Neutral homogeneous prinsepia utilis royle polysaccharide as well as preparation method and application thereof

By developing neutral homogeneous polysaccharides in Qingtao, the problems of skin itching and barrier damage have been solved, and the skin itching symptoms are soothed and the skin barrier repair has been achieved. It is suitable for a variety of skin diseases and skin care products.

CN120209172AActive Publication Date: 2025-06-27YUNNAN YUNKE CHARACTERISTIC PLANT EXTRACTION LABORATORY CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510611328.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-06-27
Estimated Expiration
2045-05-13

AI Technical Summary

Technical Problem

The prior art is difficult to effectively solve the problems of skin itching and barrier damage, especially in chronic itching diseases such as atopic dermatitis and psoriasis, which lacks a safe, non-irritating and efficient skin anti-it-it-agent agent.

Method used

A neutral homogeneous polysaccharide of cypress is developed, formed by specific glycosidic bond linkages, which can relieve skin itching symptoms and repair skin barriers. This polysaccharide reduces itching and inflammatory responses by inhibiting the expression of inflammatory factors induced by substance P, and improves skin barrier function by promoting the proliferation and migration of keratinocytes.

Benefits of technology

The neutral homogeneous polysaccharide of the green thyroid fruit significantly inhibits the symptoms of skin itching induced by substance P and has a good skin barrier repair effect. It is suitable for the treatment of skin diseases such as atopic dermatitis and psoriasis, as well as skin protective agents that promote wound healing and are used in cosmetics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120209172A_ABST
    Figure CN120209172A_ABST
Patent Text Reader

Abstract

The invention discloses prinsepia utilis royle neutral homogeneous polysaccharide with biological activity as well as a preparation method and application of the prinsepia utilis royle neutral homogeneous polysaccharide. Specifically, the prinsepia utilis royle neutral homogeneous polysaccharide (PURP-A1) with a clear structure is separated and identified for the first time, and the molecular structure characteristics of the prinsepia utilis royle neutral homogeneous polysaccharide are clarified. Experimental studies show that the polysaccharide can significantly inhibit P substance induced skin inflammation, and shows good application prospects in treatment of pruritic skin diseases, neurogenic inflammation and immune skin diseases. In addition, the polysaccharide also has the effect of promoting proliferation and migration of human keratinocytes, and can significantly accelerate wound healing and skin repair processes. Based on the multiple pharmacological effects, the prinsepia utilis royle neutral homogeneous polysaccharide provided by the invention has important application value in the aspects of developing wound repair products and anti-inflammatory and antipruritic drugs and solving the problems of sensitive skin itch and stabbing pain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a neutral homogeneous polysaccharide from Prinsepia utilis Royle, a preparation method thereof, and an application thereof. Background Art

[0002] Skin pruritus is the core symptom of various skin diseases. The troubles it brings are not limited to physical discomfort, but also deeply affect the psychology, social interaction, and quality of life of patients. Long-term scratching easily damages the skin barrier, further increasing the penetration of irritants and nerve exposure, exacerbating skin sensitivity, and forming a "sensitivity-itching" vicious cycle. Therefore, there is an urgent need to find a safe, non-irritating, and highly effective skin antipruritic agent.

[0003] Substance P is a neuropeptide widely distributed in the central and peripheral nervous systems. In skin diseases, Substance P participates in the pathological processes of various diseases by activating the neurogenic inflammation pathway. In chronic pruritic diseases such as atopic dermatitis and psoriasis, Substance P can enhance the transmission of itching signals and promote inflammation; in addition, Substance P can also stimulate immune cells, promote the release of inflammatory factors, and exacerbate allergic reactions. Therefore, the skin disease model induced by Substance P is widely used in the research of chronic pruritus, neurogenic inflammation, and allergic skin.

[0004] Plant polysaccharides are a class of macromolecular compounds formed by monosaccharide molecules through glycosidic bonds. Due to their excellent effects and high safety, they have received increasing attention in the field of health products. However, the structures of plant polysaccharides are complex and diverse, and the research is difficult. However, the structure of polysaccharides is closely related to their biological activities, and the change of chain conformation will inevitably affect the efficacy of polysaccharides.

[0005] Prinsepia utilis Royle is a traditional folk medicinal plant with pharmacological activities such as antioxidant and immune enhancement, and has great development value. CN104510668A discloses a moisturizing composition, and its moisturizing active ingredients at least include Prinsepia utilis Royle oil and Prinsepia utilis Royle polysaccharide, and the Prinsepia utilis Royle polysaccharide is a crude polysaccharide after ethanol precipitation. The structure of polysaccharides is closely related to their biological activities. To promote better industrial application, developing a neutral homogeneous polysaccharide from Prinsepia utilis Royle with a clear structure and capable of solving skin pruritus and barrier damage problems can promote the upgrading and development of the industrial chain, and provide a more reliable material basis and technical support for industrial applications in the fields of medicine, cosmetics, etc. Summary of the Invention

[0006] To solve the above technical problems, the present invention provides a neutral homogeneous polysaccharide from Prinsepia utilis Royle, a preparation method thereof, and an application thereof. The neutral homogeneous polysaccharide from Prinsepia utilis Royle has a clear structure, can relieve skin pruritus symptoms, and at the same time has a skin barrier repair function, and can solve skin problems from the aspects of inhibiting itching-barrier repair.

[0007] To achieve this goal, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a neutral homogeneous polysaccharide from Prinsepia utilis Royle, and the structure of the neutral homogeneous polysaccharide from Prinsepia utilis Royle is as follows:

[0009]

[0010] Preferably, the neutral homogeneous polysaccharide from Prinsepia utilis Royle is composed of sugar residues linked together, and the sugar residues include →4)-α-D-Glcp-(1→, →5)-α-L-Araf-(1→, α-L-Araf-(1→, →4,6)-α-D-Glcp-(1→, and →6)-α-D-Glcp-(1→.

[0011] Preferably, the molecular weight of the neutral homogeneous polysaccharide from Prinsepia utilis Royle is 15 kDa - 20 kDa (for example, it can be 15 kDa, 16 kDa, 17 kDa, 18 kDa, 19 kDa, 20 kDa, etc.).

[0012] Preferably, the total sugar content of the neutral homogeneous polysaccharide from Prinsepia utilis Royle > 90% (for example, it can be 91%, 92%, 93%, 94%, 95%, 96%, 98%, etc.).

[0013] In a second aspect, the present invention provides a preparation method of the neutral homogeneous polysaccharide from Prinsepia utilis Royle according to the first aspect, and the preparation method includes the following steps:

[0014] (1) Heat and reflux extract Prinsepia utilis Royle, concentrate the obtained extract, and add ethanol for alcohol precipitation to obtain the crude polysaccharide from Prinsepia utilis Royle.

[0015] (2) Separate and elute the crude polysaccharide from Prinsepia utilis Royle obtained in step (1) with an ion exchange cellulose chromatography column to obtain the neutral polysaccharide fraction from Prinsepia utilis Royle.

[0016] (3) Separate and elute the neutral polysaccharide fraction from Prinsepia utilis Royle obtained in step (2) with a Sephadex gel chromatography column, collect the eluate, and obtain the neutral homogeneous polysaccharide from Prinsepia utilis Royle.

[0017] Preferably, in step (1), the operation before extraction further includes pressing oil from Prinsepia utilis Royle, and heating and reflux extracting the Prinsepia utilis Royle oil cake obtained after pressing oil.

[0018] Preferably, in step (1), the extraction solvent includes water.

[0019] Preferably, in step (1), the material-liquid ratio for extraction is 1 g:(5 - 15) mL, for example, it can be 1 g:7 mL, 1 g:9 mL, 1 g:11 mL, 1 g:13 mL, etc.

[0020] Preferably, in step (1), the number of extractions is 1 - 3 times, for example, it can be 1 time, 2 times, or 3 times, and the time for each extraction is 1 - 3 h, for example, it can be 1.2 h, 1.5 h, 2 h, 2.5 h, 2.8 h, etc.

[0021] Preferably, ethanol is added to a volume concentration of 75 - 85%, for example, it can be 76%, 78%, 80%, 82%, 84%, etc.

[0022] Preferably, after adding ethanol, operations such as cooling precipitation and centrifugation are also included.

[0023] Preferably, the temperature for cooling precipitation is 2 - 8°C, for example, it can be 3°C, 4°C, 5°C, 6°C, 7°C, etc.

[0024] Preferably, the rotation speed for centrifugation is 3000 - 4000 r / min, for example, it can be 3100 r / min, 3200 r / min, 3400 r / min, 3600 r / min, 3800 r / min, 3900 r / min, etc., and the time for centrifugation is 10 - 20 min, for example, it can be 12 min, 14 min, 16 min, 18 min, etc.

[0025] Preferably, in step (2), the anion exchange gel chromatography column includes an anion exchange gel DEAE - 52 chromatography column.

[0026] Preferably, in step (2), the solvent used for elution includes water.

[0027] Preferably, in step (3), the Sephadex gel chromatography column includes a Sephadex gel G - 100 chromatography column.

[0028] Preferably, in step (3), the solvent used for elution includes water.

[0029] Preferably, the preparation method includes the following steps:

[0030] (1) The defatted Prinsepia utilis Royle oil cake after oil pressing is subjected to heating reflux extraction, the extraction solvent is distilled water, concentrated under reduced pressure, ethanol is added for alcohol precipitation, the final volume concentration of ethanol is 85%, stirred, precipitated overnight, and the precipitate is collected by centrifugation to obtain crude Prinsepia utilis Royle polysaccharide;

[0031] (2) The crude polysaccharide of Prinsepia utilis Royle obtained in step (1) is redissolved with distilled water, centrifuged, and the supernatant is loaded onto an anion exchange gel DEAE-52 packing material. Distilled water is used as the elution solvent, and a total of 4 BV is eluted. Detection is carried out by the sulfuric acid-phenol method. The absorbance is measured at 490 nm and an elution curve is plotted. The eluents corresponding to the elution peaks are combined and freeze-dried to obtain the neutral polysaccharide fraction of Prinsepia utilis Royle.

[0032] (3) The neutral polysaccharide fraction of Prinsepia utilis Royle obtained in step (2) is redissolved with distilled water, filtered, and Sephadex G100 is used as the separation packing material. The eluent is distilled water. Detection is carried out by the sulfuric acid-phenol method. The absorbance is measured at 490 nm and an elution curve is plotted. The eluents corresponding to the elution peaks are combined and freeze-dried to obtain the neutral homogeneous polysaccharide of Prinsepia utilis Royle.

[0033] Thirdly, the present invention provides an application of the neutral homogeneous polysaccharide of Prinsepia utilis Royle as described in the first aspect in the preparation of a skin antipruritic agent product.

[0034] Preferably, the skin antipruritic agent is used for the preparation of drugs for treating atopic dermatitis, psoriasis, and neurodermatitis.

[0035] Fourthly, the present invention provides an application of the neutral homogeneous polysaccharide of Prinsepia utilis Royle as described in the first aspect in the preparation of a product for promoting wound healing.

[0036] Fifthly, the present invention provides an application of the neutral homogeneous polysaccharide of Prinsepia utilis Royle as described in the first aspect in the preparation of cosmetics.

[0037] Preferably, the cosmetics include a skin protectant having the functions of relieving the itching and stinging symptoms of sensitive skin and promoting skin barrier repair. The skin protectant includes the neutral homogeneous polysaccharide of Prinsepia utilis Royle as described in the first aspect.

[0038] Compared with the prior art, the present invention has at least the following beneficial effects:

[0039] (1) The present invention provides a neutral homogeneous polysaccharide of Prinsepia utilis Royle, its structure and application. This polysaccharide is connected by specific glycosidic bonds, can inhibit the skin itching symptoms induced by substance P, has good therapeutic potential for pruritic skin diseases, neurogenic inflammation, and immune skin diseases. At the same time, it can promote the proliferation and migration effects of human keratinocytes, and has high application value in the preparation of products related to promoting wound healing and skin repair. In addition, the neutral homogeneous polysaccharide of Prinsepia utilis Royle provided by the present invention can be applied to the itching of sensitive skin and the symptoms of damaged skin barrier, and can provide a treatment plan from the aspects of inhibiting skin itching and strengthening the skin barrier.

[0040] (2) The preparation method of the neutral homogeneous polysaccharide from Prinsepia utilis Royle provided by the present invention uses ion exchange cellulose and Sephadex for multiple separation and purification. There are zero organic reagents throughout the process, which is more environmentally friendly and safe. Moreover, the preparation method is simple, has strong universality and good application prospects. And through the technical means provided by the present invention, a neutral homogeneous polysaccharide from Prinsepia utilis Royle with a narrow distribution can be obtained, which is convenient for elucidating the structure of the active polysaccharide from Prinsepia utilis Royle. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 It is the chromatogram of monosaccharide composition of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle.

[0042] Figure 2 It is the Fourier transform infrared spectrum of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle.

[0043] Figure 3 It is the molecular weight distribution diagram of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle.

[0044] Figure 4 It is the total ion current chromatogram of methylation analysis GC-MS of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle.

[0045] Figure 5 It is the one-dimensional nuclear magnetic 1 1H spectrum of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in Example 2.

[0046] Figure 6 It is the one-dimensional nuclear magnetic 13 13C spectrum of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in Example 2.

[0047] Figure 7 It is the two-dimensional nuclear magnetic COSY spectrum of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in Example 2.

[0048] Figure 8 It is the two-dimensional nuclear magnetic HMBC spectrum of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in Example 2.

[0049] Figure 9 It is the two-dimensional nuclear magnetic HSQC spectrum of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in Example 2.

[0050] Figure 10 It is the two-dimensional nuclear magnetic NOESY spectrum of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in Example 2.

[0051] Figure 11 It is the inhibitory effect diagram of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle on substance P-induced TNF-α in Example 3.

[0052] Figure 12It is the inhibitory effect diagram of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle on substance P-induced IL-6 in Example 3.

[0053] Figure 13 It is the inhibitory effect diagram of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle on substance P-induced IL-8 in Example 3.

[0054] Figure 14 It is the inhibitory effect diagram of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle on substance P-induced INF-γ in Example 3.

[0055] Figure 15 It is the cell scratch repair effect diagram of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in Example 4. Detailed implementation manners

[0056] The technical solution of the present invention will be further described below in conjunction with the accompanying drawings and through specific implementation manners. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of the patent protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0057] Prinsepia utilis Royle is from Haba Snow Mountain in Yunnan;

[0058] Human keratinocytes (HaCaT) are from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences.

[0059] Example 1

[0060] This example provides a neutral homogeneous polysaccharide from Prinsepia utilis Royle and its preparation method. The preparation method includes the following steps:

[0061] (1) Preparation of crude polysaccharide from Prinsepia utilis Royle: The oil cake of Prinsepia utilis Royle after oil extraction is subjected to heat reflux extraction at a solid-liquid ratio of 1:10 (g / mL). The extraction solvent is distilled water, and the extraction time is 2 h. The extraction is carried out twice. The two extraction liquids are combined and concentrated under reduced pressure until the concentrated weight is 1 / 5 of the initial weight. The obtained concentrated liquid is slowly added with ethanol until the final ethanol concentration is 85%. Stir for 2 h to allow the concentrated liquid to fully contact with ethanol. Stand overnight at 4 °C. After the precipitate is fully precipitated, centrifuge (3500 r / min) for 10 min, collect the precipitate, and freeze-dry to obtain the crude polysaccharide from Prinsepia utilis Royle;

[0062] (2) Ion exchange chromatography of the neutral homogeneous polysaccharide fraction of Prinsepia utilis Royle: The crude polysaccharide of Prinsepia utilis Royle obtained in step (1) was redissolved with distilled water, centrifuged, and the supernatant was loaded onto an anion exchange gel DEAE-52 filler at a loading concentration of 1:50 (g / mL). Distilled water was used as the elution solvent, and a total of 4 BV was eluted. Detection was carried out by the sulfuric acid-phenol method. The absorbance was measured at 490 nm and an elution curve was plotted. The eluates corresponding to the elution peaks were combined and freeze-dried to obtain the neutral polysaccharide fraction of Prinsepia utilis Royle;

[0063] (3) Gel purification of the neutral homogeneous polysaccharide of Prinsepia utilis Royle: The neutral polysaccharide fraction of Prinsepia utilis Royle obtained in step (2) was redissolved with distilled water, passed through a 0.22 μm filter membrane to remove insoluble particles, and Sephadex G100 was used as the separation filler. The loading concentration was 10 mg / mL, the flow rate was 0.5 mL / min, and the eluent was distilled water. Detection of the eluent was carried out by the sulfuric acid-phenol method. The absorbance was measured at 490 nm and an elution curve was plotted. The eluates corresponding to the elution peaks were combined and freeze-dried to obtain the neutral homogeneous polysaccharide (PURP-A1) of Prinsepia utilis Royle. The total sugar content of PURP-A1 was measured by the sulfuric acid-phenol method, and the total sugar content of this homogeneous polysaccharide was 91.18%.

[0064] Example 2

[0065] Structural characterization test

[0066] This test example relates to the structural characterization test of the neutral homogeneous polysaccharide PURP-A1 of Prinsepia utilis Royle, specifically including:

[0067] (1) Monosaccharide composition test

[0068] Test method: Take a clean chromatographic bottle, weigh an appropriate amount of the neutral homogeneous polysaccharide of Prinsepia utilis Royle, add 1 mL of TFA solution, heat at 121 °C for 2 h to fully hydrolyze it, pass nitrogen, and blow dry. Add distilled water to dissolve, and use an ion chromatography system (ICS5000 +, Thermo Fisher Scientific, USA) to analyze and detect the monosaccharide components using an electrochemical detector.

[0069] The monosaccharide composition results are as Figure 1 shown. PURP-A1 is mainly composed of 69.44% glucose (Glc), 23.51% arabinose (Ara), as well as containing a small amount of 4.94% galactose (Gal) and 2.11% xylose (Xyl).

[0070] (2) Infrared spectroscopy test

[0071] Test method: Weigh a small amount of PURP-A1 sample, mix it evenly with 200 mg of potassium bromide, press it into a sheet with a thickness of 1 mm, and then perform on-machine detection.

[0072] The test results show (see Figure 2 ), the absorption band at 3600 - 3200 cm -1 is the stretching vibration absorption peak of -OH, and the absorption peaks in this region are characteristic peaks of saccharides. Specifically as follows: 3370.81 cm -1 is the stretching vibration absorption peak of O-H, which is a characteristic peak of saccharides. The absorption peak at 2931.56 cm -1 is attributed to the C-H stretching vibration; the absorption peak at 1659.61 cm -1 can be attributed to crystal water; there is an absorption peak at 1025.56 cm -1 , which is attributed to the stretching vibration of C-O. Based on these several groups of characteristic peaks, PURP-A1 can be preliminarily determined to be a polysaccharide compound.

[0073] (3) Determination of molecular weight and distribution coefficient

[0074] Test method: Dissolve PURP-A1 in 0.1 M NaCl solution with a final concentration of 1 mg / mL for testing. High performance liquid chromatography gel permeation chromatography (HPGPC) was used for testing, and the HPLC was Agilent 1260 Infinity II. The chromatographic conditions were: gel permeation chromatography column PL aquagel-OH 50 (8 μM, 300×7.5 mm). The column temperature was 35 °C, the injection volume was 50 μL, the mobile phase was 0.1 M NaCl solution, the flow rate was 1 mL / min, isocratic elution was used, and the molecular weight was calculated using GPC software.

[0075] The test results (see Figure 3 ) show that the Purpurea acuminata polysaccharide PURP-A1 presents a uniform and symmetric single peak, with a molecular weight Mw = 18373 Da and a distribution coefficient PDI = 1.56, indicating a narrow distribution and a uniform molecular weight distribution.

[0076] (4) Bonding structure analysis

[0077] Test method: Accurately weigh a small amount of PURP-A1 sample, dissolve it in DMSO, add NaOH, incubate for 30 min, then add methyl iodide solution and react for 1 h. Add 1 mL of water and 2 mL of dichloromethane, vortex and mix well, centrifuge, and discard the aqueous phase. Repeat the water washing 3 times, aspirate the lower dichloromethane phase, dry it with nitrogen, add 2 M TFA, react at 121 °C for 120 min, dry it with nitrogen, add 2 M ammonia, and react at room temperature for 2.5 h. Add acetic acid to terminate the reaction, dry it with nitrogen, wash it twice with methanol, and dry it with nitrogen. Add acetic anhydride, vortex and mix well, react at 100 °C for 2.5 h, then add distilled water and let it stand for 10 min. Add dichloromethane, vortex and mix well, centrifuge, and discard the aqueous phase. Finally, take the lower dichloromethane phase and detect it by GC-MS.

[0078] The methylation results are shown in Table 1, and the total ion chromatogram of methylation GC-MS is as Figure 4 shown.

[0079] Table 1

[0080]

[0081] (5) Structural analysis of the PURP-A1 core

[0082] The freeze-dried neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle was dissolved in 0.5 mL of D2O, and a 500 MHz Bruker nuclear magnetic resonance spectrometer was used to measure one-dimensional nuclear magnetic 1 1H-NMR, 13 13C-NMR and two-dimensional nuclear magnetic COSY, HSQC, HMBC, NOESY. The one-dimensional nuclear magnetic 1 1H spectrum and 13 13C spectrum of PURP-A1 are shown in Figure 5 and Figure 6 respectively. The two-dimensional nuclear magnetic COSY spectrum, HMBC spectrum, HSQC spectrum, and NOESY spectrum are shown in Figure 7 and Figure 8 and Figure 9 and Figure 10 respectively.

[0083] The hydrogen spectrum signals of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle are mainly concentrated between δ 3.0 - 5.5 ppm. Multiple coupling signal peaks were identified in the anomeric signal region of δ 4.3 - 5.4 ppm, indicating that this sample contains multiple sugar residues. The chemical shifts corresponding to the anomeric hydrogens are δ 4.86, 4.99, 5.08, 5.27, 5.31, etc. The non-anomeric hydrogen signals are mainly concentrated in the region of δ 3.1 - 4.2 ppm. In addition, multiple signal peaks were identified in the anomeric carbon region. Combining the 13 cross peaks in the anomeric region of the 13C NMR spectrum and HSQC spectrum, the anomeric signals present in this sample were determined to be: δ 5.31 / 99.5, 4.99 / 107.46, 5.08 / 106.83, 5.27 / 100.1, 4.86 / 97.87 ppm, and were denoted as sugar residues A, B, C, D, and E respectively. Combining the sample bonding structure (methylation) information and anomeric signals, it was thus speculated that sugar residue A is →4)-α-D-Glcp-(1→, sugar residue B is →5)-α-L-Araf-(1→, sugar residue C is α-L-Araf-(1→, sugar residue D is →4,6)-α-D-Glcp-(1→, and sugar residue E is →6)-α-D-Glcp-(1→. Combining the COSY spectrum, the chemical shifts of H2 - H6 of each sugar residue can be assigned, and the chemical shift assignments of each sugar residue are shown in Table 2.

[0084] Table 2

[0085]

[0086] Based on the chemical shifts of each sugar residue in PURP-A1 13 C and 1 H, combined with the analysis of HMBC and NOESY spectra, the structure and linkage mode in this polysaccharide were analyzed. According to the HMBC spectrum, there are cross-peaks between C1 of sugar residue A and H4 of sugar residue A at δ99.5 / 3.57 ppm, between H1 of sugar residue B and C4 of sugar residue D at δ4.99 / 76.44 ppm, between H1 of sugar residue D and C4 of sugar residue A at δ5.27 / 76.52 ppm, between C1 of sugar residue D and H4 of sugar residue A at δ100.1 / 3.57 ppm, and between C1 of sugar residue D and H6 of sugar residue E at δ100.1 / 3.56 ppm. According to the NOESY spectrum, there are cross-peaks between H1 of sugar residue A and H4 of sugar residue A at δ5.31 / 3.57 ppm, between H1 of sugar residue A and H6 of sugar residue D at δ5.31 / 3.72 ppm, between H1 of sugar residue A and H6 of sugar residue E at δ5.31 / 3.56 ppm, between H1 of sugar residue B and H4 of sugar residue D at δ4.99 / 3.68 ppm, between H1 of sugar residue C and H5 of sugar residue B at δ5.08 / 3.77 ppm, between H1 of sugar residue D and H4 of sugar residue A at δ5.27 / 3.57 ppm, and between H1 of sugar residue E and H4 of sugar residue A at δ4.86 / 3.57 ppm.

[0087] Based on the comprehensive analysis of the methylation results of polysaccharide PURP-A1 and the one-dimensional and two-dimensional NMR information, it can be inferred that: the neutral homogeneous polysaccharide from Prinsepia utilis Royle is mainly composed of →4)-α-D-Glcp-(1→, →4,6)-α-D-Glcp-(1→ and →6)-α-D-Glcp-(1→ connected to form the main chain, and the side chain is mainly composed of α-L-Araf-(1→ and →5)-α-L-Araf-(1→ connected to form the side chain and linked at the O-4 position of sugar residue →4,6)-α-D-Glcp-(1→, etc. The core structural formula is as follows:

[0088]

[0089] Example 3

[0090] Activity test of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle on substance P-induced skin pruritus

[0091] Test method: Human keratinocyte cell line HaCaT was cultured in high-glucose DMEM medium (purchased from Gibco) containing 10% fetal bovine serum (purchased from Gibco). HaCaT cells in the logarithmic growth phase were seeded into 6-well plates at a density of 1.2×10 6 cells / well and cultured in a cell incubator for 24 h. After the cells were completely adherent, except for the normal group cultured with complete medium, the model group was added with 2 μM substance P (purchased from MCE), the administration group was added with 2 μM substance P and Purpurea acuminata neutral homogeneous polysaccharide PURP-A1 (500 μg / mL, 1000 μg / mL) and co-cultured for 24 h, and the positive drug group was added with 2 μM substance P and 1 μM aprepitant (purchased from MCE). After modeling and administration, the cell supernatant was aspirated and discarded, washed once with PBS, RNA was extracted according to the operation instructions of the cell RNA extraction kit (purchased from Abclonal), and reverse transcribed into cDNA using the reverse transcription kit (purchased from Abclonal). Finally, the gene expressions of TNF-α, IL-6, IL-8 and IFN-γ were detected by real-time fluorescence quantitative PCR method.

[0092] The primer sequence information is shown in Table 3:

[0093] Table 3

[0094] Gene Name Upstream Downstream TNF-α TTGGAGTGATCGGCCCCCAG ACAGGCTTGTCACTCGGGGTT IL-6 CTCCACAAGCGCCTTCGGTC TGTGTGGGGCGGCTACATCT IL-8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC IFN-γ TGAATGTCCAACGCAAAGCA ACTGGGATGCTCTTCGACCT

[0095] GraphPad Prism was used for plotting, and the results were expressed as Mean±SD. The t-test statistical analysis was used for comparison between groups. "#", "##" and "" indicated p < 0.05, p < 0.01 and p < 0.001 compared with the normal control group respectively; "*", "**" and "***" indicated p < 0.05, p < 0.01 and p < 0.001 compared with the model group respectively, n = 3.

[0096] Inflammatory factor inhibition effect = (relative expression level of the model group - relative expression level of the test group) / relative expression level of the model group × 100%.

[0097] Table 4

[0098]

[0099] The experimental results are shown in Table 4 and Figures 11 to 14As shown in the figure, the experimental results of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle in the skin itching model induced by substance P indicate that this active ingredient can significantly inhibit the gene expression of inflammatory factors TNF-α, IL-6, IL-8, and IFN-γ in human keratinocytes induced by substance P. This finding reveals the potential molecular mechanism by which PURP-A1 exerts its anti-skin itching effect by regulating the expression pathway of inflammation-related cytokines. It shows that PURP-A1 can be used as a natural anti-allergic and anti-itching active ingredient, with great application potential in the development of skin care products for sensitive skin or drugs for the treatment of pruritic skin diseases, such as neurogenic dermatitis, atopic dermatitis, psoriasis, etc.

[0100] Example 4

[0101] Potential test of the wound healing efficacy of the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle

[0102] HaCaT cells were inoculated into 12-well plates. A cell scratch insert was vertically placed in the center of each 12-well cell culture plate. 70 μL of cell suspension was added to each of the two chambers of each insert, and the area around the insert was moistened with 200 μL of cell suspension. The cells were cultured for 24 h under the conditions of 5% CO2 and 37 °C. The insert was gently removed with sterilized forceps, and the cells were gently rinsed once with 1 mL of PBS solution, and all PBS was aspirated. A blank control group (added with serum-free medium), a positive control group EGF (10,000 IU / mL), and a sample group (PURP-A1 500 μg / mL) were set. The cell growth status at the scratch area was observed under a microscope at 16 h, 24 h, and 48 h, and photos were taken and recorded respectively. The healing area was calculated using ImageJ software.

[0103] Healing rate = (Initial scratch area (0 h) - Scratch area at the measured time) / (Initial scratch area (0 h)) × 100%.

[0104] Table 5

[0105] Group 16h 24h 48h Blank Control Group 7.29% 10.11% 13.08% Positive Control Group 13.38% 34.86% 100% PURP-A1 21.45% 35.00% 78.90%

[0106] The experimental results are shown in Table 5 and Figure 15 As shown, compared with the blank control group, at different observation time points, the neutral homogeneous polysaccharide PURP-A1 from Prinsepia utilis Royle had a significantly increased healing rate compared with the blank control group, indicating its excellent scratch repair effect and great application potential in wound repair products or skin barrier repair cosmetics.

[0107] The applicant declares that the above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by any person skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A neutral uniform polysaccharide from Prinus utilis, characterized in that: The structure of the neutral uniform polysaccharide of Primarina utilis is:

2. The neutral uniform polysaccharide of Primarina utilis according to claim 1, characterized in that: The neutral homogeneous polysaccharide of thorn fruit is formed by connecting sugar residues, and the sugar residues include →4)-α-D-Glcp-(1→, →5)-α-L-Araf-(1→, α-L-Araf-(1→, →4,6)-α-D-Glcp-(1→ and →6)-α-D-Glcp-(1→.

3. The neutral uniform polysaccharide of Primarina utilis according to claim 1, characterized in that The molecular weight of the neutral homogeneous polysaccharide of Primarina utilis is 15kDa-20kDa.

4. The neutral uniform polysaccharide of Primarina utilis according to claim 1, characterized in that The total sugar content of the neutral and uniform polysaccharide of Prinus utilis is greater than 90%.

5. A method for preparing the neutral uniform polysaccharide of Prinus utilis according to any one of claims 1 to 4, characterized in that: The preparation method comprises the following steps: (1) extracting the prickle fruit by heating and refluxing, concentrating the obtained extract, and then adding ethanol for alcohol precipitation to obtain prickle fruit crude polysaccharide; (2) separating and eluting the crude polysaccharide of Prinia prinia obtained in step (1) using an anion exchange gel chromatography column to obtain a neutral polysaccharide component of Prinia prinia; (3) Separating and eluting the neutral polysaccharide component of the prickle fruit obtained in step (2) using a polysaccharide gel chromatography column, collecting the eluate, and obtaining the neutral uniform polysaccharide of the prickle fruit.

6. The preparation method according to claim 5, characterized in that: The preparation method comprises the following steps: (1) extracting the prickle oil cake after oil pressing by heating and refluxing, using water as the extraction solvent, concentrating under reduced pressure, adding ethanol for alcohol precipitation, wherein the final volume concentration of ethanol is 85%, stirring, and precipitation overnight, and collecting the precipitate by centrifugation to obtain prickle crude polysaccharide; (2) The crude polysaccharide of Prinia prinia obtained in step (1) is re-dissolved in water, centrifuged, the supernatant is collected and loaded onto an anion exchange gel DEAE-52 filler, water is used as the elution solvent, 4 BV is eluted in total, the elution is detected by the sulfuric acid-phenol method, the absorbance is tested at 490 nm and an elution curve is drawn, the eluates corresponding to the elution peaks are combined, and freeze-dried to obtain a neutral polysaccharide component of Prinia prinia; (3) The neutral polysaccharide component of the prickle fruit obtained in step (2) is re-dissolved in water, filtered, and Sephadex G100 is used as a separation filler. The eluent is water, and the sulfuric acid-phenol method is used for detection. The absorbance is tested at 490 nm and an elution curve is drawn. The eluates corresponding to the elution peaks are combined and freeze-dried to obtain the neutral uniform polysaccharide of the prickle fruit.

7. Use of the neutral uniform polysaccharide of Principia utilis as claimed in any one of claims 1 to 4 in the preparation of a skin antipruritic product.

8. The use according to claim 7, characterized in that: The skin antipruritic agent is used for preparing medicines for treating atopic dermatitis, psoriasis and neurogenic dermatitis.

9. Use of the neutral uniform polysaccharide of Prinus utilis according to any one of claims 1 to 4 in preparing a product for promoting wound healing.

10. Use of the neutral uniform polysaccharide of Prinus utilis according to any one of claims 1 to 4 in the preparation of cosmetics; The cosmetic comprises a skin protectant capable of soothing itching and stinging symptoms of sensitive skin and promoting skin barrier repair, wherein the skin protectant comprises the neutral uniform polysaccharide of Prinia utilis as claimed in any one of claims 1 to 4.

Citation Information

Patent Citations

  • Moisture retention composition, preparation method and application thereof

    CN104510668A

  • Application and extraction method of prinsepia utilis royle polysaccharide

    CN119792336A