen protein.
[0371] 1.2.1 SDS-PAGE Detection
[0372] Preparation of non-reducing solution: 1 μg of antigen protein and the quality control product IPI (IPI is the abbreviation of Ipilimumab, self-produced by Sanyou, used as the quality control product for physicochemical properties such as each SDS-PAGE and SEC-HPLC) were added to 5×SDS loading buffer and 40 mM iodoacetamide, heated in a dry bath at 75 °C for 10 min, cooled to room temperature, centrifuged at 12,000 rpm for 5 min, and the supernatant was taken.
[0373] Preparation of reducing solution: 2 μg of antigen protein and the quality control product IPI were added to 5×SDS loading buffer and 5 mM DTT, heated in a dry bath at 100 °C for 10 min, cooled to room temperature, centrifuged at 12,000 rpm for 5 min, and the supernatant was taken.
[0374] The obtained supernatants were respectively added to a Bis-tris 4 - 15% gradient gel (purchased from GenScript), electrophoresed at a constant voltage of 110 V. When Coomassie Brilliant Blue migrated to the bottom of the gel, the electrophoresis was stopped, the gel slice was taken out and placed in Coomassie Brilliant Blue staining solution for 1 - 2 h, the staining solution was discarded, decolorizing solution was added, and the decolorizing solution was replaced 2 - 3 times as needed. After decolorization until the gel background was transparent, it was stored in deionized water. The results are shown in Table 1. The SDS-PAGE purity of the prepared antigen protein was >85%, and the quality inspection was qualified.
[0375] Table 1 Physicochemical properties of antigen proteins
[0376] Protein name Mw(kDa) Purity(%) huHSA-hFc 185.1 91.7 huHSA-His 67.97 96.9 CynoHSA-His 66 >85 MSA-His 70 97.5
[0377] 1.2.2 Detection of antigen activity based on ELISA
[0378] On a 96-well ELISA plate, each antigen protein was coated separately (2 μg / mL, 30 μL / well) and incubated overnight at 4°C. The next day, the wells were washed 3 times with PBST and then blocked with 5% skim milk for 2 h. After washing the plate 3 times with PBST, serially diluted Alb23 prepared in Example 1 was added and incubated for 1 h. After that, it was washed 3 times with PBST, and then a secondary antibody (Anti-human-Fc-HRP) (abcam: ab97225) was added and incubated for 1 h. After incubation, the plate was washed 6 times with PBST, and TMB (SurModics, TMBS-1000-01) was added for color development. According to the color development result, 2 M HCl was added to terminate the reaction, and the absorbance was read at OD450 using an enzyme-linked immunosorbent assay (ELISA) reader (Molecular Devices, SpecterMax 190).
[0379] The results are as Figure 1 shown in A-1B, and the prepared antigen proteins and the positive antibody both have good binding activity.
[0380] 1.3 Alpaca immunization and immune library construction
[0381] In this example, the HSA antigen protein immunization method was used for immunization, and the antibody genes in alpaca peripheral blood were extracted to construct an alpaca VHH antibody gene phage display library.
[0382] 1.3.1 Immunization protocol
[0383] In this example, a total of 1 alpaca (Nanchang Dajia Technology Co., Ltd.) was immunized by subcutaneous injection. The immunizing antigen used was the human HSA recombinant protein prepared and qualified in the previous example. The single immunization dose was 500 μg, supplemented with CFA / IFA (Freund's complete adjuvant and Freund's incomplete adjuvant). Immunization was carried out once every 2 weeks for a total of 5 times. After the second, third, fourth immunizations and the boost immunization, blood was collected respectively to detect the titer of antibodies against the HSA recombinant protein in the serum.
[0384] 1.3.2 Construction of a gene library of camel-derived single-domain antibodies
[0385] Slowly add 15 mL of Ficoll-Paque density gradient separation solution (purchased from GE Healthcare, catalog number: 17144003S) into a 50 mL centrifuge tube. Tilt the centrifuge tube and slowly add 15 mL of the collected non-immunized alpaca blood in batches along the tube wall, so that a clear separation interface is maintained between the Ficoll-Paque density gradient separation solution and the alpaca blood. Centrifuge the 50 mL centrifuge tube containing the blood and separation solution at about 15 °C for 20 min, with the centrifuge set to 400 g, acceleration of 3, and deceleration of 0. After centrifugation, the entire liquid surface is divided into four layers. The upper layer is the plasma mixture, the lower layer is red blood cells and granulocytes, the middle layer is the Ficoll-Paque liquid, and there is a narrow white cloudy band mainly composed of PBMCs at the junction of the upper and middle layers, that is, the PBMC cell layer. Carefully aspirate the plasma mixture in the upper layer with a sterile Pasteur pipette, and then use a new sterile Pasteur pipette to aspirate the PBMCs to obtain the separated PBMCs. Wash the separated PBMCs twice with PBS, then centrifuge at 1500 rpm for 10 min at 4 °C, and finally resuspend with 1.5 mL of PBS and count using a cell counter (CountStar, CountStar Altair).
[0386] Extract total RNA from the separated PBMC cells by conventional methods. Use a reverse transcription kit (purchased from TaKaRa, catalog number: 6210A) to reverse transcribe the extracted total RNA into cDNA. Based on the germline situation of the VHH antibody, degenerate primers are designed between the front end of the V region of the VHH antibody and the second constant region (CH2). After PCR amplification, the VHH-CH2 fragment and the VH-CH1-CH2 fragment of the antibody are obtained. Through the length difference between the two fragments, the PCR products are identified by agarose gel electrophoresis, and the VHH-CH2 fragment is recovered. The recovered VHH-CH2 fragment is amplified by secondary PCR using the forward and reverse primers for VHH amplification and VHH-CH2 as the template to amplify the VHH antibody fragment (Sabir JS, El-Domyati FM, et al. Construction of Camelids VHH repertoire in phage display-based library. C R Biol. Mar 20, 2014; 337(4):244-249. doi:10.1016 / j.crvi.2014.02.004). Subsequently, the PCR product and the vector for phage display were digested, recovered, and ligated. The ligation product was recovered using a recovery kit (Omega, catalog number: D6492-02). For specific materials and methods, refer to the paper by Li Xiaolin (Li Xiaolin, Construction and preliminary screening of a large-capacity non-immunized human Fab phage antibody library, Master's thesis of Peking Union Medical College, June 2007). Finally, it was transformed into competent Escherichia coli SS320 (Lucigen, MC1061 F) using an electroporator (Bio-Rad, MicroPulser), and the transformed Escherichia coli SS320 bacterial solution was spread on a 2-YT solid plate with ampicillin resistance (the solid plate was prepared from 1.5% tryptone, 1% yeast extract, 0.5% NaCl, and 1.5% agar, prepared according to mass / volume g / mL).
[0387] 1.3.3 Calculation of antibody gene library capacity
[0388] Take the transformed Escherichia coli SS320 bacterial solution and inoculate it with antibiotic-free 2YT culture medium at a volume ratio of 1:50. Incubate at 37°C and 220 rpm for 1.5 - 2 h until the OD600 reaches 0.5 - 0.6, then take it out to room temperature. Add the bacterial solution to a 96-well round-bottom dilution plate at 90 μL / well. Each bacterial solution sample is diluted in a 10-fold gradient, with a total of 12 dilution gradients. Use an 8-channel 10 μL pipette to aspirate 2 μL of the liquid and add it to a 2YT (hereinafter also abbreviated as C+ / T+ 2YT) plate with carbenicillin and tetracycline concentrations of 50 μg / mL and 50 μg / mL respectively in ascending order of the dilution gradient. After placing it upright for 5 min, invert it and incubate overnight at 37°C. Observe the growth of clones the next day and calculate the library capacity. The calculation method of the library capacity is as follows. Starting from row A, label them as 1, 2, 3, 4, 5, 6, 7, 8 to row X. First, select the counting wells. First, select the counting wells with 3 - 20 clones, obtain the row number X, and count the number of clones n in the corresponding wells. The calculation formula is 5×100×10X×n. After calculation, the library capacity per milliliter of the bacterial solution was obtained as 7×10 8 cfu, that is, 7×10 8 antibody gene library of antibody genes.
[0389] 1.3.4 Preparation of antibody gene phage display library
[0390] Based on the antibody gene library capacity, 50 OD (1 OD is 5×10 8 cfu) of the single-domain antibody gene library bacterial solution was added to fresh 2-YT liquid medium to make the initial OD value 0.1. The obtained product was placed in a shaker at 37 °C and 220 rpm and cultured until the logarithmic growth phase (OD600 ≈ 0.6), and then VSCM13 helper phage (purchased from Stratagene) was added at a quantity 50 times the number of bacteria (i.e., the multiplicity of infection (MOI) was approximately 50). After thorough mixing and standing for 30 min, it was continued to be cultured in a shaker at 220 rpm for 1 hour. Subsequently, the culture was centrifuged at 10000 rpm for 5 min, the supernatant was discarded, and the culture medium was replaced with 2-YT medium with dual resistance of 50 μg / mL carbenicillin / 40 μg / mL kanamycin (hereinafter also referred to as C+ / K+ 2-YT medium), and it was continued to be cultured overnight at 30 °C and 220 rpm. The next day, the bacterial solution was centrifuged at 13000g for 10 min. After collecting the supernatant, 20% PEG / NaCl (prepared from 20% PEG6000 by volume concentration and 2.5 M NaCl) was added to make the final concentration of PEG / NaCl 4%. After mixing and placing on ice for 1 hour, it was centrifuged at 13000g for 10 min. The precipitated phage was rinsed with PBS and stored for subsequent phage screening.
[0391] 1.3.5 Screening of the antibody gene phage display library
[0392] (1) Screening of the antibody gene phage display library by magnetic bead method
[0393] Magnetic bead method screening is based on biotin-labeling human or mouse serum albumin antigen (huHSA-His / MSA-His), and then binding it to magnetic beads conjugated with streptavidin. Through the panning process of incubating, washing, and eluting the magnetic beads bound with the antigen and the antibody gene phage display library, usually 3 rounds of panning are experienced (300 nM in the first round, 100 nM in the second round, 30 nM in the third round), whereby specific monoclonal antibodies against the antigen can be enriched in large quantities. In this example, biotin-labeled huHSA-His / MSA-His protein was used for phage display library screening, and after 3 rounds of panning, the primary screening of monoclonal antibodies against HSA protein was carried out. The specific implementation method of antibody screening is as follows:
[0394] First, incubate the biotin-labeled huHSA-His / MSA-His protein with streptavidin-conjugated magnetic beads so that the biotin-labeled protein binds to the magnetic beads. Incubate the magnetic beads with the bound protein and the constructed phage library at room temperature for 2 h. After washing 6 - 8 times with PBST to remove non-specifically adsorbed phages, add Trypsin (Gibco, 25200072), gently mix and react for 20 min to elute the specifically bound antibody-displaying phages. Subsequently, infect the logarithmic-phase SS320 bacteria (Lucigen, MC1061 F) with the eluted phages and let it stand for 30 min, then culture it at 220 rpm for 1 h, add VSCM13 helper phages and let it stand for 30 min, continue to culture at 220 rpm for 1 h, centrifuge and transfer it to C+ / K+2-YT medium. The finally obtained phages are used for the next round of panning.
[0395] (2) Screening of the antibody gene phage display library by immunotube method
[0396] The purposes of both the immunotube method and the magnetic bead method are to enrich specific antibodies against the antigen, and they are two mutually complementary and verifying experimental methods. The principle of screening by the immunotube method is to coat the HSA-His / MSA-His antigen on the surface of an immunotube with high adsorption capacity. Through the panning process of adding the phage display antibody library to the immunotube and incubating, washing, and eluting with the antigen protein adsorbed on the surface of the immunotube, after 3 rounds of panning (the first round at 100 ug / mL, the second round at 30 ug / mL, the third round at 10 ug / mL), the specific monoclonal antibodies against the antigen are finally enriched. The specific implementation method is as follows:
[0397] In the first round of screening, 1 mL of 100 μg / mL antigen was added to the immunotube and coated overnight at 4°C. The next day, the coating solution was discarded, and the tube was blocked with 5% milk in PBS for 2 h. After rinsing twice with PBS, a phage library displaying single-domain antibodies was added and incubated for 2 h. The tube was then rinsed 8 times with PBS and 2 times with PBST to remove non-specifically bound phages. Then, 0.8 mL of 0.05% EDTA trypsin digestion solution was added to the immunotube to elute phages specifically binding to the target antigen. Subsequently, the eluted phages were used to infect exponentially growing SS320 bacteria (Lucigen, 60512-1), and the mixture was incubated statically at 37°C for 30 min and then cultured at 220 rpm for 1 h. Then, VSCM13 helper phage was added, and the mixture was incubated statically for 30 min and further cultured at 220 rpm for 1 h. The culture was centrifuged and transferred to C+ / K+2-YT medium, and cultured overnight at 30°C and 220 rpm. The next day, the phages were precipitated for subsequent two rounds of screening. Generally, the antigen coating concentrations for the second and third rounds of phage screening decreased successively to 30 μg / mL and 10 μg / mL, respectively. In addition, the PBS rinsing intensity was gradually increased, and the number of PBS elution times was 12 and 16, respectively.
[0398] The enrichment effect was evaluated by ELISA detection of the phage pool eluted in each round. The results showed that significant enrichment occurred in the second and third rounds after three rounds of screening.
[0399] For the rounds with better enrichment, a large number of monoclonal clones were picked for preliminary ELISA screening. The clones obtained in the third round were selected for positive clone screening by ELISA. After sequencing analysis and ELISA binding analysis, VHH A20 was finally obtained. The variable region amino acid sequence of the obtained VHH is shown in Table 2, and the CDR sequences were determined by the AbM-defined CDR method.
[0400] Table 2 Sequence information of antibody molecule A20
[0401]
[0402] 1.4 Construction, expression and purification of anti-HSA candidate molecule antibodies
[0403] In this example, the VHH (A20) obtained by screening in Example 1.3 was fused with the Fc of human IgG1 (SEQ ID NO: 4). The C-terminus of the VHH gene sequence was ligated to the N-terminus of the human IgG1 Fc segment gene sequence to construct the expression vector pcDNA3.4-TOPO (Invitrogen) of the VHH-Fc antibody, which was expressed through the ExpiCHO transient expression system. The cell culture supernatant expressing the target protein was centrifuged at 15,000 g for 10 min at high speed. The obtained supernatant was affinity purified with MabSelect SuRe LX (GE, 17547403), and then the target protein was eluted with 100 mM sodium acetate (pH 3.0), followed by neutralization with 1 M Tris-HCl. Finally, the obtained protein was replaced into PBS buffer through an ultrafiltration concentrator tube (Millipore, UFC901096) to obtain the qualified VHH-Fc antibody (A20-Fc) for quality inspection.
[0404] 1.5 Detection of Physicochemical Properties of Anti-HSA Candidate Antibodies
[0405] 1.5.1 SDS-PAGE Detection
[0406] The detection method is referred to Example 1.2. The results showed that the purity of the prepared A20-Fc under the reducing condition of SDS-PAGE was >95%, and it passed the quality inspection.
[0407] 1.5.2 SEC-HPLC Detection
[0408] Sample preparation: The mobile phase was 150 mmol / L phosphate buffer, pH 7.4. The candidate antibody, control antibody, and the quality control product IPI were all diluted to 0.5 mg / mL with the mobile phase solution.
[0409] Experimental procedure: The flow rate of the Agilent HPLC 1100 chromatographic column (XBridge BEH SEC 3.5 μm, 7.8 mm I.D.×30 cm, Waters) was set to 0.8 mL / min, the injection volume was 20 μL, and the wavelengths of the VWD detector were 280 nm and 214 nm. The blank solution, Herceptin quality control product solution, and sample solution were injected successively.
[0410] Experimental results: The percentages of high molecular polymers, antibody monomers, and low molecular substances in the sample were calculated by the area normalization method. The results showed that the monomer purity of the candidate antibody A20 in the IgG1 configuration was greater than 95%.
[0411] 1.6 Detection of Affinity Activity of Candidate Antibodies
[0412] In this example, the affinity effect of the candidate antibody on the huHSA-His antigen protein was verified based on the ELISA method.
[0413] On a 96-well ELISA plate, coat the antigen protein huHSA-His (2 μg / mL, 30 μL / well) and incubate overnight at 4°C. The next day, wash the wells 3 times with PBST and then block with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add serially diluted candidate antibodies and incubate for 1 h. Then, after washing 3 times with PBST, add the secondary antibody Anti-human Fc-HRP (abcam; ab97225) and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development result, add 2 M HCl to terminate the reaction and read the absorbance at OD450 using an ELISA reader (Molecular Devices, SpecterMax190).
[0414] The results are as Figure 2 shown. The candidate antibody A20-Fc (EC 50 = 0.00575 μg / mL) has better affinity activity than the positive control antibody Alb23 (EC 50 = 0.01 μg / mL) at the ELISA level.
[0415] 1.7 Detection of the cross-species activity of the candidate antibody
[0416] In this example, an ELISA-based method was used to verify the affinity of the candidate antibody for the antigen proteins CynoHSA-His and MSA-His.
[0417] On a 96-well ELISA plate, coat the antigen protein CynoHSA-His or MSA-His (2 μg / mL, 30 μL / well) and incubate overnight at 4°C. The next day, wash the wells 3 times with PBST and then block with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add serially diluted candidate antibodies and incubate for 1 h. Then, after washing 3 times with PBST, add the secondary antibody Anti-human Fc-HRP (abcam; ab97225) and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development result, add 2 M HCl to terminate the reaction and read the absorbance at OD450 using an ELISA reader (Molecular Devices, SpecterMax 190).
[0418] The results are as Figure 3 shown in A-3B. The antibody A20-Fc binds to CynoHSA-His( Figure 3 A, EC 50 = 0.00462 μg / mL) and MAS-His(Figure 3 B, EC 50 = 0.00578 μg / mL) had better binding activity than the positive control antibody Alb23 (EC 50 were 0.00718 μg / mL and 0.00983 μg / mL, respectively).
[0419] 1.8 Humanization of alpaca single-domain antibody
[0420] In this example, to reduce the immunogenicity that the camelid single-domain antibody A20-Fc might cause, humanization mutations were designed for the framework region of the single-domain antibody VHH, and the humanization degree of the antibody sequence was increased through back mutations. The process of humanization of the single-domain antibody is as follows:
[0421] The sequence of A20 was compared with the human antibody germline gene database to find 1-3 germline genes germline with relatively high homology to A20. At the same time, considering the drugability of the germline gene Germline, a suitable Germline template was selected for comparison, and the non-human sites in the framework region were counted. Homology modeling was performed on the candidate molecules, and the homology modeling referred to the single-domain antibody result model in the PDB database (http: / / www.rcsb.org / ). Combining the structural model of the candidate molecule and the non-human site situation, a combined back mutation design was carried out. The back mutation design avoided introducing potential post-translational modification sites, and 12 antibody sequences with different degrees of humanization were designed for A20, as shown in Table 3 for details.
[0422] Table 3. Summary of the results of humanization of A20 single-domain antibody
[0423] Expressed protein name Number of back mutations Degree of humanization SEQ ID NO A20 12 90.5% 9 A20-VHH1 10 92.3% 10 A20-VHH2 9 93.1% 11 A20-VHH3 8 93.8% 12 A20-VHH4 7 94.6% 13 A20-VHH5 6 95.4% 14 A20-VHH6 6 95.4% 15 A20-VHH7 6 95.4% 16 A20-VHH8 5 96.2% 17 A20-VHH9 4 96.9% 18 A20-VHH10 4 96.9% 19 A20-VHH11 3 97.7% 20 A20-VHH12 1 99.2% 21
[0424] 1.9 Construction, purification and expression of humanized antibody
[0425] Refer to the method in Example 1.4 to construct the humanized VHH into a VHH-Fc antibody.
[0426] 1.10 Detection of the affinity activity of humanized antibody
[0427] In this example, the affinity effect of the humanized antibody on the huHSA-His antigen protein was verified based on the ELISA method. The experimental method is referred to Example 1.6. The results are as Figure 4 shown in A-4C. After humanization, the antibodies all had good binding activity with huHSA-His. Among them, the binding activity of A20-VHH5-Fc with huHSA-His was better than that of the parental antibody A20-Fc and the positive control antibody Alb23.
[0428] 1.11 Detection of cross-species activity of humanized antibodies
[0429] In this example, an ELISA-based method was used to verify the affinity of the humanized antibody for the CynoHSA-His antigen protein. See Example 1.7 for the experimental method. The results are as Figure 5 shown. The humanized antibodies A20-VHH1-Fc, A20-VHH3-Fc, A20-VHH5-Fc, and A20-VHH10-Fc all had good binding activity to CynoHSA-His.
[0430] 1.12 SDS-PAGE physical and chemical detection of humanized antibodies
[0431] Referring to Example 1.5, SDS-PAGE detection was performed on the humanized molecule A20-VHH5-Fc. The results showed that the SDS-PAGE purity of the prepared antibody protein was >95%, and the quality inspection was qualified.
[0432] Example 2. Phage display screening of cyclic peptide-linked fusion proteins
[0433] In this example, the effects of polypeptide-linked single-domain antibody fusion proteins and polypeptide-linked Fc fusion proteins on phage display of polypeptides were compared at the prokaryotic phage display level.
[0434] 2.1 Preparation of raw materials
[0435] Antigen preparation: Through genetic manipulation at the coding gene level, a His tag or a huFc tag was added to the C-terminus of the sequence of the human EPOR protein huEPOR ECDAA25-250 (Uniprot ID: P19235, SEQ ID NO: 22). The obtained nucleic acid sequences were respectively constructed into the pcDNA3.4 vector, then transformed into Escherichia coli DH5α, cultured overnight at 37°C, and then the plasmid was extracted using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01). The obtained plasmid was transiently transfected into HEK293 cells ([[]] TM 293 transfection kit (Gibco[[[]] TM , A14524) [[[]] CRL-1573[[[]] TM)After 7 days of expression, the cell culture supernatant was collected, and the protein containing the Fc tag was affinity purified through a Protein A / G affinity chromatography column. After purification, the target protein was eluted with 100 mM glycine salt (pH = 3.0), concentrated, buffer exchanged, and finally the antigen protein huEPOR-Fc was obtained. The protein containing the His tag was affinity purified with Ni Smart Beads 6FF (Changzhou Tiandi Renhe Biotechnology Co., Ltd., SA036050), and then the target protein was eluted with an imidazole gradient. Each eluted protein was buffer exchanged into PBS buffer through an ultrafiltration concentrator tube (Millipore, UFC901096), and finally the antigen protein huEPOR-His was obtained.
[0436] 2.2 Construction of phage display plasmid of polypeptide-linked fusion protein and preparation of phage samples
[0437] The cyclic peptide sequence EMP1 (GGTYSCHFGPLTWVCKPQGG) (SEQ ID NO: 23) that specifically binds to the human EPOR antigen reported in the literature (Small peptides as potent mimetics of the protein hormone erythropoietin. Science. 1996 Jul 26; 273(5274): 458 - 64. doi: 10.1126 / science.273.5274.458.) was respectively linked to the A20 VHH sequence obtained in Example 1 or the monomeric Fc sequence (see SEQ ID NO: 26) in the invention patent (CN109705211B) through Linker1 ((GGGGS)3) (SEQ ID NO: 24) and Linker2 (EPKSSDKTHTCPPCP) (SEQ ID NO: 25). Those linked to A20 or only linked to the Linker were further added with Flag and His tags (DYKDHDGDYKDHDIDYKDDDDKGGGGSHHHHHH) (SEQ ID NO: 27) at the C - terminus. The obtained nucleotide sequences were constructed into the pcDNA3.4 vector, then transformed into Escherichia coli SS320, cultured overnight at 37 °C, single colonies were picked, and after confirming the correct sequence by Sanger sequencing, the bacterial solution was inoculated into 2 - YT medium with carbenicillin and tetracycline resistance. After culturing at 37 °C and 220 rpm for 1.5 - 2 h until the OD600 reached 0.5 - 0.6, VSCM13 helper phage (purchased from Stratagene) (titer: 5e + 12) was added at a ratio of 1:1000, and incubated statically in a 37 °C constant temperature incubator for half an hour, then transferred to a shaker and cultured at 37 °C and 220 rpm for 1 h. After centrifugation at 5000 rpm to remove the supernatant, fresh 2 - YT medium with carbenicillin and kanamycin resistance was added, and cultured overnight at 30 °C (about 16 h); the next day, centrifuged at 12000 rpm to collect the supernatant, one - fifth volume of PEG6000 (Sigma, 81260 - 5KG) was added, incubated on ice for 2 h, then centrifuged at 12000 rpm to remove the supernatant, and the phage was resuspended with PBS.
[0438] 2.3 Detection of the binding of the polypeptide - linked fusion protein phage to the antigen protein by ELISA
[0439] Coat the antigen proteins huEPOR-His / huEPOR-Fc (2 μg / mL, 30 μL / well) on a 96-well ELISA plate and incubate overnight at 4°C. The next day, wash the wells 3 times with PBST, then block with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add the phage prepared in Example 2.2 and incubate for 1 h. Then, after washing 3 times with PBST, add the secondary antibody Anti-M13-HRP (Sinobiological, 11973-MM05T-H) and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development result, add 2 M HCl to terminate the reaction, and read the plate at OD450 using an ELISA reader (Molecular Devices, SpecterMax 190). Plot the graph after statistical analysis with EXCEL.
[0440] The results are as Figure 6 shown in Figure 6 A-6B. On huEPOR-His ( Figure 6 A) and huEPOR-hFc ( 50 B), the EC of the binding of EMP1-Linker1-A20-Flag-phage to the antigen is lower than that of EMP1-Linker1-Flag-phage and EMP1-Linker2-Fc-phage, and the upper plateau of the binding of EMP1-Linker1-A20-Flag-phage to the antigen is significantly higher than that of EMP1-Linker1-Flag-phage and EMP1-Linker2-Fc-phage, proving that the fusion of the cyclic peptide (EMP1) with the single-domain antibody has a better display efficiency on the phage, and the obtained phage has a higher binding activity to the antigen.
[0441] Example 3. Screening of the affinity of the cyclic peptide-linked fusion protein for eukaryotic proteins
[0442] In this example, the effects of the polypeptide-linked single-domain antibody fusion protein and the polypeptide-linked Fc fusion protein on the binding activity of the cyclic peptide antigen were compared at the eukaryotic protein level.
[0443] 3.1 Construction of the phage display plasmid of the polypeptide-linked fusion protein and preparation of the phage sample
[0444] The cyclic peptide sequence (EMP1) is linked to the A20 VHH sequence obtained in Example 1, the monomeric Fc sequence (SEQ NO: 26) in the invention patent (CN109705211B), and the HSA sequence AA25 - 609 (Uniprot ID:
[0445] P02768, SEQ ID NO: 1) through Linker1 ((GGGGS)3), Linker2 (EPKSSDKTHTCPPCP), and Linker3 (GGGGG) (SEQ ID NO: 28) respectively. For the one linked to A20, a Flag and His tag (DYKDHDGDYKDHDIDYKDDDDKGGGGSHHHHHH) (SEQ ID NO: 27) is further added at the C - terminus, and for the one linked to HAS, a His tag is further added at the C - terminus. The obtained nucleic acid sequences are constructed into the pcDNA3.4 vector, then transformed into Escherichia coli DH5α, cultured overnight at 37 °C, and then the plasmid is extracted using an endotoxin - free plasmid extraction kit (OMEGA, D6950 - 01). The obtained plasmid is transiently expressed using the ExpiCHO transient expression system (Thermo Fisher, A29133). After 7 days of expression, the supernatant of the cell culture is collected, and the protein containing the Fc tag is affinity - purified through a Protein A / G affinity chromatography column. After purification, the target protein is eluted with 100 mM glycinate (pH = 3.0), concentrated, and the buffer is exchanged. Finally, the polypeptide - fusion protein EMP1 - Linker2 - Fc is obtained. The protein containing the His tag is affinity - purified using Ni Smart Beads 6FF (Changzhou Tiandi Renhe Biotechnology Co., Ltd., SA036050), and then the target protein is eluted with an imidazole gradient. Each eluted protein is exchanged into PBS buffer using an ultrafiltration concentrator tube (Millipore, UFC901096). Finally, the polypeptide - fusion proteins (EMP1 - Linker1 - A20 - Flag, EMP1 - Linker2 - Fc, EMP1 - Linker3 - HSA - His) are obtained.
[0446] 3.2 Detection of the binding of the polypeptide - linked fusion protein to the antigen protein by Biacore
[0447] In this example, a Biacore T200 (Cytiva) instrument was used to detect the affinity of the polypeptide molecules prepared in Example 3.1 for the huEPOR - His or huEPOR - Fc antigen.
[0448] Dilute 10×HBS-EP (pH 7.4) with ultrapure water to 1×HBS-EP (pH 7.4) buffer. Then dilute the candidate or control antibody to 30 nM with 1×HBS-EP (pH 7.4) buffer. Dilute huEPOR-His, used as the antigen, in 1×HBS-EP (pH 7.4) buffer by 2-fold serial dilution, successively being 600, 300, 150, 75, 37.5, 18.8, 9.38, 0 nM. Use a Protein A chip (LOT#10323089, Cytiva) to perform the detection according to the preset program. First, capture the candidate or control antibody on the chip for 120 s. After the capture is completed, continue to equilibrate in 1×HBS-EP (pH 7.4) buffer for 30 s, and then pass different concentrations of antigen dilutions through the chip in sequence for antibody-antigen binding for 120 s. Then switch to 1×HBS-EP (pH 7.4) buffer, and the dissociation time is 180 s. Finally, obtain KD, Kon, and Koff by fitting the binding and dissociation data of different concentrations of antigen and antibody.
[0449] The results are shown in Table 4-5. The KD of EMP1-linker1-A20-Flag binding to the antigen protein huEPOR-His is 1.81E-07, while the KD of EMP1-Linker2-Fc binding to the antigen protein huEPOR-His is 1.59E-07; the KD of EMP1-linker1-A20-Flag binding to the antigen protein huEPOR-Fc is 1.33E-08, while the KD of EMP1-Linker2-Fc binding to the antigen protein huEPOR-Fc is 1.22E-08, and the KD of EMP1-Linker3-HSA-His binding to the antigen protein huEPOR-Fc is 7.57E-08. The results indicate that the affinities of EMP1-Linker1-A20-Flag and EMP1-Linker2-Fc for the EPOR antigen are comparable.
[0450] Table 4 Biacore detection results of huEPOR-His antigen
[0451]
[0452] Table 5 Biacore detection results of huEPOR-Fc antigen
[0453]
[0454] Example 4. Screening of polypeptides linked by different Linkers and fusion proteins
[0455] In this example, A20 was selected as the fusion protein according to the results of Example 3 and Example 4. The polypeptide was linked to the fusion protein with different Linkers for phage display and prokaryotic-level antigen affinity ELISA detection to screen for Linkers with better antigen affinity.
[0456] 4.1 Construction of phage display plasmids for linking polypeptides with fusion proteins using different Linkers and sample preparation
[0457] The cyclic peptide sequence (EMP1) of the EPOR antigen was separately linked to Linker1 ((GGGGS)3) and Linker4 (A(EAAAP)3A) (SEQ ID NO: 29), or linked to the A20 VHH sequence obtained in Example 1 through Linker1 ((GGGGS)3) and Linker4 (A(EAAAP)3A). Those with Linker linked alone or A20 linked through Linker were added with Flag and His tags (DYKDHDGDYKDHDIDYKDDDDKGGGGSHHHHHH) at the C-terminus. The obtained nucleotide sequences were constructed into the pcDNA3.4 vector, then transformed into Escherichia coli SS320, cultured overnight at 37 °C, single colonies were picked, and after Sanger sequencing confirmed that the sequences were correct, phage samples EMP1-Linker1-phage, EMP1-Linker2-phage, EMP1-Linker1-A20-phage, and EMP1-Linker2-A20-phage were prepared according to the method of Example 2.2.
[0458] At the same time, Escherichia coli protein lysates were prepared. The preparation method was to inoculate the bacterial solution into 2-YT medium resistant to carbenicillin and tetracycline, culture at 37 °C and 220 rpm for about 36 h, centrifuge the bacterial solution to remove the supernatant, add 0.5 mL of lysate (formula: 200 μL of 1 M Tris-HCl (pH 9.0), 200 μL of 0.1 M EDTA, 60 μL of 2 M MgCl2, 19.64 mL of ddH2O), resuspend the bacterial cells and lyse them on ice for 2 h, and then transfer the supernatant after centrifugation to obtain lysate samples of EMP1-Linker1-Flag-lysate, EMP1-Linker4-Flag-lysate, EMP1-Linker1-A20-Flag-lysate, and EMP1-Linker4-A20-Flag-lysate.
[0459] 4.2 ELISA detection of the binding of phages and lysates of polypeptides linked to fusion proteins with different Linkers to antigen proteins
[0460] Coat the antigen protein huEPOR-His (2 μg / mL, 30 μL / well) on a 96-well ELISA plate and incubate overnight at 4°C. The next day, wash the plate 3 times with PBST and then block it with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add the phage or lysate prepared above and incubate for 1 h. Then, after washing 3 times with PBST, add the secondary antibody Anti-M13-HRP (Sinobiological, 11973-MM05T-H) to the phage and incubate for 1 h, and add the secondary antibody Anti-Flag-HRP (Sigma, A8592-1MG) to the lysate and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development result, add 2 M HCl to terminate the reaction, and read the plate at OD450 using an ELISA reader (Molecular Devices, SpecterMax 190). After statistical analysis with EXCEL, plot the graph.
[0461] The binding results at the lysate level are shown in Figure 7 A. The EC of the binding of EMP1-Linker1-A20-Flag-lysate to the antigen 50 and the upper plateau are better than those of EMP1-Linker4-A20-Flag-lysate, EMP1-Linker1-Flag-lysate, and EMP1-Linker4-Flag-lysate, among which the binding of EMP1-Linker1-Flag-lysate and EMP1-Linker4-Flag-lysate to the antigen is weak.
[0462] The binding results at the phage display level are shown in Figure 7 B. At the prokaryotic protein level, the EC of the binding of EMP1-Linker1-A20-Flag-phage to the antigen 50 and the upper plateau are better than those of EMP1-Linker4-A20-Flag-phage, EMP1-Linker1-Flag-phage, and EMP1-Linker4-Flag-phage. The results show that EMP1-Linker1-A20-Flag has good antigen affinity activity at both the prokaryotic level and the phage display level.
[0463] Example 5. Design of polypeptide amino acid distribution
[0464] For most antibodies, the conformation of the epitope is largely determined by the CDR3 domain, especially the heavy-chain CDR3. The high diversity in the amino acid arrangement and length in the sequence generates different degrees of spatial conformations, which affect the affinity activity through the conformation. Based on some previous theoretical analyses and experimental verifications, the inventors found that the sequence of the CDR3 domain has strong reference significance for the design of cyclic peptide sequences. In this example, the amino acid distribution of the whole human heavy-chain CDR3 will be analyzed by computer to design the amino acid distribution of the polypeptide.
[0465] There are certain differences in the CDR3 sequence of the single-domain antibody (VHH, sometimes also called nanobody) and the CDR3 domain of the variable region of the heavy chain of the ordinary full-length antibody. Therefore, in this example, the amino acid distribution of the CDR3 domain of the single-domain antibody will also be independently statistically analyzed.
[0466] 5.1 Acquisition of antibody sequences
[0467] In this example, to comprehensively study the design of amino acids in the CDR3 sequence in nature as much as possible, whole human antibody sequences and single-domain antibody sequences were collected. Among them, the whole human antibody libraries are the 10-billion-level human-derived antibody library, 100-billion-level human-derived antibody library, trillion-level whole human antibody library, and trillion-level whole human semi-synthetic antibody library owned by Sanyou. The single-domain antibody libraries are the 100-billion-level single-domain antibody library, 100-billion-level semi-synthetic single-domain antibody library, and alpaca immune library. The sequences include the quality control sequencing sequences for constructing the antibody libraries and the lead antibody sequences screened from the antibody libraries.
[0468] After statistics, 30,604 correct whole human antibody sequences and 11,417 single-domain antibody sequences were obtained. After removing the repetitive sequences, finally 20,973 human-derived antibody sequences and 8,007 single-domain antibody sequences were available for analysis. The website for sequence analysis is: https: / / www.ncbi.nlm.nih.gov / igblast / .
[0469] 5.2 Analysis of antibody sequences
[0470] Perform amino acid proportion analysis on the CDR3 sequences obtained in 5.1, corresponding to the design of each amino acid site in the polypeptide library. Perform statistics on the amino acid length and the proportion of each antibody amino acid site in the heavy-chain CDR3 region of human-derived antibodies and the CDR3 region of single-domain antibodies. Use the sequence analysis website: http: / / abysis.org / . We use the AbM scheme to define the precise amino acid sequence boundaries of the CDR or FR and divide the CDR3 region of the antibody sequence. The AbM scheme is a compromise between the kabat and chothia definitions.
[0471] The CDR3 region sequences were statistically analyzed according to the amino acid length, and the results are as Figure 8As shown in Figure A-8B, in the human heavy chain antibody sequence ( Figure 8 A), the amino acid length distribution of CDR3 ranges from 1 to 34, showing a normal distribution as a whole. The most common amino acid length is 12, and most are distributed between 6 and 21 amino acids. In the single-domain antibody sequence ( Figure 8 B), the amino acid length distribution of CDR3 ranges from 1 to 32, also showing a normal distribution as a whole. The most common amino acid length is 14, and most are distributed between 7 and 19 amino acids.
[0472] The amino acid proportion at each site in the CDR3 region was analyzed and statistically counted using R language, especially the distribution pattern of cysteine. The results showed that the amino acid proportion distribution diversity at each site was very high for both human antibodies and single-domain antibodies, but there were certain differences between human antibodies and single-domain antibodies.
[0473] According to the length distribution pattern of the CDR3 region of human antibodies and single-domain antibodies, the number of amino acids for the cyclic peptide library design was determined to be 8 - 19. According to their structures, they were assigned as NL6~NL17 and NB9-1~NB17-78. The polypeptide length design layout is as Figure 9A shown in Figure -9G. Figure 9A Figure 9A is the polypeptide length designed according to the amino acid length rule of the human heavy chain CDR3 region and the corresponding cysteine sites (NL6~NL17), and Figures 9B - 9I are the polypeptide lengths designed according to the amino acid length rule of the single-domain antibody CDR3 region and the corresponding cysteine sites (NB9-1~NB17-78).
[0474] Determine the most primitive amino acid length distribution pattern of the CDR3 region in nature, as well as the amino acid proportion at each site in the CDR3 region, analyze to obtain sub-libraries, and based on this, guide the next step of designing polypeptides that best conform to natural laws, thereby improving the drug-likeness of polypeptides.
[0475] Example 6. Construction of a polypeptide library
[0476] 6.1 Construction of a polypeptide phage display library with hundreds of billions of members
[0477] In this example, eight sub-libraries designed in Example 5, namely NB-9-9, NB-11-19, NB-14-36, NB-17-58, NL-6, NL-9, NL-12, and NL-17, were selected for the construction of an exemplary polypeptide phage display library.
[0478] The polypeptide configuration of the library members is as Figure 10 shown. The cyclic peptide (R) is connected to the anti-HSA single-domain antibody (V) through a linker (L), and the tag (T) at the C-terminal end is fused in the structure of formula (I) from the N-terminal to the C-terminal:
[0479] R-L-V-(T) (I)
[0480] Among them, in this embodiment, the tag (T) is the Flag-His tag (DYKDHDGDYKDHDIDYKDDDDKGGGGSHHHHHH, SEQ ID NO: 27), wherein the linker is the aforementioned Linker1 ((GGGGS)3, SEQ ID NO: 24), and the single-domain antibody is A20-VHH5 prepared in Example 1.
[0481] The method for constructing the phage display library of the polypeptide library is as follows: The gene sequence library encoding the members of the cyclic peptide library is realized by synthesizing a trinucleotide polynucleotide (Trimer polynucleotide) library. The linker is introduced by constructing its coding sequence at the 3' end of the trinucleotide polynucleotide and the 5' end of the anti-HSA single-domain antibody coding gene (each part has an overlap), and a fixed sequence is additionally added at the 5' end to introduce a HindIII cleavage site and serve as the 5' primer binding region; the anti-HSA single-domain antibody coding gene is amplified by PCR using gene synthesis as a template according to the determined sequence (the DNA sequence encoding the amino acid sequence of SEQ ID NO: 14) and adding a NotI cleavage site; the two amplification products are ligated into a full-length single nucleic acid sequence by fusion PCR. Further, using this as a template, the forward primer and reverse primer amplified in two parts are used respectively. After full-length amplification, double digestion is performed using the designed sites and cloned and ligated into the phage expression vector containing the Flag-His tag coding sequence, inserted at the upstream position of the tag.
[0482] Exemplary specific steps are as follows:
[0483] Amplification of polypeptide fragments: The trinucleotide polynucleotide (Trimer polynucleotide) library is diluted and used as a template to configure a 50 μL PCR reaction system: 25 μL of 2×Prime Star Mix (TaKaRa, R045A), primer CPL-HindIII-Trim-F1 (sequence: 5'-
[0484] 1 μL of primer CPL-Trim-F (sequence: 5'-tacgccaagcttgcatgcaaattctatttcaaggagacagtcataatgaaatacctattgcctacggcagccgctggattgttattactcgcggctcagccggccatggcc-3’, SEQ ID NO:35), 1 μL of primer CPL-Trim-R (sequence: 5'-ACTTCCACCTCCGCCAGATCCTCCGCCTC-3’, SEQ ID NO:36), 20 ng of Trimer polynucleotide library, and made up to 50 μL with ddH2O; The PCR reaction system was: 98°C for 120 s, 98°C for 10 s, 65°C for 15 s, 72°C for 10 s, 72°C for 120 s, stored at 4°C, and the number of amplification cycles was 25. For the amplified sample, add 10×loading buffer and mix well, add it into the wells of 1% agarose gel, 160 V, 30 min. After gel cutting and recovery, use a gel recovery kit (Omega, D2500-02) for gel recovery.
[0485] Amplification of the fusion protein A20-VHH5 fragment: Gene synthesis of pUC-A20-VHH5 (NotI restriction site and primer binding sequence added at the 3' end), diluted and used as a template, configure a 50 μL PCR reaction system: 25 μL of 2×Prime Star Mix (TaKaRa, R045A), 1 μL of primer CPL-A20-F1 (sequence: 5'-GGAGGCGGAGGATCTGGCGGAGGTGGAAGTG-3’, SEQ IDNO:37), 1 μL of primer CPL-A20-R (sequence: 5'-CTAGCATAACTAGCCTCGTGATG-3’, SEQ ID NO:38), 20 ng of template, and made up to 50 μL with ddH2O; The PCR reaction system was: 98°C for 120 s, 98°C for 10 s, 65°C for 15 s, 72°C for 10 s, 72°C for 120 s, ∞ at 4°C, and the number of amplification cycles was 25. For the amplified sample, add 10×loading buffer and mix well, add it into the wells of 1% agarose gel, 160 V, 30 min. After gel cutting and recovery, use a gel recovery kit (Omega, D2500-02) for gel recovery.
[0486] The recycled polypeptide fragment and the fusion protein VHH A20-VHH5 fragment were subjected to fusion PCR reaction: the total amount of the polypeptide fragment and the fusion protein A20-VHH5 was 1 μg, 25 μL of 2×Prime Star Mix (TaKaRa, R045A), and ddH2O was added to make up to 50 μL; the PCR reaction system was: 98 °C for 120 s, 98 °C for 10 s, 65 °C for 15 s, 72 °C for 10 s, 72 °C for 120 s, stored at 4 °C, and the number of amplification cycles was 25. After the fusion PCR reaction, the fusion product was purified using a DNA purification kit cycle pure (Omega, D6293-02), and the purified product was used as the template for the full-length amplification reaction.
[0487] Full-length amplification reaction: 25 μL of 2×Prime Star Mix (TaKaRa, R045A), 1 μL of primer CPL-F (sequence: 5’-tacgccaagcttgcatgcaaattc-3’, SEQ ID NO:39), 1 μL of primer CPL-A20-R (sequence: 5’-CTAGCATAACTAGCCTCGTGATG-3’, SEQ ID NO:38), 20 ng of template, and ddH2O was added to make up to 50 μL; the PCR reaction system was: 98 °C for 120 s, 98 °C for 10 s, 65 °C for 15 s, 72 °C for 10 s, 72 °C for 120 s, ∞ at 4 °C, and the number of amplification cycles was 15. After the full-length amplification reaction, the amplification product was mixed with 10×loading buffer and added to the wells of a 1% agarose gel, and electrophoresed at 160 V for 30 min. After gel extraction and recovery, a gel extraction kit (Omega, D2500-02) was used for gel extraction and recovery.
[0488] After obtaining the full-length amplification fragments of the polypeptide and the fusion protein A20-VHH5, double digestion of the full-length fragment and the phage display plasmid was carried out. The digestion system was as follows: 1 μg of the full-length fragment or vector, 2 μL of 10×Fast Digest buffer, 1.2 μL of HindIII (Thermo Fisher, FD0505), 0.6 μL of NotI (Thermo Fisher, FD0596), and ddH2O was added to make up to 20 μL. The digested full-length product and the PMID21 vector (manufacturer: Novopro, product number: V004730#) were mixed with 10×loading buffer and added to the wells of a 1% agarose gel, and electrophoresed at 160 V for 30 min. After gel extraction and recovery, a gel extraction kit (Omega, D2500-02) was used for gel extraction and recovery.
[0489] The recovered digested full-length fragment and dAb fragment were subjected to a ligation reaction. The ligation system and conditions were as follows: a total of 220 ng of the digested fragment and the vector, 2 μL of 10× ligation buffer, 1 μL of T4 ligase (Thermo Fisher, EL0012), and ddH2O was added to make up to 20 μL. The ligated product was purified using a DNA purification kit cycle pure (Omega, D6293-02).
[0490] Finally, the recovered ligated product was transformed into competent Escherichia coli SS320 (Lucigen, MC1061 F) using an electroporator (Bio-Rad, MicroPulser), and the transformed Escherichia coli SS320 bacterial solution was spread on a 2-YT solid plate with ampicillin resistance (the solid plate was prepared from 1.5% tryptone, 1% yeast extract, 0.5% NaCl, and 1.5% agar, prepared according to mass / volume g / mL).
[0491] By gradient dilution and plating, the total library capacity of the NB-9-5, NB-11-13, NB-14-28, NB-17-47, NL-6, NL-9, NL-12, and NL-18 libraries was 1.29×10 11 cfu, that is, 1.29×10 11 a phage display library of polypeptides. At the same time, the gradient-diluted bacterial solution was spread on plates to obtain monoclonal colonies, and 560 colonies were picked for sequencing.
[0492] As shown in Table 6 after sequencing, the overall efficiency of the polypeptide phage display library was 79%, and the overall sequence unique molecule ratio (unique rate) of the polypeptide phage display library was 100%.
[0493] Table 6 Library capacity of the polypeptide phage display library in the tens of billions
[0494] Name Planned library size Actual library size Efficiency Unique rate NL-6 1.00E+10 1.33E+10 95% 100% NL-9 1.00E+10 2.00E+10 100% 100% NL-12 1.00E+10 2.43E+10 77% 100% NL-17 1.00E+10 1.68E+10 55% 100% NB-9-5 1.00E+10 1.07E+10 69% 100% NB-11-13 1.00E+10 1.89E+10 86% 100% NB-14-28 1.00E+10 1.33E+10 71% 96% NB-17-48 1.00E+10 1.21E+10 77% 100% Trimer summary 8.00E+10 1.29E+11 79% 100%
[0495] Example 7. Screening of the polypeptide library
[0496] In this example, the polypeptide phage library constructed in Example 6 was screened using human TROP2 and human ROR1 recombinant proteins as screening antigens.
[0497] 7.1 Preparation of antigen proteins
[0498] By genetic manipulation at the level of the coding gene, a His tag or a human IgG1 Fc tag was added to the C-terminus of the sequences of human TROP2 protein huTROP2 ECD AA31-274 (Uniprot ID: P09758-1, SEQ ID NO: 30) and human ROR1 protein huROR1 ECD AA30-406 (Uniprot ID: Q01973, SEQ ID NO: 31), respectively. The obtained nucleic acid sequences were respectively constructed into the pcDNA3.4 vector, then transformed into Escherichia coli DH5α, cultured overnight at 37 °C, and then the plasmid was extracted using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01). The obtained plasmid was transiently transfected into HEK293 cells ( TM 293 transfection kit (Gibco TM , A14524) CRL-1573 TM ) using ExpiFectamine. After 7 days of expression, the supernatant of the cell culture was collected. The antigen containing the Fc tag was affinity purified by COLUMN XK16 / 20 (Cytiva). After purification, the target protein was eluted with 100 mM glycine salt (pH = 3.0), concentrated, and the buffer was exchanged. Finally, the antigen proteins (huTROP2-Fc, huROR1-Fc) were obtained; the antigen containing the His tag was affinity purified with Ni Smart Beads 6FF (Changzhou Tiandi Renhe Biotechnology Co., Ltd., SA036050), and then the target protein was eluted with a gradient concentration of imidazole. Each eluted protein was exchanged into PBS buffer using an ultrafiltration concentrator tube (Millipore, UFC901096). Finally, the antigen proteins (huTROP2-His, huROR1-His) were obtained.
[0499] 7.2 Preparation of huROR1-HEK293 overexpressing cell line
[0500] The coding nucleic acid sequence of full-length human ROR1 (Uniprot ID: Q01973, SEQ ID NO: 32) was constructed onto the pLVX-puro plasmid (Clontech, Cat#632164). Then, the obtained plasmid was electrotransformed into HEK293 cells ( TM Transfection System, MP922947) using an electroporator (Invitrogen, Neon CRL-1573 TM) After electroporation, the obtained cells were separately transferred into DMEM medium (Gibco, 11995065) containing 10% (v / v) FBS (Gibco, 15140-141) and no antibiotics, and then the cells were transferred into a 10×10 cm cell culture dish and cultured for 48 hours. Then, the cells were dispensed into a 96-well cell culture plate at a density of 10 4 cells / well, and puromycin with a final concentration of 2 μg / mL was added as a selection pressure. After about 2 weeks, the cell lines forming clones were picked for identification.
[0501] 7.3 Screening of antibody gene phage display library by magnetic bead method
[0502] Magnetic bead screening is based on the biotinylation of huROR1-His, huROR1-Fc, huTROP2-His and huTROP2-Fc, followed by binding to magnetic beads conjugated with streptavidin. Through the panning process of incubating, washing and eluting the magnetic beads bound to the antigen and the antibody gene phage display library, usually 3-4 rounds of panning are experienced, and finally the binding specific polypeptides against the antigen can be enriched in large quantities.
[0503] The specific implementation method of antibody screening is as follows:
[0504] First, incubate the biotinylated antigen proteins (huROR1-His-Biotin, huROR1-Fc-Biotin, huTROP2-His-Biotin, huTROP2-Fc-Biotin) with magnetic beads conjugated with streptavidin, so that the huROR1-His-Biotin, huROR1-Fc-Biotin, huTROP2-His-Biotin or huTROP2-Fc-Biotin proteins bind to the magnetic beads. Incubate the magnetic beads bound with huROR1-His-Biotin, huROR1-Fc-Biotin, huTROP2-His-Biotin and huTROP2-Fc-Biotin proteins with the constructed phage library at room temperature for 2 h. After washing 6-8 times with PBST to remove non-specifically adsorbed phages, add Trypsin (Gibco, 25200072), gently mix and react for 20 min to elute the antibody-displaying phages that specifically bind. Subsequently, infect the logarithmic-phase SS320 bacteria (Lucigen, MC1061 F) with the eluted phages and let stand for 30 min, then culture at 220 rpm for 1 h, add VSCM13 helper phages and let stand for 30 min, continue to culture at 220 rpm for 1 h, centrifuge and transfer to C+ / K+2-YT medium. The finally obtained phages are continued to be used for the next round of panning, and the panning is repeated 2-3 times.
[0505] 7.4 Immunotube method for screening phage display antibody gene library
[0506] Immunotube screening is a panning process in which huROR1-His, huROR1-Fc, huTROP2-His or huTROP2-Fc is coated on the surface of an immunotube with high adsorption capacity. The phage display cyclic peptide library is added to the immunotube and incubated, washed and eluted with the antigen protein adsorbed on the surface of the immunotube. After 2-4 rounds of panning, the specific polypeptides against the antigen are finally enriched.
[0507] The specific implementation method is as follows:
[0508] In the first round of screening, 1 mL of 100 μg / mL huROR1-His, huROR1-Fc, huTROP2-His or huTROP2-Fc is added to the immunotube and coated overnight at 4°C. The next day, the coating solution is discarded, and 5% milk in PBS is added for blocking for 2 h. After rinsing twice with PBST (PBS containing 0.05% Tween 20), a total of 1*10 13 peptide library is added and incubated for 2 h. The phages with non-specific binding are removed by rinsing 2 times with PBS and 6 times with PBST (PBS containing 0.05% Tween 20). Then, 0.8 mL of 0.05% EDTA trypsin digestion solution is added to the immunotube to elute the phages specifically binding to the target antigen. Then, the eluted phages are used to infect the logarithmic-phase SS320 bacteria (Lucigen, 60512-1), and left standing at 37°C for 30 min, then cultured at 220 rpm for 1 h. Then, VSCM13 helper phage is added and left standing for 30 min, and the culture is continued at 220 rpm for 1 h. After centrifugation, the phages are transferred to C+ / K+2-YT medium and cultured overnight at 30°C and 220 rpm. The next day, the phages are precipitated and used for the subsequent 2-4 rounds of screening. Generally, the antigen coating concentrations for the second and third rounds are gradually decreased to 30 μg / mL and 10 μg / mL respectively; in addition, the intensity of PBS rinsing is also gradually increased, and the number of PBS elution times is 10 times and 14 times respectively.
[0509] 7.5 Selection of monoclonal
[0510] After three rounds of screening, the second and third rounds were selected for positive cloning. The plates were coated with huTROP2–His or huROR1-His antigens for ELISA screening. Finally, a total of 140 Unique polypeptide molecules were obtained from the huTROP2-His antigen, and the sequences of 43 polypeptides were finally selected to construct the full length for eukaryotic expression and purification. A total of 72 Unique polypeptide molecules were obtained from the huROR1-His antigen, and the sequences of 38 polypeptides were finally selected to construct the full length for eukaryotic expression and purification.
[0511] Example 8. Construction, expression and purification of full-length polypeptides
[0512] In this example, the polypeptide sequences obtained by screening in Example 7 were used for the construction of eukaryotic expression vectors and eukaryotic expression and purification.
[0513] 8.1 Construction of eukaryotic plasmids for polypeptides
[0514] The polypeptide sequences obtained by screening in Example 7 were inserted into the eukaryotic expression vector plasmid pcDNA3.4 (Invitrogen), and then transformed into Escherichia coli DH5α and cultured overnight at 37°C. The plasmid was extracted using an endotoxin-free plasmid extraction kit (OMEGA, D6950-01) to obtain endotoxin-free antibody plasmids for eukaryotic expression.
[0515] 8.2 Expression and purification of polypeptides
[0516] The above-obtained polypeptide sequences were expressed through the ExpiCHO transient expression system (Thermo Fisher, A29133). The specific method is as follows: On the day of transfection, confirm that the density of CHO cells is about 7×10 6 to 1×10 7 viable cells / mL, and the cell viability > 98%. At this time, adjust the cells to a final concentration of 6×10 6 cells / mL with fresh ExpiCHO expression medium pre-warmed at 37°C. Dilute the target plasmid with OptiPRO TM SFM (add 1 μg plasmid to 1 mL of the medium), and at the same time dilute ExpiFectamine TM CHO reagent with OptiPRO TM SFM, then mix the two in equal volumes and gently pipette to mix evenly to prepare the ExpiFectamine TM CHO / plasmid DNA mixture, incubate at room temperature for 1-5 min, slowly add it to the prepared cell suspension while gently shaking, and finally place it in a cell culture shaker and culture at 37°C and 8% CO2.
[0517] 18 - 22 h after transfection, add ExpiCHO TM Enhancer reagent and ExpiCHO TM Feed reagent into the cell culture medium, and place the shake flask in a shaker at 32 °C and 5% CO2 for continued culture. On the 5th day after transfection, add the same volume of ExpiCHO TM Feed reagent, and gently mix the cell suspension while slowly adding it. 7 days after transfection, collect the cell culture supernatant expressing the target antibody protein, centrifuge at 15000 g for 10 min, and purify the obtained supernatant with MabSelect SuRe TM LX (GE, 17 - 5474 - 99) by affinity purification, and then elute the target polypeptide with 0.1 M Pro - Ac pH 3.5.
[0518] Example 9. Physicochemical and Affinity Analysis of Polypeptides
[0519] In this example, the polypeptides expressed and purified in Example 8 were subjected to physicochemical analysis and affinity activity detection.
[0520] 9.1 SDS - PAGE Detection
[0521] In this example, the purity of the candidate molecules in the polypeptide library was detected based on SDS - PAGE gel electrophoresis. The specific procedure of SDS - PAGE gel electrophoresis is as follows:
[0522] Preparation of non - reducing solution: Add 1 μg of the candidate antibody and the control product IPI (i.e., ipilimumab) to 5×SDS loading buffer and 40 mM iodoacetamide, heat in a dry bath at 75 °C for 10 min, cool to room temperature, and centrifuge at 12000 rpm for 5 min to take the supernatant. Preparation of reducing solution: Add 2 μg of the candidate antibody and the control product IPI to 5×SDS loading buffer and 5 mM DTT, heat in a dry bath at 100 °C for 10 min, cool to room temperature, and centrifuge at 12000 rpm for 5 min to take the supernatant. Add the supernatant to a Bis - tris 4 - 15% gradient gel (GenScript) for gel electrophoresis and stain the protein bands with Coomassie Brilliant Blue. Scan the protein gel with the stained protein bands (decolorize with decolorizing solution until the gel background is transparent) using an EPSON V550 color scanner, and calculate the purity of the reduced and non - reduced bands by the peak area normalization method using ImageJ
[0523] A total of 7 polypeptide molecules were detected in this example, and the experimental results are shown in Table 7. The results show that the SDS - PAGE protein purity of the candidate molecules in the polypeptide library is greater than 95%.
[0524] Table 7 Physicochemical Properties of Candidate Polypeptides
[0525] Protein name Target Molecular weight (KD) Isoelectric point Extinction coefficient SDS-PAGE(%) A039 TROP2 20.11 6.04 2.33 >95 A023 TROP2 20.63 6.19 2.24 >95 A002 TROP2 20.55 6.19 2.44 >95 A017 TROP2 21.02 6.03 2.12 >95 A021 ROR1 20.56 5.87 1.83 >95% A017-1 ROR1 20.67 6.34 2.43 >95% B003 ROR1 20.6 6.34 2.09 >95%
[0526] 9.2 Detection of the binding activity of anti-huTROP2 polypeptide to huTROP2-His
[0527] In this example, the affinity activity of the polypeptide expressed and purified in Example 8 was detected based on the ELISA method
[0528] Coat huTROP2-His (2 μg / mL, 30 μL / well) on a 96-well ELISA plate and incubate overnight at 4°C. The next day, wash the well plate 3 times with PBST and then block it with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add serially diluted candidate polypeptide molecules and the positive control antibody Sacituzumab and incubate for 1 h. Then, after washing 3 times with PBST, add the secondary antibody Anti-Human-IgG-Fc-HRP (abcam, ab97225), 1:8000 / Anti-Flag-HRP (Sigma, A8592-1MG), and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development result, add 2 M HCl to terminate the reaction, and read the plate at OD450 using a microplate reader (Molecular Devices, SpecterMax 190).
[0529] The results showed that Figure 11 : The candidate molecules A023, A039, A002, and A017 all had good binding activities to the antigen protein huTROP2-His.
[0530] 9.3 Detection of the affinity kinetics of anti-huTROP2 polypeptide
[0531] In this example, the Biaocre T200 (PCytiva) instrument was used to detect the affinity of the molecules A039 and A023 from the polypeptide library to the antigen protein huTROP2-Fc.
[0532] The specific method is as follows: Dilute 10×HBS-EP (pH 7.4) with ultrapure water to 1×HBS-EP (pH 7.4) buffer, and then dilute the candidate polypeptide molecules to 30 nM with 1×HBS-EP (pH 7.4) buffer. The huTROP2-Fc used as the antigen is serially diluted 2-fold with 1×HBS-EP (pH 7.4) buffer, successively being 600, 300, 150, 75, 37.5, 18.8, 9.38, 0 nM. Detection is performed using a Protein A chip (LOT#10323089, Cytiva) according to a preset program. First, the chip captures the candidate or control antibody for 120 s. After the capture is complete, it continues to equilibrate in 1×HBS-EP (pH 7.4) buffer for 30 s, and then the antigen dilutions of different concentrations are successively passed through the chip for antibody-antigen binding for 120 s. Then, it is switched to 1×HBS-EP (pH 7.4) buffer, and the dissociation time is 180 s. Finally, KD, Kon, and Koff are obtained by fitting the binding and dissociation data of the antigen of different concentrations and the polypeptide molecules. A total of 2 candidate molecules are detected.
[0533] As shown in Table 8, the candidate polypeptide molecules A039 and A023 both showed affinity activity with the antigen huTROP2-Fc.
[0534] Table 8 Affinity Kinetics Results of Anti-huTROP2 Polypeptide Molecules
[0535] Protein name KD(M) Kon(1 / Ms) Koff(1 / s) Rmax(nm) Chi2 A039 1.69E-07 7.69E+03 1.30E-03 56.86 0.417 A023 2.14E-07 9.82E+03 2.11E-03 46.26 0.398
[0536] 9.4 Detection of the Binding Activity of Anti-huROR1 Polypeptide Molecules to huROR1-HEK293
[0537] In this example, FACS activity evaluation of the candidate molecules in the polypeptide library was performed using human ROR1 overexpressing cells huROR1-HEK293, and a total of 3 candidate polypeptides were selected.
[0538] The specific method of FACS is as follows: Prepare a single-cell suspension of logarithmically growing huROR1-HEK293 cells, adjust the density to 1×10 6 cells / mL, add 100 μL per well to a 96-well round bottom plate, centrifuge at 4°C and 300 g, and remove the supernatant. Add the 3 candidate molecules of gradient dilution and the negative control antibodies anti-Human Fc (Jackson, 109-115-098, 1:200) or Anti-his (BioLegend 362603 1:100) to the corresponding wells, incubate in the dark at 4°C for 30 min, wash 3 times, and then detect using a flow cytometer (Beckman, CytoFLEX AOO-1-1102).
[0539] The results are asFigure 12 As shown in the figure, on huROR1-HEK293 cells, the purified polypeptide molecules can bind to huROR1-HEK293 cells. The results show that the polypeptide molecules A021 and A017-1 have certain binding activities with huROR1-HEK293, and the binding level is at the μM level.
[0540] Example 10. Affinity Maturation of Polypeptides and Affinity Analysis of Polypeptides after Affinity Maturation
[0541] In this example, the obtained anti-ROR1 polypeptide molecules were subjected to affinity maturation, and the affinity properties of the molecules after affinity maturation were detected.
[0542] 10.1 Affinity Maturation of Anti-ROR1 Polypeptide Molecules
[0543] The cyclic peptide sequences in the anti-ROR1 polypeptide molecules screened in Example 7 were subjected to sequence alignment analysis. The results are as Figure 13 shown in A. There are conserved amino acid sites in the cyclic peptide sequences of the three polypeptide molecules (shown as SEQ ID NO:40, 41, and 42 respectively). According to the analysis results, a Figure 13 mutation library shown in B was designed by retaining the conserved amino acid sites. In the first library, L (leucine) at the sixth position, G (glycine) at the seventh position, and two cysteines were fixed, and other sites were mutated into 20 arbitrary natural amino acids using NNK degenerate primers; the second library contains three different designs. One is to fix L (leucine) at the sixth position, G (glycine) at the seventh position, F (phenylalanine) at the tenth position, W (tryptophan) at the twelfth position, and two cysteines. The second is to fix L (leucine) at the sixth position, G (glycine) at the seventh position, L (leucine) at the eighth position, and N (asparagine) at the eleventh position, and two cysteines. The third is to fix L (leucine) at the sixth position, G (glycine) at the seventh position, L (leucine) at the eighth position, F (phenylalanine) at the tenth position, N (asparagine) at the eleventh position, and W (tryptophan) at the twelfth position, and two cysteines.
[0544] The constructed mutation library was also ligated to anti-HSA VHH through a linker and displayed on phages.
[0545] The specific library construction method is as follows: first, a primer containing a point mutation is synthesized (Golden Wisdom Biotechnology Co., Ltd.); secondly, the coding sequence of the cyclic peptide in the polypeptide molecules to be modified (also called the parent polypeptide) A017-1, B003, and A013 is used as a PCR amplification template to amplify the sequence containing the designed mutation and the A20-VHH5 sequence containing the Linker, and the fragment containing the mutation at different sites is combined with the A20-VHH5 sequence containing the Linker by the bridge PCR method, and then the point mutation antibody is connected to the phage display vector by double enzyme digestion (HindⅢ and NotⅠ) and double sticky end connection, and finally the antibody sequence with the mutation site is transferred into Escherichia coli SS320 by electroporation. The library capacity calculation, phage library preparation and library screening operation process are detailed in Example 10. After screening and selection, affinity matured polypeptide molecules N-PR-003 (cyclic peptide sequence is SEQ ID NO: 43), N-PR-037 (cyclic peptide sequence is SEQ ID NO: 44), N-PR-055 (cyclic peptide sequence is SEQ ID NO: 45), N-PR-075 (cyclic peptide sequence is SEQ ID NO: 46), N-PR-089 (cyclic peptide sequence is SEQ ID NO: 47), N-PR-187 (cyclic peptide sequence is SEQ ID NO: 48), N-PR-197 (cyclic peptide sequence is SEQ ID NO: 49) and N-PR-210 (cyclic peptide sequence is SEQ ID NO: 50) were obtained.
[0546] 10.2 Construction, expression, purification and SDS PAGE detection of affinity matured peptide fused to Fc protein
[0547] The affinity-matured polypeptide obtained in Example 10.1 and the polypeptides A017-1 and B003 before affinity maturation were constructed into the eukaryotic expression vector pcDNA3.4 containing the IgG1 subtype Fc sequence with the hinge region EPKSC mutated to EPKSS, expressed through the ExpiCHO transient expression system (Thermo Fisher, A29133), and affinity-purified using MabSelect SuRe LX (GE, 17547403) to finally obtain the proteins of N-PR-003-Fc (IgG1-CS), N-PR-037-Fc (IgG1-CS), N-PR-055-Fc (IgG1-CS), N-PR-075-Fc (IgG1-CS), N-PR-089-Fc (IgG1-CS), N-PR-187-Fc (IgG1-CS), N-PR-197-Fc (IgG1-CS), N-PR-210-Fc (IgG1-CS), A017-1-Fc (IgG1-CS), and B003-Fc (IgG1-CS) polypeptides fused with Fc. SDS-PAGE detection was performed according to the method in Example 9, and the detection results are shown in Table 9. The SDS-PAGE purity of the affinity-matured polypeptide fused with the Fc protein was above 95%.
[0548] Table 9 Physicochemical properties of the affinity-matured polypeptide fused with the Fc protein
[0549]
[0550] 10.3 ELISA detection of the affinity-matured anti-ROR1 polypeptide fused with the Fc protein molecule
[0551] In this example, the above-obtained affinity-matured anti-ROR1 polypeptide fused with the Fc protein molecule was subjected to ELISA detection, and the specific method was as follows:
[0552] huROR1-His (2 μg / mL, 30 μL / well) was coated on a 96-well ELISA plate and incubated overnight at 4°C. The next day, the wells of the plate were washed 3 times with PBST and then blocked with 5% skim milk for 2 h. After washing the plate 3 times with PBST, gradient-diluted affinity-matured candidate polypeptide fused with the Fc protein molecule and polypeptide fused with the Fc protein molecule before affinity maturation were added and incubated for 1 h. Then, after washing 3 times with PBST, secondary antibody Anti-Hu Fc-HRP (abcam, ab97225) was added and incubated for 1 h. After incubation, the plate was washed 6 times with PBST, and TMB (SurModics, TMBS-1000-01) was added for color development. According to the color development result, 2 M HCl was added to terminate the reaction, and the plate was read at OD450 using a microplate reader (Molecular Devices, SpecterMax 190).
[0553] The results are as Figure 14 shown. The affinity-matured candidate polypeptides fused with the Fc protein, N-PR-003-Fc (IgG1-CS) (EC 50 : 1.328 nM), N-PR-037-Fc (IgG1-CS) (EC 50 : 0.7469 nM), N-PR-055-Fc (IgG1-CS) (EC 50 : 0.5493 nM), N-PR-075-Fc (IgG1-CS) (EC 50 : 1.1 nM), N-PR-089-Fc (IgG1-CS) (EC 50 : 2.406 nM), N-PR-187-Fc (IgG1-CS) (EC 50 : 0.8908 nM), N-PR-197-Fc (IgG1-CS) (EC 50 : 1.379 nM), N-PR-210-Fc (IgG1-CS) (EC 50 : 1.956 nM), show significantly better ELISA affinity activity with the antigen protein than the polypeptides fused with the Fc protein before affinity maturation, A017-1-Fc (IgG1-CS) and B003-Fc (IgG1-CS). Among them, the affinity of N-PR-055-Fc (IgG1-CS) is about ten times higher than that of the polypeptides before affinity maturation, A017-1-Fc (IgG1-CS) (EC 50 : 9.557 nM) and B003-Fc (IgG1-CS) (EC 50 : 5.088 nM).
[0554] 10.4 FACS Detection of Affinity-Matured Anti-ROR1 Polypeptide Fused with Fc Protein
[0555] In this example, the affinity-matured anti-ROR1 polypeptide fused with the Fc protein molecule obtained above was subjected to FACS detection. The specific method is as follows: The logarithmically growing huROR1-HEK293 cells were prepared into a single-cell suspension, and the density was adjusted to 1×10 6 cells / mL. 100 μL was added to each well of a 96-well round-bottom plate and centrifuged at 4 °C and 300 g to remove the supernatant. Gradient-diluted candidate molecules and negative control antibodies, anti-Human Fc (Jackson, 109-115-098, 1:200) or Anti-his (BioLegend 362603 1:100), were added to the corresponding wells and incubated at 4 °C in the dark for 30 min. After washing 3 times, detection was performed using a flow cytometer (Beckman, CytoFLEX AOO-1-1102).
[0556] The results are as Figure 15 shown. The affinity matured candidate polypeptides fused with Fc protein, N-PR-187-Fc (IgG1-CS) (EC 50 : 0.433 nM), N-PR-197-Fc (IgG1-CS) (EC 50 : 0.2402 nM), and N-PR-210-Fc (IgG1-CS) (EC 50 : 0.5584 nM) have good affinity activities with huROR1-HEK293 cells.
[0557] Example 11. Construction of a trillion polypeptide library
[0558] In this example, a trillion-level polypeptide phage display library was constructed with reference to the method in Example 6. The specific method is as follows:
[0559] Single-stranded DNA fragments NB-14-28 and NB-17-48 designed according to the amino acid distribution ratios of single-domain antibodies with amino acid lengths of 14 and 17 statistically in Example 5 were gene-synthesized. At the same time, single-stranded DNA fragments NL-12 and NL-17 designed according to the amino acid distribution ratios of human antibodies with amino acid lengths of 12 and 17 statistically in Example 5 were gene-synthesized. Then, using single-stranded DNA fragments NB-14-28, NB-17-48, NL-12, and NL-17 as templates, PCR amplification was performed to obtain double-stranded DNA fragments NB-14-28, NB-17-48, NL-12, and NL-17. At the same time, using A20-VHH5 screened in Example 1 as a template, PCR amplification was performed to obtain the VHH fragment. The obtained double-stranded DNA fragments NB-14, NB-17, NL-12, and NL-17 and the VHH fragment were combined by fusion PCR to obtain full-length fragments. Then, the full-length fragments were digested with enzymes and ligated to the phage display vector. The ligation product was recovered using a recovery kit (Omega, catalog number: D6492-02). Finally, it was transformed into competent Escherichia coli SS320 (Lucigen, MC1061F) using an electroporator (Bio-Rad, MicroPulser), and the transformed Escherichia coli SS320 bacterial solution was spread on a 2-YT solid plate with ampicillin resistance (the solid plate was prepared from 1.5% tryptone, 1% yeast extract, 0.5% NaCl, and 1.5% agar, prepared according to g / mL by mass volume). After overnight culture, 2YT medium was added to the 2-YT solid plate covered with library bacteria on the surface, and the library bacteria grown on the 2-YT solid plate with ampicillin resistance were scraped with a spreading rod. Then, an appropriate volume of 80% sterilized glycerol (final concentration 10 - 20%) was added to construct 4 polypeptide phage display libraries.
[0560] The library sizes of the 4 polypeptide phage display libraries obtained by gradient dilution plating were determined (the method for calculating the library size refers to Example 2.2 in CN112250763B). At the same time, hundreds of polypeptides were picked from each library for sequencing analysis.
[0561] The library sizes, Unique rates, and proportions of valid sequences of the 4 polypeptide phage display libraries are shown in Table 10. The library sizes of the 4 polypeptide phage display libraries are all above 2.58E+11.
[0562] Table 10 Library sizes, Unique rates, and proportions of valid sequences of polypeptide phage display libraries
[0563] Library name Actual library size Terminator percentage Unique rate Percentage of valid sequences NB-14-28 3.02E+11 5.58% 100% 77.46% NL-17 2.58E+11 4.56% 100% 70.94% NB-17-48 3.15E+11 5.98% 100% 77.33% NL-12 2.91E+11 1.76% 100% 86.40%
[0564] Example 12. Screening of a trillion polypeptide library and expression and purification of polypeptides after screening
[0565] In this example, a human PD-L1 recombinant protein (prepared by adding a His tag or a human IgG1 Fc tag to the C-terminus of the sequence of human PD-L1 protein huPD-L1 ECD AA19-238 (Uniprot ID: Q9NZQ7, SEQ ID NO: 33), namely huPD-L1-His and huPD-L1-Fc) was used as the screening antigen to screen the polypeptide phage library constructed in Example 11. The specific method was the same as that in Example 7.
[0566] The polypeptide sequences obtained by screening were used for the construction of eukaryotic expression vectors and eukaryotic expression purification. The specific method was the same as that in Example 8.
[0567] Example 13. Detection of polypeptide physicochemical properties
[0568] In this example, SDS-PAGE and SEC were used to detect the polypeptides expressed and purified in Example 12.
[0569] 13.1 SDS-PAGE detection of polypeptides
[0570] The SDS-PAGE detection method was the same as that in Example 9.
[0571] The results are as Figure 16 ( Figure 16 A is the SDS-PAGE diagram of polypeptide A083-v2, and 16B is the SDS-PAGE diagram of polypeptide A083-v3) and Table 11 show that the bands of each polypeptide in non-reducing gel and reducing gel are around 20 kD, which is in line with the expected size.
[0572] 13.2 SEC-HPLC identification of monomer purity of polypeptides
[0573] Material preparation: Phosphate buffer solution with a concentration of 150 mmol / L and pH 7.4 was used as the mobile phase. Each antibody and the quality control product IPI were diluted to 0.5 mg / mL with the mobile phase solution respectively.
[0574] Experimental method: Agilent HPLC 1100 chromatographic column (XBridge BEH SEC 3.5 μm, 7.8 mm I.D.×30 cm), the flow rate of Waters was set at 0.8 mL / min, the injection volume was 20 μL, and the wavelengths of the VWD detector were 280 nm and 214 nm. The blank solution, IPI quality control product solution and antibody sample solution were injected in sequence. The percentages of high molecular polymers, polypeptides and low molecular substances in the sample were calculated by the area normalization method.
[0575] The results are as Figure 17 ( Figure 17 Figure A is the SEC diagram of polypeptide A083-v2, and Figure 17B is the SEC diagram of polypeptide A083-v3) and Table 11 show that the purity of the two polypeptides is above 95%.
[0576] Table 11 Physicochemical properties of candidate polypeptides
[0577]
[0578] Example 14. Polypeptide affinity analysis
[0579] In this example, the affinity activity of the polypeptides expressed and purified in Example 12 was detected.
[0580] 14.1 Detection of the binding activity between anti-PD-L1 polypeptide and huPD-L1-Fc
[0581] In this example, the affinity activity of the polypeptides expressed and purified in Example 11 was detected based on the ELISA method.
[0582] Coat huPD-L1-Fc (2 μg / mL, 30 μL / well) on a 96-well ELISA plate and incubate overnight at 4°C. The next day, wash the wells 3 times with PBST and then block with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add serially diluted candidate polypeptide molecule A083 (cyclic peptide amino acid sequence is SEQ ID NO: 53) and positive control antibody KN035 (amino acid sequence see SEQ ID NO: 34 in the sequence listing) and incubate for 1 h. Then, after washing 3 times with PBST, add secondary antibodies Anti-VHH1+VHH2-HRP (Genescript; A01861-200, A02089), Anti-6*his-HRP (proteintech, HRP-66005), and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development result, add 2 M HCl to terminate the reaction, and read the plate at OD450 using a microplate reader (Molecular Devices, SpecterMax 190).
[0583] The results are shown in Figure 18 as follows: Candidate polypeptide A083 has good binding activity with the antigen protein huPD-L1-Fc, and the binding EC 50 is 0.9 nM.
[0584] 14.2 Affinity Kinetics Detection of Anti-PD-L1 Polypeptides
[0585] In this example, a GATOR (ProbeLife) instrument was used to detect the affinity of the polypeptide library molecules with human recombinant protein huPD-L1-Fc. The specific method is as follows:
[0586] Weigh 2g of BSA, measure 2mL of 10% Tween 20, add to 1000mL of 1×PBS, mix, adjust the pH to 7.40, make Q Buffer buffer, filter and store in aliquots. Weigh 0.38g of glycine and 4.38g of sodium chloride, add to 500mL of pure water, mix, adjust the pH to 1.75, make sensor regeneration buffer, filter and store in aliquots. The peptide was diluted to 30nM with Q Buffer buffer, and the antigen huPD-L1-Fc or huPD-L1-His was diluted 2 times with Q Buffer buffer, which were 75, 37.5, 18.8, 9.38, 4.69, and 0nM, respectively. Under light-proof conditions, the sensor (Anti-His Probes, ProbeLife, CA) was pre-wetted with Q Buffer buffer, and the sample plate (Greiner, 655209) was tested at least 10min later. After the test was correct, the preset program was performed. First, the candidate peptide or control antibody was used for binding for 120 seconds. After the binding was completed, the sensor was equilibrated in the QBuffer buffer for 30 seconds. Then, the sensor bound with the target molecule was transferred to different concentrations of antigen huPD-L1-Fc dilutions for binding for 120 seconds, and then transferred to the Q Buffer buffer. The dissociation time was 180 seconds. Finally, the K was obtained by fitting the binding and dissociation data of different concentrations of antigen and target molecule. D , K on and K off ,
[0587] The results are shown in Table 12. The KD of the candidate polypeptide molecule A083 binding to the antigen huPD-L1-Fc was 3.42E-9, and the K on is 2.34E+5, K off The affinity is 8.00E-4, which is comparable to that of the control antibody KN035.
[0588] Table 12 Affinity kinetic test results of candidate peptides
[0589] Protein Name Antigen Name KD (M) Kon (1 / Ms) Koff (1 / s) R2 Rmax (nm) A083 huPD-L1-Fc 3.42E-09 2.34E+05 8.00E-04 0.995 0.317 KN035 huPD-L1-His 9.26E-09 4.40E+04 4.08E-04 0.998 1.19
[0590] 14.3 Binding activity assay of anti-PD-L1 peptides and huPD-L1-CHO-K cells
[0591] In this example, the affinity activity of the peptide library molecules with PD-L1 overexpressing cells huPD-L1-CHO-K (a recombinant vector plasmid expressing the full-length human PD-L1 protein (Uniprot ID: Q9NZQ7) was constructed, and the constructed plasmid was introduced into CHO-K cells by electroporation) was detected by FACS method. The specific method is as follows:
[0592] The logarithmically growing huPD-L1-CHO-K cells were prepared into a single-cell suspension, and the density was adjusted to 1×10 6 cells / mL. 100 μL of the cell suspension was added to each well of a 96-well round-bottom plate, and centrifuged at 4°C and 300 g to remove the supernatant. The corresponding wells were added with serially diluted candidate polypeptide molecules and negative control antibodies, and incubated at 4°C for 60 min; centrifuged at 4°C and 300 g to remove the supernatant, then added with Anti-Human IgG, Fcγ(PE)(Jackson 109-115-098 1:300) or PE anti-His Tag(BioLegend362603 1:150), and incubated at 4°C in the dark for 30 min. After washing three times, the cells were detected by flow cytometry (Beckman, CytoFLEX AOO-1-1102).
[0593] The results were as Figure 19 shown. The EC 50 value of the candidate polypeptide molecule A083 binding to huPD-L1-CHO-K cells was 29.76 nM.
[0594] Example 15. Detection of the cell blocking activity of anti-PD-L1 polypeptides
[0595] In this example, the FACS method was used to detect the blocking activity of the polypeptide library molecules. The specific method was as follows:
[0596] The logarithmically growing huPD-L1-CHO-K cells were prepared into a single-cell suspension, and the density was adjusted to 1×10 6 cells / mL. 100 μL of the cell suspension was added to each well of a 96-well round-bottom plate, and centrifuged at 4°C and 300 g to remove the supernatant. The corresponding wells were added with serially diluted candidate polypeptide molecules, positive and negative control antibodies, and incubated at 4°C for 60 min; centrifuged at 4°C and 300 g to remove the supernatant, then 100 μL of Biotinylated PD-1ECD(25-167)-143-Biotin at a concentration of 3 μg / mL was added to each well, and incubated at 4°C for 60 min; centrifuged at 4°C and 300 g to remove the supernatant, then added with 100 μL of PE Streptavidin(Invitrogen 12-4317-087
[0597] 1:300), and incubated at 4°C for 30 min. After washing three times, the cells were detected by flow cytometry (Beckman, CytoFLEX AOO-1-1102).
[0598] The results were as Figure 20 shown. The candidate polypeptide molecule A083 had good blocking activity, and the IC 50 value was 269.4 nM.
[0599] Example 16 Affinity Maturation of Anti-PD-L1 Polypeptide and Affinity Analysis of the Polypeptide after Affinity Maturation
[0600] In this example, the polypeptide molecule that binds to PD-L1 obtained in Example 12 was subjected to affinity maturation.
[0601] 16.1 Alanine Scanning of Anti-PD-L1 Polypeptide
[0602] The A083 polypeptide screened in Example 12 was subjected to alanine scanning. The specific method is as Figure 21 shown: A083 was mutated to alanine from the first amino acid to the last amino acid. The mutated polypeptide was expressed (the specific method is the same as in Example 8), and then the expressed and purified polypeptide was subjected to ELISA activity detection (the detection method is the same as in Example 14.1). The detection results are as Figure 22 shown in A-22C. The results show that the cysteine at the 1st position, proline at the 2nd position, leucine at the 3rd position, isoleucine at the 4th position, phenylalanine at the 5th position, tyrosine at the 10th position, and cysteine at the 18th position are key amino acids related to the polypeptide activity. After these amino acids are mutated, the polypeptide hardly binds to the PD-L1 antigen protein.
[0603] 16.2 Affinity Maturation of the Polypeptide that Binds to PD-L1
[0604] The A083 polypeptide screened in Example 12 was subjected to affinity maturation. The specific method is to construct a mutation library according to the method designed in Table 13 (X uses NNK primers). Single-site saturation mutations, double-site continuous saturation mutations, triple-site continuous saturation mutations, quadruple-site continuous saturation mutations, and discontinuous multi-site mutations were constructed respectively. The mutation sites were mutated to any one of the 20 natural amino acids. The phage display polypeptide mutation library was constructed using the same library construction method as in Example 10.1. After panning and screening, 3 polypeptide molecules with matured affinity, A083-001, A083-023, and A083-196, were obtained. The cyclic peptide amino acids in the A083-001 polypeptide are shown in SEQ ID NO:54, the cyclic peptide amino acids in the A083-023 polypeptide are shown in SEQ ID NO:55, and the cyclic peptide amino acids in the A083-196 polypeptide are shown in SEQ ID NO:56.
[0605] Table 13 Construction of Mutation Library
[0606]
[0607]
[0608] 16.3 Construction, Expression, Purification and Physicochemical Property Detection of the Affinity-Matured Polypeptide Fusion Fc Protein
[0609] The affinity-matured polypeptide and the pre-affinity-matured polypeptide A083 obtained in Example 16.2 were constructed into the eukaryotic expression vector pcDNA3.4 containing the IgG1 subtype Fc sequence with the hinge region EPKSC mutated to EPKSS, expressed through the ExpiCHO transient expression system (Thermo Fisher, A29133), and affinity-purified with MabSelect SuRe LX (GE, 17547403) to finally obtain the proteins of polypeptide fusion Fc, namely A083-001-Fc (IgG1-CS), A083-023-Fc (IgG1-CS), A083-196-Fc (IgG1-CS), and A083-Fc (IgG1-CS). SDS PAGE detection was performed according to the method in Example 9, and the detection results are shown in Table 14. The SDS PAGE purity of the polypeptide fusion Fc proteins after affinity maturation was all above 95%.
[0610] Table 14 Detection of Physicochemical Properties of Polypeptide Fusion Fc Proteins after Affinity Maturation
[0611]
[0612] 16.4 ELISA Detection of Polypeptide Fusion Fc Proteins
[0613] In this example, the polypeptide fusion Fc proteins prepared in Example 16.3 were subjected to ELISA detection, and the specific method was as follows:
[0614] Coat huPD-L1-his (2 μg / mL, 30 μL / well) on a 96-well ELISA plate and incubate overnight at 4°C. The next day, wash the well plate 3 times with PBST and then block it with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add the polypeptide fusion Fc proteins prepared in Example 16.3 and incubate for 1 h. Then, after washing 3 times with PBST, add the secondary antibody Anti-Hu Fc-HRP (abcam, ab97225) and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development results, add 2 M HCl to terminate the reaction, and read the plate at OD450 using a microplate reader (Molecular Devices, SpecterMax190).
[0615] The results are as Figure 23As shown, after affinity maturation, the polypeptide-fused Fc proteins A083-001-Fc(IgG1-CS), A083-023-Fc(IgG1-CS), and A083-196-Fc(IgG1-CS) all have varying degrees of increased affinity compared to the polypeptide A083-Fc(IgG1-CS) before modification. Among them, the EC 50 of A083-196-Fc(IgG1-CS) binding to the PD-L1 antigen is 0.1375 nM, which is 17.5-fold higher than that of the polypeptide before modification.
[0616] FACS detection of 16.5 polypeptide-fused Fc proteins
[0617] In this example, the polypeptide-fused Fc protein that binds to PD-L1 obtained in Example 16.3 was subjected to FACS detection. The specific method is as follows: The logarithmically growing huPD-L1-CHO-K cells were prepared into a single-cell suspension, and the density was adjusted to 1×10 6 cells / mL, and 100 μL per well was added to a 96-well round bottom plate, centrifuged at 4°C and 300 g, and the supernatant was removed. Gradient-diluted candidate molecules and positive and negative control antibodies Anti-Goat F(ab)2 Anti-Human lgG-Fc(PE) (abcam ab98596, 1:300) were added to the corresponding wells, and incubated at 4°C in the dark for 30 min. After washing 3 times, it was detected by a flow cytometer (Beckman, CytoFLEX AOO-1-1102).
[0618] The results are as Figure 24 shown. After affinity maturation, the polypeptide-fused Fc proteins A083-001-Fc(IgG1-CS) and A083-196-Fc(IgG1-CS) both have increased affinity compared to the polypeptide A083-Fc(IgG1-CS) before modification. Among them, the EC 50 of A083-196-Fc(IgG1-CS) binding to huPD-L1-CHO K cells is 6.714 nM, which is 5-fold higher than that of the polypeptide before modification.
[0619] Example 17 Verification of fusion expression and purification of A083-196-Fc(IgG1-CS) fusion protein with PD-L1 nanobody
[0620] In this example, the VHH sequence of V20-VHH5 in the A083-196-Fc(IgG1-CS) sequence obtained in Example 16 was replaced with the VHH sequence of KN035 to verify that the fusion proteins after connecting VHH can all achieve the effect of easy purification. The protein was prepared according to the method in Example 16.3, and the results are shown in Table 15. The results show that MabSelect SuReTM LX can also purify polypeptide A083-196-KN035-Fc(IgG1-CS).
[0621] Table 15 Purification and Physicochemical Properties of A083-196-KN035-Fc(IgG1-CS)
[0622]
[0623] Example 18 Verification of the Function of Cyclic Peptide
[0624] To verify whether a cyclic peptide, a polypeptide with only 2 amino acids between two cysteines, has binding activity, in this example, the polypeptide sequence GGTYSCHFGPLTWVCKPQ of EMP1-Linker1-A20-Flag prepared in Example 3.1 was replaced with GGTCYSCHFGPLTWVCKPQ or GCGTCYSCHFGPLTWVCKPQ, and the proteins EMP1-linker1-A20-3C-Flag-his and EMP1-linker1-A20-4C-Flag-his were prepared by the method in Example 3.1.
[0625] Coat huEPOR-Fc (2 μg / mL, 30 μL / well) on a 96-well ELISA plate and incubate overnight at 4°C. The next day, wash the well plate 3 times with PBST and then block it with 5% skim milk for 2 h. After washing the plate 3 times with PBST, add the affinity-matured candidate polypeptide molecules and the pre-affinity-matured polypeptide at gradient dilutions and incubate for 1 h. Then, after washing 3 times with PBST, add the secondary antibody Anti-6*his-HRP (proteintech, HRP-66005) and incubate for 1 h. After incubation, wash the plate 6 times with PBST, add TMB (SurModics, TMBS-1000-01) for color development. According to the color development result, add 2 M HCl to terminate the reaction, and read the plate at OD450 using an enzyme-linked immunosorbent assay (ELISA) reader (Molecular Devices, SpecterMax 190).
[0626] The results are as Figure 25 shown. EMP1-linker1-A20-3C-Flag and EMP1-linker1-A20-4C-Flag have good binding to the antigen EPOR ECD-huFc, and the cyclic peptide can also bind to the antigen well.
[0627] Sequence Listing
[0628]
[0629]
[0630]
[0631]
[0632]
Claims
1. A fusion polypeptide comprising the following structure of formula (I) from the N-terminus to the C-terminus: R-(L)-V-(T)(I) wherein, R is a cyclic peptide, preferably a cyclic peptide cyclized via an intramolecular disulfide bond formed between any two cysteines within the fragment, more preferably the two cysteines forming the disulfide bond are separated by at least two amino acid residues, and most preferably the two cysteines forming the disulfide bond are separated by at least four amino acid residues; L is an optional linker; V is a single-domain antibody (VHH domain); T is an optional C-terminal tag sequence.
2. The fusion polypeptide according to claim 1, wherein, The R fragment is as described in any one of (a) and (b) below: (a) (i) It contains 8 - 19 amino acid residues; and (ii) The N-terminal first and C-terminal first amino acid residues are cysteines, and a disulfide bond (i.e., an intramolecular disulfide bond) is formed between the two cysteines; (b) (i) It contains 9 - 17 amino acid residues; and (ii) A disulfide bond (i.e., an intramolecular disulfide bond) is formed between any two cysteines, where the two cysteines forming the disulfide bond are located at any position from the 1st to the 14th position at the N-terminus and any position from the 1st to the 14th position at the C-terminus respectively, and are separated by at least two and at most fifteen amino acid residues between them, preferably the two cysteines forming the disulfide bond are located at any position from the 1st to the 12th position at the N-terminus and any position from the 1st to the 12th position at the C-terminus respectively, and are separated by at least four and at most fifteen amino acid residues between them.
3. A polypeptide library, wherein each polypeptide member comprises the following structure of formula (I) from the N-terminus to the C-terminus: R-(L)-V-(T)(I) wherein, R is a cyclic peptide, preferably a cyclic peptide cyclized via an intramolecular disulfide bond formed between any two cysteines within it, more preferably the two cysteines forming the disulfide bond are separated by at least four amino acid residues; L is an optional linker; V is a single-domain antibody (VHH domain); T is an optional C-terminal tag sequence, where each polypeptide member has a different amino acid sequence of the R fragment.
4. The polypeptide library according to claim 3, wherein, The R fragment is as described in any one of (a) and (b): (a) (i) It contains 8 - 19 amino acid residues; and (ii) The N-terminal first and C-terminal first amino acid residues are cysteines, and a disulfide bond (i.e., an intramolecular disulfide bond) is formed between the two cysteines; (b) (i) It contains 9 - 17 amino acid residues; and (ii) A disulfide bond (i.e., an intramolecular disulfide bond) is formed between any two cysteines, where the two cysteines forming the disulfide bond are located at any position from the 1st to the 14th position at the N-terminus and any position from the 1st to the 14th position at the C-terminus respectively, and are separated by at least two and at most fifteen amino acid residues between them, preferably the two cysteines forming the disulfide bond are located at any position from the 1st to the 12th position at the N-terminus and any position from the 1st to the 12th position at the C-terminus respectively, and are separated by at least four and at most fifteen amino acid residues between them.
5. A polynucleotide encoding the fusion polypeptide according to claim 1 or 2, or any polypeptide member of the polypeptide library according to claim 3 or 4.
6. A phage display library, wherein each phage particle independently contains a polypeptide having a three-dimensional structure, wherein the polypeptide is any polypeptide member of the polypeptide library according to claim 3 or 4, and the phage display library contains different amino acid sequences of the R fragment.
7. A method for constructing a phage display library for displaying cyclic peptides, comprising the following steps: (a) Obtain the polynucleotide as described in claim 3; (b) Introduce the nucleic acid fragment in (a) into the phage genome.
8. The method according to claim 7, wherein step (a) specifically comprises: (a1) Acquisition of the cyclic peptide coding fragment: Synthesize an artificial trinucleotide polynucleotide (Trimer polynucleotide) library as a template, obtain the nucleic acid sequence fragment encoding the cyclic peptide fragment by PCR amplification, and then recover the above product fragment as the cyclic peptide coding fragment, for example, by agarose gel electrophoresis; (a2) Obtaining single-domain antibody-encoding fragments: The polynucleotide fragment encoding the single-domain antibody is obtained by gene synthesis as the single-domain antibody-encoding fragment, or used as a template to obtain more identical nucleic acid sequence fragments by PCR amplification, and recovered and purified as the single-domain antibody-encoding fragment, for example, by agarose gel electrophoresis; (a3) Linking the two encoding fragments obtained in (a1) and (a2) into a full-length single polynucleotide, for example, by a ligation reaction or a fusion PCR reaction.
9. A method for selecting a cyclic peptide that binds to a desired target, the method comprising the steps of: (a) contacting the phage display library of claim 6 with a specific target molecule, (b) screening the phage particles for the desired target, wherein the result of the screening is the selection of phage particles having a cyclic peptide that binds to the desired target; and (c) identifying the amino acid sequence of the cyclic peptide of the selected phage particles.
10. An immunoglobulin heavy chain variable domain single domain (VHH) or an antigen-binding fragment thereof that specifically binds to human serum albumin (HSA), which comprises CDR1-3 of the VHH domain having an amino acid sequence as shown in any one of SEQ ID NOs: 9-21.
Citation Information
Patent Citations
An IgG1 Fc monomer and its application
CN109705211B
Antibodies targeting SARS-CoV-2 coronavirus and their diagnostic and diagnostic uses
CN112250763B
Stabilized single domain antibodies
WO2004041865A2
Antibody compositions and methods
WO2005035572A2