Application of rhein in preparation of medicine for inhibiting activity of glucocorticoid receptor

Abstract

The invention discloses an application of rhein in a medicine for inhibiting the activity of a glucocorticoid receptor, the rhein is associated with the glucocorticoid for the first time, and it is found that the rhein achieves the effect of inhibiting the activity of the glucocorticoid receptor by regulating and controlling the glucocorticoid receptor to convert co-activated molecules arginine and glutamic acid rich protein 1 (ARGLU1). Therefore, a basis can be provided for applying the rhein to the preparation of the medicine for inhibiting the activity of the glucocorticoid receptor, and the rhein can achieve an obvious improvement effect on anxiety caused by high-glucocorticoid including corticosterone. Rheinic acid can increase the browning degree of brown fat of mice and UCP1 expression and can induce fat browning, and in combination with mouse experiment results, it is shown that the rheinic acid increases energy consumption of organisms and reduces the body fat content, so that application of the rheinic acid in resisting obesity and improving metabolic syndromes caused by obesity has a prospect, and the rheinic acid can be used for preparing medicines for resisting obesity and improving metabolic syndromes caused by obesity. And more directions are provided for further development and application of the rhein.

Description

Technical Field

[0001] The present invention relates to the field of pharmaceutical technology, and particularly to the application of rhein in the preparation of drugs for inhibiting the activity of glucocorticoid receptors. Background Art

[0002] Glucocorticoids, also known as glucocorticosteroids, are a class of adrenal cortical hormones secreted by the zona fasciculata of the adrenal cortex. They are steroid hormones that regulate the biosynthesis and metabolism of carbohydrates, fats, and proteins, and also have effects on immune response, anti-inflammation, anti-toxicity, and anti-shock. Rhein (4,5-dihydroxyanthraquinone) belongs to anthraquinone derivatives and is mainly distributed in plants of the Polygonaceae family. It is an active ingredient and a marker ingredient in many traditional Chinese medicines such as rhubarb, polygonum multiflorum, and giant knotweed. Modern research shows that rhein has effects such as anti-inflammation, antioxidant, anti-arteriosclerosis, lipid regulation, and immune regulation. Rhein is gradually being applied in the fields of Chinese patent medicine preparations, health care products, and hygiene products, with wide applications. However, there has been no research on the association between rhein and glucocorticoids so far. Summary of the Invention

[0003] Based on the above background, the present invention provides a new application of rhein in the preparation of drugs for inhibiting the activity of glucocorticoid receptors. Through experimental research, it is found that rhein can inhibit the activity of glucocorticoid receptors by regulating the glucocorticoid receptor-transforming coactivator arginine and glutamate-rich protein 1 (ARGLU1), providing more directions for the further development of the application of rhein.

[0004] The technical solution provided by the present invention is as follows:

[0005] One of the technical solutions of the present invention is:

[0006] The application of rhein in the preparation of drugs for inhibiting the activity of glucocorticoid receptors.

[0007] Furthermore, the drug for inhibiting the activity of glucocorticoid receptors contains an effective amount of rhein, and rhein is the sole active ingredient.

[0008] Another technical solution of the present invention is: the application of rhein in the preparation of preparations for improving or preventing cognitive dysfunction or anxiety caused by high glucocorticoids.

[0009] Furthermore, the glucocorticoid is corticosterone.

[0010] Furthermore, the preparation contains an effective amount of rhein, and rhein is the sole active ingredient.

[0011] The third technical solution of the present invention is: the application of rhein in the preparation of drugs for preventing and treating diseases caused by glucocorticoid level disorders.

[0012] Furthermore, the drug contains an effective amount of rhein, and rhein is the only active ingredient.

[0013] The fourth technical solution of the present invention is that the drug contains an effective amount of rhein, and rhein is the only active ingredient.

[0014] The fifth technical solution of the present invention is the application of rhein in the preparation of a preparation for preventing and treating obesity or metabolic syndrome caused by obesity.

[0015] Furthermore, the preparation contains an effective amount of rhein, and rhein is the only active ingredient.

[0016] Rhein inhibits the activity of glucocorticoid receptor by regulating the glucocorticoid receptor-transforming coactivator arginine and glutamate-rich protein 1 (ARGLU1).

[0017] The beneficial effects achieved by the present invention are as follows:

[0018] The present invention first associates rhein with glucocorticoids. Through experimental research, it is found that rhein inhibits the activity of glucocorticoid receptor by regulating the glucocorticoid receptor-transforming coactivator arginine and glutamate-rich protein 1 (ARGLU1). This can provide a basis for the application of rhein in the preparation of drugs that inhibit the activity of glucocorticoid receptor. And through mouse experiments, it is also verified that rhein can significantly improve the anxiety caused by high glucocorticoids including corticosterone.

[0019] And the present invention also proves through mouse experiments that rhein can increase the degree of brownization of brown fat and the expression of UCP1 in mice, and can induce the brownization of fat. Based on this, the present invention provides a new direction for the development of preparations for activating brown fat. And combined with the mouse experimental results, it shows that rhein increases the energy consumption of the body and reduces the body fat content. Therefore, the application of rhein in anti-obesity and improving metabolic syndrome caused by obesity is promising, and provides more directions for the further development and application of rhein. Description of the Drawings

[0020] Appendix Figure 1 This is the energy metabolism status of the control group mice (Veh) and rhein intervention group mice (Rhein) in the embodiment of the present invention.

[0021] Appendix Figure 2 This is the degree of brownization of fat in the control group mice (Veh) and rhein intervention group mice (Rhein) in the embodiment of the present invention.

[0022] Appendix Figure 3Expression of UCP1 in control group mice (Veh) and Rhein - intervened group mice in the embodiments of the present invention.

[0023] Appendix Figure 4 Expression of UCP1 in primary brown adipocytes of mice in the embodiments of the present invention (p < 0.05).

[0024] Appendix Figure 5 Activity of glucocorticoid receptor in brown adipose tissue of mice in the embodiments of the present invention (*p < 0.05).

[0025] Appendix Figure 6 Activity of glucocorticoid receptor in primary brown adipocytes of mice in the embodiments of the present invention (*p < 0.05).

[0026] Appendix Figure 7 Activity of glucocorticoid receptor in brown adipocytes of mice in the embodiments of the present invention.

[0027] Appendix Figure 8 Expression of UCP1 in brown adipocytes of mice in the embodiments of the present invention.

[0028] Appendix Figure 9 Results of open - field test of mice in the embodiments of the present invention. Detailed implementation manners

[0029] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0030] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified.

[0031] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0032] Example 1: Verification by mouse experiment

[0033] Six-week-old normal male C57BL / 6 mice (purchased from Jicuiyaokang, with the experimental animal production license SYXK (Su) 2023-0009 and the experimental animal use license SYXK (Su) 2023-0036) were randomly divided into two groups, namely the blank control group and the rhein intervention group, with 5-6 mice in each group. Each group of mice was fed a high-fat diet, and at the same time, the rhein intervention group was intragastrically administered with rhein. 120 mg of rhein was added to 10 ml of 1% sodium carboxymethylcellulose and intragastrically administered according to 120 mg / kg per day; the blank control group was intragastrically administered with the same volume of 1% sodium carboxymethylcellulose as a placebo for a total of 8 weeks. The high-fat diet was from Research Diets. The body weight and food intake of the mice were measured weekly. After 8 weeks of intervention, by Figure 1 It can be seen that the body weight of the mice in the rhein intervention group was significantly lower than that of the control group. There was no significant difference in the food intake between the two groups.

[0034] The relevant indicators of the mice in the blank control group and the rhein intervention group were detected, and the results are as follows:

[0035] (1) After 8 weeks of intervention, an animal energy metabolism detection system (CLAMS, Columbus Instruments, USA) was used to detect the overall energy metabolism level of the mice. Specific conditions were set through CLAMS to accurately measure the activities, respiration, body weight, food intake, urine, body temperature, heart rate, etc. of the mice. The energy metabolism status of the mice was comprehensively evaluated according to indicators such as oxygen consumption (VO2) and respiratory exchange ratio (RER). The results showed that compared with the control group, the VO2 values of the mice in the rhein intervention group were significantly increased at night and during the day, the RER value at night was significantly increased, while there was no significant change in the RER value between the two groups during the day. Combining Figure 1 Overall, it can be seen that rhein can increase the oxygen consumption of the body and reduce the body weight of obese mice.

[0036] (2) The visceral white fat and brown fat of the scapula of the mice were scanned using a 9.4T high-field small animal magnetic resonance (Bruker BioSpec 94 / 30USR small animal magnetic resonance, abbreviated as 9.4T MRI), and the results are shown in Figure 2 .

[0037] Transmitting coil: A mouse transmitting volume coil with an inner diameter of 86 mm.

[0038] Receiving coil: A mouse body coil.

[0039] Specific method: Isoflurane inhalation anesthetic was used for anesthesia, and the anesthetic concentration was adjusted according to the respiration or heart rate to make the animal enter deep anesthesia as much as possible. An animal physiological detector (SA Instruments, Inc, USA) was used to monitor the respiratory rate in real time, and a water-heat circulation system (ThermoFisher scientific, USA) was used to maintain the body temperature at about 37°C.

[0040] The brown adipose tissue (BAT) and visceral white adipose tissue (WAT) of mice were scanned using T1-weighted imaging. The specific scanning parameters were as follows: repetition time: 800 ms; echo time: 6 ms; number of repeated acquisitions: 2; field of view: 24 mm × 37.5 mm; matrix: 256 × 256; number of layers: 25; slice thickness: 0.8 mm for BAT and 1.6 mm for WAT.

[0041] It can be seen that Figure 2 compared with the control group, the content of white adipose tissue in the rhein intervention group of mice was significantly reduced, and the degree of brownization of brown adipose tissue was significantly enhanced.

[0042] (3) The brown adipose tissue of the scapula of rhein and control group mice was isolated, and the expression of UCP1 was detected by Western blot. The results are shown in Figure 3 . The specific method is as follows: RIPA lysis buffer was added to the brown adipose tissue. According to the ratio of adding 100 μL of lysis buffer per 10 mg of tissue, a homogenizer was used to homogenize the tissue. After thorough lysis, it was centrifuged at 10,000 g for 3 - 5 min, and the supernatant was taken. A small amount of the liquid was taken for protein quantification (BCA protein assay kit, Thermo Scientific), and the loading volume of each sample was determined according to the total amount of protein required. After adding Loading Buffer to the sample, it was boiled at 95 °C for 5 minutes and then loaded onto the gel. Different molecular weight proteins were separated by denaturing gel SDS-PAGE. Then it was transferred to a solid-phase carrier PVDF membrane, and then blocked with skim milk as a blocking solution. The PVDF membrane was incubated with the primary antibody dilution overnight, and the next day it was eluted 4 times with TBST eluent, 15 minutes each time. The PVDF membrane was incubated with the corresponding HRP-labeled secondary antibody for one hour and then eluted 4 times with TBST, 15 minutes each time. ECL luminescent solution was used for color development, and the chemiluminescence instrument was used to visualize the bands of the target protein.

[0043] It can be seen that Figure 3 compared with the control group, the expression of UCP1 in the brown adipose tissue of the rhein intervention group of mice was significantly increased.

[0044] (4) Primary brown preadipocytes were isolated from UCP1 luciferase mice (Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences).

[0045] First, the mice were anesthetized and sacrificed, and then the brown adipose tissue was taken out under sterile conditions. The tissue was minced into tissue blocks less than 1 mm with tissue scissors, placed in a 37 °C water bath and gently shaken, and digested with type I collagenase (1 mg / ml) for 1 hour. The digest was filtered through a 100 μm nylon cell sieve. The flow-through was allowed to stand at room temperature for 10 minutes and then centrifuged (800 g, 10 minutes).

[0046] Separate the upper floating cells (mature adipocytes) and the lower aggregated cells (vascular stromal cells), wash them twice with phosphate buffer respectively, isolate the stromal vascular fraction (SVF), and differentiate it into mature brown adipocytes in vitro using a standard induction protocol.

[0047] Intervene with different concentrations (5 μM, 10 μM) of rhein, and detect the expression of UCP-1 in brown adipocytes by luciferase activity assay. The results are shown in Figure 4 . As Figure 4 shown, rhein can significantly promote the expression of UCP1 in brown adipocytes and activate the brown adipose tissue of mice.

[0048] (5) Isolate the scapular brown adipose tissue of mice in the rhein intervention group and the blank control group, and measure the glucocorticoid receptor activity in the brown adipose tissue by ELISA method.

[0049] The specific method is as follows: Extract the nuclear protein of brown tissue using a nuclear protein extraction reagent (Active Motif), and detect the glucocorticoid receptor activity using a TransAM kit (Active Motif). Meanwhile, isolate the primary brown preadipocytes of C57BL / 6 male mice, differentiate them into mature brown adipocytes in vitro (the method is the same as above), intervene with rhein (30 μM), and detect the glucocorticoid receptor activity of the cells. The method is the same as above. The results are shown in Figure 5 and 6 . As Figure 5 and 6 shown, rhein can significantly inhibit the glucocorticoid receptor activity in brown adipose tissue.

[0050] (6) Arginine and glutamate-rich protein 1 (ARGLU1), as a glucocorticoid receptor-transforming coactivator molecule, participates in regulating the biosynthesis and metabolism of sugars, fats, and proteins. Therefore, based on ARGLU1 being a glucocorticoid receptor-transforming coactivator molecule, Genewiz constructed an ARGLU1 overexpression lentivirus (80-548449638, ARGLU1: A 313T102C 210G 263|GC%: 53.27%|Length: 888): GAATTCATGGACTACAAAGACGATGACGACAAGGT CGAGCACCACCACCACCACCACCACCACGGCCGGTCTCGGAGCCGGAGCTCGTCCCGCTCCAAGCACACCAAGAGCAGCAAGCACAACAAGAAGCGCAGCCGGTCCCGGTCGCGATCCCGGGACAAGGAGCGCGTGCGGAAGCGTTCCAAATCTCGGGAAAGTAAACGGAACCGGCGGCGGGAGTCGCGGTCCCGTTCGCGCTCCACCAACACGGCCGTGTCCCGGCGCGAGCGGGACCGGGAGCGCGCCTCGTCCCCGCCCGACCGCATCGACATCTTCGGGCGCACGGTGAGCAAGCGCAGCAGCCTGGACGAGAAGCAGAAGCGAGAGGAGGAGGAGAAGAAAGCGGAGTTCGAGCGGCAGCGAAAAATTCGACAGCAAGAAATAGAAGAAAAACTCATCGAGGAAGAAACAGCACGAAGAGTAGAAGAATTGGTAGCAAAAAGGGTGGAGGAAGAACTGGAGAAAAGGAAGGATGAAATTGAACGAGAAGTTCTCCGAAGGGTGGAGGAAGCCAAACGCATCATGGAAAAGCAGTTGCTCGAAGAACTCGAGCGACAGAGACAAGCTGAGCTTGCCGCACAAAAAGCTAGAGAGGAGGAAGAACGTGCAAAACGTGAGGAGCTAGAGCGAATACTGGAAGAGAATAACCGAAAAATTGCAGAAGCACAAGCCAAACTGGCCGAAGAACAGTTGAGAATTGTTGAAGAACAAAGAAAGATTCATGAGGAAAGGATGAAACTAGAACAAGAACGACAACGTCAACAAAAAGAAGAACAAAAAATTATCCTGGGCAAGGGGAAGTCCAGGCCAAAACTGTCCTTCTCATTAAAAACCCAGGATTAAGAATTC), and transfected into in vitro differentiated and mature brown adipocytes as the ARGLU1 group; and transfected in vitro differentiated and mature brown adipocytes with a blank vector as the blank vector control group; detected glucocorticoid receptor activity using the TransAM kit, with the method the same as before, and the results are shown in...Figure 7 It can be seen that, compared with the empty vector control group, overexpression of ARGLU1 can significantly increase the activity of glucocorticoid receptor. Figure 7 It can be seen that, compared with the empty vector control group, overexpression of ARGLU1 can significantly increase the activity of glucocorticoid receptor.

[0051] On this basis, cells in the ARGLU1 group and the empty vector control group were intervened with rhein (0 / 10 μM / 30 μM) in vitro, and the expression of UCP1 was detected by Western blot method, with the method the same as before. The results are shown in Figure 8 It can be seen that Figure 8 in the empty vector control group, rhein can significantly increase the expression of UCP1 in brown adipocytes in a dose-dependent manner. While in the ARGLU1 overexpression group, there was no significant difference in the expression of UCP1 between the rhein group and the non-intervened group. Rhein inhibits the activity of glucocorticoid receptor by regulating ARGLU1 and activates brown fat.

[0052] Example 2:

[0053] Hypercortisolism is one of the causes of cognitive decline. Long-term GC exposure can act on neurons in different regions of the brain through glucocorticoid receptors, causing nerve cell damage and dendritic atrophy, reducing hippocampal neurogenesis, and aggravating the occurrence of chronic degenerative diseases such as Alzheimer's disease.

[0054] Six-week-old normal C57BL / 6 male mice (purchased from Jicui Yaokang, experimental animal production license SYXK (Su) 2023-0009, experimental animal use license SYXK (Su) 2023-0036) were randomly divided into three groups, namely the blank control group, the corticosterone model group, and the rhein intervention group, with 5-6 mice in each group. The corticosterone and rhein groups were given corticosterone intervention. 5 mg of corticosterone was added to 100 ml of pure water and fed by drinking water for 8 weeks. The rhein group was simultaneously given rhein intervention. 120 mg of rhein was added to 10 ml of 1% sodium carboxymethylcellulose and gavaged at 120 mg / kg per day; the blank control group was gavaged with the same volume of 1% sodium carboxymethylcellulose as a placebo and fed with pure water by drinking water for a total of 8 weeks. After 8 weeks, the open field test was performed on the three groups of mice to evaluate the anxiety state and spontaneous activity of the mice. The results are shown in Figure 9。The open field test is a method for evaluating the anxiety behavior, exploratory behavior, and locomotor activity of experimental animals in a novel environment. In a quiet environment with appropriate light, temperature, and humidity, the animals are first allowed to acclimatize to the experimental environment for 30 minutes. After the experiment starts, the mice are placed in a corner of the bottom surface of an open field response box with a height of 40 cm and a bottom side length of 50 cm. The total movement distance, movement speed, stationary time, number of contacts with the center, and the time spent staying in the center of the open field of the mice are observed through a camera above the open field response box within 5 minutes. The experimental equipment is cleaned with 75% ethanol between two experiments to avoid the remaining odor of the previous experimental mouse affecting the experimental results of the next mouse. After the experiment, all the animals are returned to the breeding cages, and the animals are allowed to eat and drink freely. The results are shown in Figure 9 。It can be seen from Figure 9 that, compared with the control group, the total movement distance and average speed of the mice in the corticosterone group were significantly reduced, the number of contacts with the center decreased, and the time spent staying in the center was shortened. After rhein intervention, the total movement distance could be significantly increased, the average speed could be increased, the number of contacts with the center could be increased, and the time spent staying in the center could be prolonged. It is suggested that rhein can significantly improve the anxiety state of hypercorticosteronemic mice and enhance the spontaneous activity ability.

[0055] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Application of rhein in the preparation of drugs for inhibiting glucocorticoid receptor activity.

2. The use according to claim 1, characterized in that: The glucocorticoid receptor activity inhibitory drug contains an effective amount of rhein, and rhein is the only active ingredient.

3. The use of rhein in the preparation of preparations for improving or preventing cognitive dysfunction or anxiety caused by high glucocorticoids.

4. The use according to claim 3, characterized in that: The glucocorticoid is corticosterone.

5. The use according to claim 3 or 4, characterized in that: The preparation contains an effective amount of rhein, which is the only active ingredient.

6. Use of rhein in the preparation of drugs for preventing and treating diseases caused by imbalance of glucocorticoid levels.

7. The use according to claim 6, characterized in that: The medicine contains an effective amount of rhein, which is the only active ingredient.

8. Application of rhein in the preparation of brown fat activator.

9. Use of rhein in the preparation of preparations for preventing and treating obesity or metabolic syndrome caused by obesity.

10. The use according to claim 9, characterized in that: The preparation contains an effective amount of rhein, which is the only active ingredient.

Images