Dammarendiol derivative as well as preparation method and application thereof

By preparing damantene glycol derivatives Compounds I and Compound II, the problem of lack of effective anti-tumor drugs in the prior art was solved, and the significant inhibitory effect on human breast cancer, colon cancer, ovarian cancer and gastric cancer cells was achieved, and the preparation method was simple and costly.

CN120241746AActive Publication Date: 2025-07-04YUNNAN AGRICULTURAL UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510063334.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-15
Publication Date
2025-07-04
Estimated Expiration
2045-01-15

AI Technical Summary

Technical Problem

There is a lack of effective anti-tumor drugs in the prior art, especially inhibiting drugs for tumor cells such as human breast cancer, colon cancer, ovarian cancer and gastric cancer, resulting in a high mortality rate.

Method used

The codon-optimized P450 enzyme gene BmCYP068 of pseudopurslane was used to homologously recombinate with YCplac33 vector to construct a recombinant plasmid. The damantene glycol derivative compound I and compound II were prepared by yeast chassis cell fermentation and extraction purification to prepare the damantene glycol derivative compound I and compound II for the preparation of anti-cancer drugs.

Benefits of technology

Compounds I and Compound II showed significant inhibitory effects on human breast cancer, colon cancer, ovarian cancer and gastric cancer cell lines in in vitro experiments, which was better than existing positive control drugs, and the preparation method was simple and low cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120241746A_ABST
    Figure CN120241746A_ABST
Patent Text Reader

Abstract

The invention relates to a dammarendiol derivative as well as a preparation method and application thereof, and belongs to the technical field of biochemistry. The structure of the dammarendiol derivative is shown as a formula (1). # imgabs0 #, formula (1); in formula (1), R is # imgabs 1 # or # imgabs 2 #. Pharmacological experiments prove that the dammarendiol derivative has an obvious anti-tumor effect, has a better inhibition effect on human breast cancer cells, colon cancer cells, ovarian cancer cells and gastric cancer cell lines than positive control drugs, and can be used as a lead compound or a candidate compound for development of anti-tumor drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biochemistry, and particularly relates to dammarenediol derivatives, a preparation method thereof, and an application thereof. Background Art

[0002] At present, the treatment methods for tumors are still traditional surgical treatment, radiotherapy, and drug treatment. However, to a large extent, drug treatment is still the main method, and drugs play an important role in the treatment of malignant tumors. In recent years, great progress has been made in tumor chemotherapy, and the survival time of patients has been significantly extended. In particular, there have been breakthroughs in the treatment of leukemia, malignant lymphoma, etc. However, there are still many types of tumors for which there are no good inhibitory drugs, resulting in a high mortality rate. Therefore, the research and development of new anti-tumor drugs have important clinical significance for the treatment of malignant tumors. Summary of the Invention

[0003] The purpose of the present invention is to solve the deficiencies of the prior art and provide dammarenediol derivatives, a preparation method thereof, and an application thereof.

[0004] To achieve the above purpose, the technical scheme adopted by the present invention is as follows:

[0005] Application of dammarenediol derivatives in the preparation of anti-cancer drugs, wherein the structure of the dammarenediol derivatives is shown in formula (1);

[0006]

[0007] In formula (1), R is

[0008] Furthermore, preferably, the anti-cancer drug is an anti-human breast cancer, anti-human lung cancer, anti-colorectal cancer, anti-ovarian cancer, or anti-gastric cancer drug.

[0009] Furthermore, preferably, the preparation method of the dammarenediol derivatives comprises the following steps:

[0010] (1) Homologous recombination of the codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri with the Y33 vector to obtain the Y33-BmCYP068 recombinant plasmid; the nucleotide sequence of the codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri is shown in SEQ ID NO.1;

[0011] (2) Transforming the Y33-BmCYP068 recombinant plasmid into the Saccharomyces cerevisiae transgenic engineering bacteria DM yeast chassis cell strain capable of producing Dammarenediol II to obtain the transgenic engineering bacteria containing the Y33-BmCYP068 recombinant plasmid;

[0012] (3) The genetically engineered bacteria containing the recombinant plasmid Y33-BmCYP068 were cultured in a liquid medium of SC-His-Leu-Ura at 30 °C with shaking at 220 rpm for 5 days, and then the cells were collected by centrifugation at 5000 rpm for 30 min.

[0013] (4) The collected cells were lysed and broken by a lysis solution, and then extracted with a mixed solution of petroleum ether and ethyl acetate with a volume ratio of 1:1. After concentration and drying of the extract, column chromatography was carried out to obtain the dammarenediol derivative shown in formula (1).

[0014] Furthermore, preferably, in step (4), the lysis solution is a solvent with a volume concentration of 50% EtOH, and KOH is added to a mass concentration of 20%.

[0015] Furthermore, preferably, in step (4), the extraction is carried out three times.

[0016] Furthermore, preferably, in step (4), during concentration and drying, a rotary evaporator is used for concentration and drying at 50 °C.

[0017] Furthermore, preferably, in step (4), during silica gel column chromatography, a mixed solvent of petroleum ether and ethyl acetate is used as the eluent for gradient elution, and the gradient elution ratios are successively 12:1, 10:1, 8:1, 6:1, 4:1, 2:1, 1.5:1; TLC tracking is adopted.

[0018] In the present invention, the YCplac33 vector is used for homologous recombination with the codon-optimized P450 enzyme gene BmCYP 068 of Bacopa monnieri. Those skilled in the art should know that the YCplac33 vector is abbreviated as the Y33 vector.

[0019] In the present invention, gradient elution is monitored by TLC tracking, and the same parts are combined for concentration. After each gradient elution until there is no obvious main spot on the TLC plate, the next concentration gradient can be changed.

[0020] In the present invention, the nucleotide sequence of the codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri is shown in SEQ ID NO.1, and the full-length sequence is 1554 bp.

[0021] The codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri in the present invention was identified by screening through transcriptome sequencing and bioinformatics techniques from the plants of Bacopa monnieri after a large number of experiments; after codon optimization, it was obtained by an artificial synthesis method. The reaction formula of the preparation method of the present invention is:

[0022]

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0024] (1) In the in vitro anti-tumor activity experiments of dammarenediol derivatives provided by the present invention on various human cancer cells, it is found that Compounds I and II have better inhibitory effects on human breast cancer (MCF-7), colon cancer (SW480), ovarian cancer (SKOV3) and gastric cancer (SGC7901) cell lines in vitro than the positive control drug, indicating that these two compounds can be used as lead compounds or candidate compounds for the development of anti-tumor drugs;

[0025] (2) The preparation method provided by the present invention is simple, with a high yield and low cost. Description of the Drawings

[0026] Figure 1 Schematic diagram of the construction of the recombinant expression plasmid Y33-BmCYP068;

[0027] Figure 2 Electrophoresis detection results of the recombinant P450 enzyme gene BmCYP068 of Bacopa monnieri after codon optimization; among them, M is the nucleic acid Marker, and 1-6 are the detection results of positive single colonies;

[0028] Figure 3 Schematic diagram of the gene fusion fragment for constructing the DM chassis;

[0029] Figure 4 Results of the catalytic effect of the codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri on the substrate Dammarenediol II in yeast detected by HPLC; among them, DM+PPD standard: the peak elution times of Dammarenediol II standard and PPD standard; DM chassis+Y33 empty vector: the reaction results of the control group with Y33 empty plasmid as the positive control; DM chassis+BmCYP068: the reaction results of the codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri catalyzing the substrate Dammarenediol II in yeast, and the peak elution times of Products I and II;

[0030] Figure 5 Characteristic peak ion diagram of Reaction Product I (theoretical molecular weight 460);

[0031] Figure 6 Characteristic peak ion diagram of Reaction Product II (theoretical molecular weight 460);

[0032] Figure 7 NMR detection results, the NMR 13 C spectrum of Reaction Product 1;

[0033] Figure 8For the NMR test results, the NMR of reaction product 1 1 1H spectrum;

[0034] Figure 9 For the NMR test results, the HMBC spectrum of reaction product 1;

[0035] Figure 10 For the NMR test results, the HSQC spectrum of reaction product 1;

[0036] Figure 11 For the NMR test results, the COSY spectrum of reaction product 1

[0037] Figure 12 For the NMR test results, the ROESY spectrum of reaction product 1;

[0038] Figure 13 For the NMR test results, the NMR of reaction product 2 13 13C spectrum;

[0039] Figure 14 For the NMR test results, the NMR of reaction product 2 1 1H spectrum;

[0040] Figure 15 For the NMR test results, the HMBC spectrum of reaction product 2;

[0041] Figure 16 For the NMR test results, the HSQC spectrum of reaction product 2;

[0042] Figure 17 For the NMR test results, the COSY spectrum of reaction product 2

[0043] Figure 18 For the NMR test results, the ROESY spectrum of reaction product 2;

[0044] Figure 19 For the inhibitory effects of Compound I and Compound II on human breast cancer (MCF-7) cell line;

[0045] Figure 20 For the inhibitory effects of Compound I and Compound II on human colon cancer (SW480) cell line;

[0046] Figure 21 For the inhibitory effects of Compound I and Compound II on human ovarian cancer (SKOV3) cell line;

[0047] Figure 22 For the inhibitory effects of Compound I and Compound II on human gastric cancer (SGC7901) cell line;

[0048] Figure 23The inhibitory effects of Compound I and Compound II on human lung cancer (A549) cell line.

[0049] The above NMR detections were all carried out on a Bruker AV-800MHz spectrometer (Santa Clara, USA) with the compound in DMSO-d6. Specific implementation manners

[0050] The present invention will be further described in detail below in conjunction with the embodiments.

[0051] Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the embodiments regarding specific techniques or conditions, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For those materials or equipment without indicating the manufacturer, they are all conventional products that can be obtained by purchase.

[0052] Example 1 Preparation of Compound I and Compound II

[0053] After a series of operations such as codon optimization, artificial synthesis, homologous recombination, in vivo induction expression in yeast chassis cells, extraction of yeast metabolites, HPLC, LC-MS, NMR detection, etc. on the nucleotide sequence of Bacopa monnieri cytochrome P450 monooxygenase (CYPs) BmCYP068 (see ZL202311077715.2), Compound I and Compound II were purified by silica gel column chromatography.

[0054] The operating steps of each stage in the preparation of Compound I and Compound II are as follows:

[0055] The medium formula used in the present invention is shown in Table 1.

[0056] Table 1 Medium formula used in the present invention

[0057]

[0058] (1) Codon optimization and artificial synthesis of the BmCYP068 gene

[0059] The P450 synthase-encoding gene BmCYP068 annotated from the transcriptome was codon-optimized and then artificially synthesized by the company.

[0060] (2) Construction and identification of the gene recombination vector

[0061] The schematic diagram of homologous recombination is shown in detail in Figure 1First, the YCplac33 vector was linearized, and the linearized vector was obtained by single restriction digestion with XbaI enzyme. The restriction digestion system (50μL) was 1μg of circular YCplac33 vector, 5μL of 10×NEBuffer, 1μL of Restriction Enzyme, and double distilled water was added to the total system of 50μL. The reaction solution was placed at 37℃ for 15min to obtain the linearized vector YCplac33. The EasyPure Quick Gel Extraction Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used for recovery. After the recovery, its concentration was measured and finally stored in a -20℃ refrigerator for future use. During homologous recombination, the assembly was carried out according to the operating instructions of the homologous recombination enzyme kit (Sangon Biotechnology (Shanghai) Co., Ltd.), and then the amount of each component was calculated according to the concentration of the insert and the vector and the recombination instructions; finally, each component was added to the PCR reaction tube on ice, as shown in Table 2. The codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri was homologously recombined with the linearized vector YCplac33 to obtain a recombinant plasmid named Y33-BmCYP068. The recombinant plasmid was transformed into DH5α Escherichia coli, and the positive clones were selected for detection and sent to the company for sequencing. The electrophoresis detection results after assembly are shown in Figure 2 , indicating that the assembly was successful. The positive monoclonal clones that were successfully sequenced were preserved in 50% (v:v) glycerol (i.e., positive monoclonal seed solution) and stored in a -80°C ultra-low temperature refrigerator.

[0062] Table 2 Candidate gene recombination reaction system

[0063] Component Recombination reaction μL Linearized vector YCplac33 X Inserted gene fragment Y 5×CE II Buffer 4 Exnase II 2 <![CDATA[ddH2O]]> to 20 μL

[0064] Wherein, X = (0.02 × YCplac33 base pairs) ng / linearized YCplac33 concentration ng / μL; Y = (0.02 × YCplac33 base pairs) ng / BmCYP068 recovery concentration ng / μL;

[0065] (3) Recombinant plasmid extraction

[0066] 10 μL of the positive monoclonal seed solution detected by sequencing was placed in 6 mL LB liquid medium (100 mg / mL Amp) and cultured overnight at 37°C in a shaker (220 r / min). The plasmid was extracted according to the instructions in the plasmid DNA mini-preparation kit centrifugal column type (GenStar, Shenzhen, China). After extraction, the recovery concentration of the plasmid DNA was measured on a NanoReady ultra-micro UV-visible spectrophotometer, and finally stored in a -20°C refrigerator for later use.

[0067] (4) Preparation of competent cells in DM yeast chassis

[0068] Pick up the DM yeast chassis cell strain on the SC-His-Leu solid medium plate and inoculate it into 100 mL of SC-His-Leu liquid medium. Culture at 30 °C and 220 rpm until OD = 0.8 - 0.9. Centrifuge using a 50 mL centrifuge tube, and collect the cells at 5000 g for 5 min. Wash twice with 25 mL of sterilized water, repeat the centrifugation step. Resuspend the washed cells with 1 mL of ddH2O, mix well, transfer to a 1.5 mL centrifuge tube, and centrifuge at 13000 rpm for 30 s to collect the cells. Resuspend with 600 μL of ddH2O, aliquot 100 μL into each tube, and a total of two tubes are used for transformation.

[0069] The above DM yeast chassis cell strain is from Yunnan Agricultural University and can provide the precursor dammarenediol (DM) for the functional verification of BmCYP068. The construction method of this DM yeast chassis cell strain can be referred to ZL2025100515909: A recombinant Saccharomyces cerevisiae that can produce 23-OH-Dammarenediol II and 25-OH-Dammarenediol II simultaneously. The steps are as follows:

[0070] S1: The related genes ERG1, ERG9, ERG20, and tHMG1 of the mevalonate pathway from Saccharomyces cerevisiae BY4742, the dammarenediol synthase gene synPgDDS from Panax ginseng, the NADPH-cytochrome P450 reductase gene synBmCPR1 from Bacopa monnieri, the leucine selection tag (LEU2), as well as the yeast-derived promoter and terminator are respectively constructed to form gene expression cassettes to become the modules of the DM synthesis pathway. Specifically, the expression of the tHMG1 gene introduced into the BY-MVA recombinant bacterium is controlled by the promoter HXT7 and the terminator ADH1, the expression of the synBmCPR1 gene introduced into the BY-MVA recombinant bacterium is controlled by the promoter TEF2 and the terminator TDH2, the expression of the ERG1 gene introduced into the BY-MVA recombinant bacterium is controlled by the promoter IPI1 and the terminator ENO2, the expression of the ERG20 gene introduced into the BY-MVA recombinant bacterium is controlled by the promoter GPM and the terminator CYC1, the expression of the ERG9 gene introduced into the BY-MVA recombinant bacterium is controlled by the promoter PGK1 and the terminator FBA 1, and the expression of the synPgDDS gene introduced into the BY-MVA recombinant bacterium is controlled by the promoter TDH3 and the terminator PGT1. Construct gene expression cassettes ( Figure 3) Among them, the BY-MVA recombinant strain is existing, and the construction method is as follows: by using the promoter IDP1 and terminator TDH2 to control the expression of the ERG1 gene introduced into BY4742; using the promoter TEF1 and terminator CYC1 to control the expression of the ERG9 gene introduced into BY4742; using the promoter CPS1 and terminator ENO2 to control the expression of the ERG20 gene introduced into BY4742; using the promoter PGK1 and terminator ADH1 to control the expression of the tHMG1 gene introduced into BY4742, a gene expression cassette is constructed, and the gene expression cassette and HIS3 screening tag are co-transformed into the YPRCδ15 locus of Saccharomyces cerevisiae BY4742 by homologous recombination using the lithium acetate transformation method.

[0071] S2. Using the lithium acetate transformation method, co-transform the gene expression cassette and LEU2 screening tag at the δDNA locus of the BY-MVA recombinant strain to obtain the recombinant strain DM-BmCPR capable of producing DM, that is, the DM yeast chassis cell strain.

[0072] (5) Transformation of DM yeast chassis cells

[0073] Centrifuge the above two tubes of bacteria in a microcentrifuge for 20 s, discard the supernatant, and add to each tube the transformation system: PEG 4000 (50%) 240 μL, LAC (lithium acetate) 1.0 mol 36 μL, SSDNA (salmon sperm) 2.0 μg / μL 10 μL, Y33-BmCYP068 plasmid with the target fragment (400 ng), and ddH2O to make up the total volume to 74 μL. Resuspend the mixed reaction system, incubate at 30 °C for 20 min, heat shock at 42 °C for 40 min to obtain a resuspension; take 200 μL of the resuspension and spread it on SC-His-Leu-Ura plates, and invert and place it in a 30 °C incubator for 2 - 4 days, then select positive clone strains for verification to obtain the engineered bacteria transformed with Y33-BmCYP068.

[0074] (6) Screening of positive strain clones

[0075] Add 20 μL of ddH2O to each of the 8-tube 0.2 mL PCR tubes. Pick 4 single colonies from each of the above two plate cultures, for a total of 8, and add 1 to each PCR tube. Perform cell wall breaking treatment in a PCR instrument at 95 °C for 10 min. Add the following reaction system to the PCR tubes: 10 μL of Super 2x Mix, 7.4 μL of sterilized water, 0.8 μL of universal forward primer (10 mM), 0.8 μL of universal reverse primer (10 mM), and 1 μL of single colony template dissolved in water, for a total of 20 μL. The detection universal primers were designed using software (SnapGene 3.2.1). Universal forward primer: gatgctttctttttctctttttttacagatc (SEQ ID NO.2), universal reverse primer: gcgtgaatgtaagcgtgac (SEQ ID NO.3); The PCR amplification cycle parameters were: 95 °C for 3 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 90 S, for 35 cycles; 72 °C for 5 min, 10 °C for 5 min.

[0076] (7) Detection and sequencing

[0077] Take 1.0 μL of Loading buffer and add 5 μL of the above PCR product, mix well, and detect the amplification result by 1% agarose gel electrophoresis. If it is similar to the size of the target fragment, it is a true positive yeast strain, indicating successful transformation. The bacterial solution identified as a positive clone was cultured in SC-His-Leu-Ura liquid medium at 30 °C and 220 rpm / min for 1 day for preservation. The method was to add 50% (v:v) glycerol and the bacterial solution to the preservation tube at a ratio of 1:1, mix well, and store it in a -80 °C ultra-low temperature refrigerator for later use.

[0078] (8) Yeast induction expression and detection

[0079] Select positive transformed strains with normal growth and culture them in SC-His-Leu-Ura liquid medium (50 ml). After culturing at 30 °C and shaking at 220 rpm for 5 days, centrifuge at 8000 rpm for 5 min to collect cells. Use 5 ml of lysis solution (using 50% EtOH by volume as the solvent and adding KOH to a mass concentration of 20%) to lyse the cell wall; Extract three times with 5 mL of a mixture of petroleum ether:ethyl acetate = 1:1; Dry the extract to dryness at 50 °C using a rotary evaporator and dissolve it in 3 ml of chromatographic methanol. Analyze the extracted metabolites by HPLC.

[0080] The HPLC detection conditions are as follows:

[0081] The instrument used for HPLC detection was an Agilent high performance liquid chromatograph. The chromatographic column was an Agilent EC-C18 chromatographic column (4.6×100 mm, 2.7 μm), column temperature: 25°C; the mobile phase for determination was: water (A) - acetonitrile (B), gradient elution: 0 - 10 min, 70% - 75% B; 10 - 20 min, 75% - 85% B; 20 - 22 min, 85% - 100% B; 22 - 25 min, 100% B; the total of mobile phases A + B used during elution was 100%; linear gradient elution was adopted; elution time: 25 min; injection volume: 10 μL; flow rate: 0.8 ml / min; detection wavelength 203 nm, and the detector was a diode array detector. The detection results are shown in Figure 4 , indicating that new products were generated under the catalysis of the Bacopa monnieri P450 enzyme BmCYP068 in the experimental samples.

[0082] The LC-MS detection conditions were as follows:

[0083] To further confirm the reaction products detected by HPLC, an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography mass spectrometry (LC / MS / MS) was used for detection: Mass spectrometry conditions: The ion source adopted the negative ion mode, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V, scanning range: 100 - 1000 m / z, scanning mode: SRM. Chromatographic conditions: The chromatographic column was an Agilent EC-C18 chromatographic column (4.6×100 mm, 2.7 μm), column temperature: 25°C; the mobile phase for determination was: water (A) - acetonitrile (B), gradient elution: 0 - 10 min, 70% - 75% B; 10 - 20 min, 75% - 85% B; 20 - 22 min, 85% - 100% B; 22 - 25 min, 100% B; the total of mobile phases A + B used during elution was 100%; linear gradient elution was adopted; elution time: 25 min; injection volume: 10 μL; flow rate: 0.8 ml / min; detection wavelength 203 nm, and the detector was a diode array detector. Data analysis was performed using the MassHunter workstation (Agilent) software. The detection results are shown in Figures 5 - 6 .

[0084] (9) The engineered bacteria transformed with Y33-BmCYP068 were expanded and cultured in 10 L. After 5 days of shake flask fermentation, the cells were collected by centrifugation at 5000 rpm for 30 min and extracted three times with 500 mL of a mixed solution of petroleum ether:ethyl acetate = 1:1; the extract was dried by rotary evaporation at 50 °C to obtain 5 g of dry extract; a silica gel (300 mesh, 125 g) chromatography column 25 times the mass of the dry extract was used, and gradient elution was carried out with petroleum ether:ethyl acetate (12:1 - 1.5:1, v / v) (the elution ratios of the gradient elution were 12:1, 10:1, 8:1, 6:1, 4:1, 2:1, 1.5:1 in turn; TLC tracking was used), and Compound I and Compound II were obtained at ratios of 4:1 and 2:1 respectively. The two compounds were respectively subjected to NMR detection to determine their structures. The NMR detection was carried out on a Bruker AV-800 MHz spectrometer (Santa Clara, USA) in DMSO-d6, and the detection results are shown in Figures 7 - 18 , and according to the NMR spectrum analysis, Compound I was determined to be 23-OH-Dammarenediol II, and Compound II was determined to be 25-OH-Dammarenediol II.

[0085] Example 2 Observation of the effects of Compound I and Compound II on the proliferation of human breast cancer cells (MCF-7), lung cancer cells (A549), colon cancer cells (SW480), ovarian cancer cells (SKOV3) and gastric cancer (SGC7901) cell lines by the CCK method

[0086] 1. Materials

[0087] 1.1 Cancer cell types: Human breast cancer cell line: MCF-7, human lung cancer cell line: A549, colon cancer cell line: SW480, ovarian cancer cell line: SKOV3, human gastric cancer cell line: SGC7901;

[0088] Storage conditions: Cryopreservation in liquid nitrogen

[0089] Number of samples: 120 groups

[0090] 1.2 Experimental drugs: Compound I and Compound II (self-made), purity identification was carried out by HMR analysis, the purity was ≥98%, meeting the experimental requirements. The powder was sealed and stored at 4 °C.

[0091] 2. Methods

[0092] 2.1 Culture conditions

[0093] Complete cell culture medium:

[0094] MCF-7 and SW480: 90% DMEM + 10% FBS + 1% Penicillin / Streptomycin Solution (wt%);

[0095] A549 and SGC7901: 90% RPMI1640 + 10% FBS + 1% Penicillin / Streptomycin Solution (wt%);

[0096] SKOV3: 90% DMEM / F12 + 10% FBS + 1% Penicillin / Streptomycin Solution (wt%).

[0097] Culture conditions: air, 95%; carbon dioxide, 5% (v:v); cultured in an incubator at 37°C with a humidity of 70% - 80%.

[0098] 2.2 Cell treatment:

[0099] 1. Cell resuscitation: Rapidly shake and thaw the cell cryopreservation tube in a 42°C water bath, add 4 mL of complete cell culture medium, and mix well. Centrifuge at 1000 rpm for 4 min, discard the supernatant, add 2 mL of complete cell culture medium, and resuspend the cells. Then transfer all the cell suspension to a culture flask and culture overnight. Change the medium the next day and check the cell density.

[0100] 2. Cell passage: If the cell density reaches 80% - 90%, subculture can be carried out.

[0101] Subculture steps:

[0102] 1) Add 500 μL of 0.25% Trypsin to the flask, place it in a 37°C incubator for 1 min, observe the cell digestion under a microscope. If most of the cells become round and detached, quickly take it back to the operation table, gently tap it a few times, then add 50 μL of complete cell culture medium to terminate the digestion, centrifuge at 1000 rpm for 4 min, and wash the cells with PBS twice.

[0103] 2) Discard the supernatant, add 2 mL of culture medium, and resuspend the cells.

[0104] 3) Divide the cell suspension into new culture flasks at a ratio of 1:2 (v:v).

[0105] 3. Cell cryopreservation: After the experiment, when the cells are in good growth condition, use a pipette to aspirate and digest the cells to collect them, and add cell cryopreservation solution (Thermo Fisher Scientific Inc) to cryopreserve the cells.

[0106] 2.3 CCK8 assay

[0107] 1. Take cells in the logarithmic growth phase and seed them into a 96-well plate at a cell density of 10 4 cells per well.

[0108] 2. Incubate the cells overnight.

[0109] 3. On the next day, treat the cells in the culture wells with Compound I and Compound II at seven concentrations: 1000 μmol / L, 100 μmol / L, 10 μmol / L, 1 μmol / L, 0.1 μmol / L, 0.01 μmol / L, and 0.001 μmol / L.

[0110] 4. After 24 h, perform CCK8 assays on the cells treated differently (see the CCK8 instruction manual for details).

[0111] 5. Based on the CCK8 results, select the concentration range where the cell inhibition rate is 50%, and then set 5 concentrations at a 2-fold concentration gradient for CCK8 assays. Each concentration is repeated 3 times, and the survival rate is calculated. Survival rate (%) = (experimental OD value - blank control OD value) / (negative control OD value - blank control OD value) * 100. The detection results are analyzed using GraphPad Prism 8.0 to evaluate the inhibitory effects of Compound I and Compound II on cancer cells (Note: blank control: no cells; negative control: drug concentration is 0).

[0112] 3. Results

[0113] Compound I and Compound II both showed better inhibitory effects on human breast cancer cells (MCF-7), colon cancer cells (SW480), ovarian cancer cells (SKOV3), and gastric cancer (SGC7901) cell lines than the positive control drugs (pertuzumab, fluorouracil, cisplatin, ginsenoside Rg3, paclitaxel corresponding to those Figures 19 - 23 indicated), and the effects were dose-dependent; Compound I and Compound II also showed significant inhibitory effects on human lung cancer cells (A549), but the required concentrations were relatively higher compared to the positive control drugs. The results are as Figures 18 - 22 shown in Table 3.

[0114] Table 3 Cytotoxic effects of Compound I and Compound II on 5 types of cancer cells

[0115]

[0116]

[0117] 4. Conclusions

[0118] Compound I and Compound II both have significant inhibitory effects on human breast cancer cells (MCF-7), human lung cancer cells (A549), colon cancer cells (SW480), ovarian cancer cells (SKOV3) and gastric cancer (SGC7901) cell lines. Except for human lung cancer cells (A549), the inhibitory effects of Compound I and Compound II on the other 4 types of human cancer cells are better than those of the positive control drug.

[0119] The above has shown and described the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. Use of dammarenediol derivatives in the preparation of anti-cancer drugs, characterized in that, The structure of the dammarenediol derivative is shown in formula (1); In formula (1), R is 2. Use of the dammarenediol derivative according to claim 1 in the preparation of an anticancer drug, characterized in that: The anti-cancer drug is an anti-human breast cancer, anti-human lung cancer, anti-colon cancer, anti-ovarian cancer or anti-gastric cancer drug.

3. Use of the dammarenediol derivative according to claim 1 in the preparation of an anticancer drug, characterized in that: The preparation method of the dammarenediol derivative comprises the following steps: (1) Homologous recombination of the codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri with the Y33 vector to obtain the Y33-BmCYP068 recombinant plasmid; the nucleotide sequence of the codon-optimized P450 enzyme gene BmCYP068 of Bacopa monnieri is shown in SEQ ID NO.1; (2) Transforming the Y33-BmCYP068 recombinant plasmid into the transgenic engineering yeast strain DM yeast chassis cells that can produce Dammarenediol II to obtain a transgenic engineering bacterium containing the Y33-BmCYP068 recombinant plasmid; (3) Culturing the transgenic engineering bacterium containing the Y33-BmCYP068 recombinant plasmid in a liquid medium of SC-His-Leu-Ura at 30 °C and 220 rpm for 5 days, and then centrifuging at 5000 rpm for 30 min to collect the cells; (4) Lysing and breaking the cell wall of the collected cells with a lysis solution, then extracting with a mixed solution of petroleum ether and ethyl acetate with a volume ratio of 1:1, concentrating and drying the extract, and performing column chromatography to obtain the dammarenediol derivative shown in formula (1).

4. Use of the dammarenediol derivative according to claim 3 in the preparation of an anti-cancer drug, characterized in that: In step (4), the lysis solution is a solvent with a volume concentration of 50% EtOH, and KOH is added to a mass concentration of 20%.

5. Use of the dammarenediol derivative according to claim 3 in the preparation of an anti-cancer drug, characterized in that: In step (4), the extraction is performed three times.

6. Use of the dammarenediol derivative according to claim 3 in the preparation of an anti-cancer drug, characterized in that: In step (4), during concentration and drying, a rotary evaporator is used for concentration and drying at 50 °C.

7. Use of the dammarenediol derivative according to claim 3 in the preparation of an anti-cancer drug, characterized in that: In step (4), during silica gel column chromatography, a mixed solvent of petroleum ether and ethyl acetate is used as the eluent for gradient elution, and the gradient elution ratios are 12:1, 10:1, 8:1, 6:1, 4:1, 2:1, 1.5:1 in sequence; TLC is used for tracking.

Citation Information

Patent Citations

  • Bacillus subtilis glycosyltransferase and application thereof

    CN108728423A

  • P450 enzyme gene BmCYP068 of bacopa monnieri and application thereof

    CN117327715A

  • Gene Expression Inflammatory Age and Its Uses

    US20220291237A1