Hemonchus contortus subunit vaccine

Abstract

The invention discloses a haemonchus contortus subunit vaccine, and belongs to the field of veterinary vaccines. The subunit vaccine comprises an antigen protein MEP3, an antigen protein AP1, an antigen protein AP8, an antigen protein H11-2, an antigen protein H11-4 and an antigen protein AP5 of galactosylated and modified haemonchus contortus, and the antigen protein MEP3, the antigen protein AP1, the antigen protein AP8, the antigen protein H11-2, the antigen protein H11-4 and the antigen protein AP5 of galactosylated and modified haemonchus contortus. The galactosylation modification of the antigen protein is realized by jointly expressing glycosyl transferase HcGALT of haemonchus contortus and one or more of the proteins in eukaryotic cells. The antigen protein modified by galactosylation in the subunit vaccine is closer to the glycosylation modification of natural protein, and can provide effective immune protection after the goat is infected with haemonchus contortus, and the egg laying rate is reduced by 81.43%. The invention lays a foundation for development of haemonchus contortus subunit vaccines, provides an effective technical means for prevention and treatment of the haemonchus contortus subunit vaccines, and has important application value and popularization prospect.

Description

Technical Field

[0001] The invention belongs to the field of veterinary vaccines, and in particular relates to a subunit vaccine of Haemonchus contortus. Background Art

[0002] Haemonchus contortus is a disease caused by the nematode Haemonchus contortus of the genus Haemonchus in the family Trichophyton. Haemonchus contortus ) is a blood-sucking parasitic nematode disease caused by parasitic nematodes in the stomach of ruminants such as sheep and cattle. It is one of the most important parasitic diseases of small ruminants; the main clinical symptoms are emaciation, weakness and anemia, and in severe cases, it can cause the death of infected animals. The disease is highly pathogenic and widely distributed, and is prevalent in temperate, subtropical and tropical regions; in almost all provinces in my country, there are reports of the prevalence of Haemonchus twisterus disease, which has caused huge economic losses to the ruminant animal breeding industry and seriously hindered the development of my country's cattle and sheep breeding industry.

[0003] At present, the prevention and control of Haemonchus twister disease still mainly relies on chemical drugs. The long-term and frequently used anti-helminth drugs mainly include benzimidazoles (such as albendazole), imidazothiazoles (such as levamisole), macrolides (such as ivermectin, avermectin) and aminoacetylcyanide derivatives. However, the irrational use of drugs has led to serious drug resistance problems in Haemonchus twister worldwide. The only commercial vaccine currently available for Haemonchus twister is Barbervax®, which is composed of natural H11 protein and H-gal-GP protein from the intestine of the worm. However, since the worm cannot be cultured in vitro, it needs to be obtained from infected animals, resulting in low yields of natural protein antigens, making it difficult to achieve large-scale production to meet the needs of prevention and control. However, various forms of recombinant proteins failed to achieve good protective effects after immunization. After the four subtypes of natural H11 (H11, H11-1, H11-2, and H11-4) were recombinantly expressed in Hi5 insect cells and mixed with goats for immunization, the protective effect on egg reduction rate was 66.29%, with no significant difference (Liu et al., 2025); the components MEP1, MEP3, and MEP4 of H-gal-GP were recombinantly expressed in Sf9 insect cells, and another component PEP1 was expressed in Escherichia coli. After mixed immunization of goats, the protective effect on egg reduction rate was 2.5% (Cachat, Newlands, Ekoja, McAllister, & Smith, 2010); other recombinant proteins also failed to induce good immune protection in goats (Roberts et al., 2013; Smith, Newlands, Smith, Pettit, & Skuce, 2003; Smith, Skuce, Newlands, Smith,& Pettit, 2003).

[0004] References: Cachat, E., Newlands, G. F. J., Ekoja, S. E., McAllister, H., &Smith, W. D. (2010). Attempts to immunize sheep against Haemonchus contortususing a cocktail of recombinant proteases derived from the protectiveantigen, H-gal-GP. PARASITE IMMUNOLOGY, 32(6), 414 - 419. Liu, H., Zhang, Y., Li, J., Liu, F., Ye, L., Liu, X.,... Hu, M.(2025). Identification and validation of protective glycoproteins inHaemonchus contortus H11. FRONTIERS IN IMMUNOLOGY, 16, 1521022. Roberts, B., Antonopoulos, A., Haslam, S. M., Dicker, A. J.,McNeilly, T. N., Johnston, S. L.,... Britton, C. (2013). Novel expressionof Haemonchus contortus vaccine candidate aminopeptidase H11 using the free-living nematode Caenorhabditis elegans. VETERINARY RESEARCH, 44. Smith, W. D., Newlands, G. F. J., Smith, S. K., Pettit, D., & Skuce,P. J. (2003). Metalloendopeptidases from the intestinal brush border ofHaemonchus contortus as protective antigens for sheep. PARASITE IMMUNOLOGY,25(6), 313 - 323. Smith, W. D., Skuce, P. J., Newlands, G. F. J., Smith, S. K., & Pettit, D. (2003). Aspartyl proteases from the intestinal brush border of Haemonchus contortus as protective antigens for sheep. PARASITE IMMUNOLOGY, 25(11 - 12), 521 - 530. Summary of the Invention

[0005] An object of the present invention is to overcome the disadvantages and deficiencies of the prior art, and to provide an antigen combination of Haemonchus contortus and its application in the preparation of a subunit vaccine against Haemonchus contortus, aiming to solve the problems raised in the above - mentioned background art.

[0006] The object of the present invention is achieved by the following technical solutions: An antigen protein combination of Haemonchus contortus, comprising galactosylated antigen proteins MEP3, AP1, AP8, H11 - 2, H11 - 4, and AP5 of Haemonchus contortus. Among them, the galactosylation modification is preferably achieved by co - expressing the glycosyltransferase HcGALT of Haemonchus contortus with one or more of the above proteins in eukaryotic cells. The eukaryotic cells include mammalian cells, insect cells, plant cells, etc. The mammalian cells include human embryonic (HEK) 293 cells, Chinese hamster ovary (CHO) cells, etc. The insect cells include Sf9 cells, Hi5 cells, Sf21 cells, etc. The amino acid sequence of the glycosyltransferase HcGALT is shown in SEQ ID NO.1, the amino acid sequence of the antigen protein MEP3 is shown in SEQ ID NO.2, the amino acid sequence of the antigen protein AP1 is shown in SEQ ID NO.3, the amino acid sequence of the antigen protein AP8 is shown in SEQ ID NO.4, the amino acid sequence of the antigen protein H11 - 2 is shown in SEQ ID NO.5, the amino acid sequence of the antigen protein H11 - 4 is shown in SEQ ID NO.6, and the amino acid sequence of the antigen protein AP5 is shown in SEQ ID NO.7.

[0007] The preparation method of the Haemonchus contortus antigen protein combination comprises the following steps: constructing the nucleotide sequence encoding glycosyltransferase HcGALT and the nucleotide sequence encoding the antigen protein onto the same eukaryotic expression vector or two eukaryotic expression vectors, transfecting the constructed eukaryotic expression vector into eukaryotic cells, culturing the cells to express glycosyltransferase HcGALT and the antigen protein, and subjecting the antigen protein to galactosylation modification, and obtaining the galactosylation-modified antigen protein through purification. Among them, a signal peptide is preferably linked to the N-terminus of the glycosyltransferase HcGALT or the antigen protein, and a tag is preferably linked to the N-terminus or C-terminus of the antigen protein to facilitate the purification of the antigen protein; more preferably, a signal peptide and a tag are linked to the N-terminus of the antigen protein.

[0008] Preferably, the preparation method of the Haemonchus contortus antigen protein combination comprises the following steps: constructing the optimized nucleotide sequence encoding glycosyltransferase HcGALT onto pFastBacDual to obtain the recombinant plasmid pFastBacDual-Hcgalt, constructing the optimized nucleotide sequence encoding the antigen protein onto pFastBacDual-Hcgalt to obtain the recombinant plasmid pFastBacDual-Hcgalt-MEP3 or pFastBacDual-Hcgalt-AP1 or pFastBacDual-Hcgalt-AP8 or pFastBacDual-Hcgalt-H11-2 or pFastBacDual-Hcgalt-H11-4 or pFastBacDual-Hcgalt-AP5, obtaining the recombinant bacmid rbacmid-Hcgalt-MEP3 or rbacmid-Hcgalt-AP1 or rbacmid-Hcgalt-AP8 or rbacmid-Hcgalt-H11-2 or rbacmid-Hcgalt-H11-4 or rbacmid-Hcgalt-AP5 through transposition, packaging after transfecting Sf9 cells to obtain the recombinant baculovirus rBV-Hcgalt-MEP3 or rBV-Hcgalt-AP1 or rBV-Hcgalt-AP8 or rBV-Hcgalt-H11-2 or rBV-Hcgalt-H11-4 or rBV-Hcgalt-AP5, infecting Hi5 cells with the recombinant baculovirus rBV-Hcgalt-MEP3 or rBV-Hcgalt-AP1 or rBV-Hcgalt-AP8 or rBV-Hcgalt-H11-2 or rBV-Hcgalt-H11-4 or rBV-Hcgalt-AP5 to express the target protein, and purifying to obtain galactosylation-modified MEP3 or AP1 or AP8 or H11-2 or H11-4 or AP5.

[0009] In the preparation method of the above-mentioned Haemonchus contortus antigen protein combination, the optimized nucleotide sequence encoding glycosyltransferase HcGALT is shown as SEQ ID NO.8, the optimized nucleotide sequence encoding antigen protein MEP3 is shown as SEQ ID NO.9, the optimized nucleotide sequence encoding antigen protein AP1 is shown as SEQ ID NO.10, the optimized nucleotide sequence encoding antigen protein AP8 is shown as SEQ ID NO.11, the optimized nucleotide sequence encoding antigen protein H11-2 is shown as SEQ ID NO.12, the optimized nucleotide sequence encoding antigen protein H11-4 is shown as SEQ ID NO.13, and the optimized nucleotide sequence encoding antigen protein AP5 is shown as SEQ ID NO.14.

[0010] In the preparation method of the above-mentioned Haemonchus contortus antigen protein combination, the N-terminus of the glycosyltransferase HcGALT or the antigen protein may also be linked with a Kozak sequence, a signal peptide sequence, and a tag sequence. The signal peptide sequence is preferably MKTIIALSYIFCLVFAAG (SEQ ID NO.15), and the tag is preferably one or two of a Flag tag and a 10×His tag. The signal peptide, the tag, and the antigen protein are preferably linked through a flexible Linker (preferably GS).

[0011] In the preparation method of the above-mentioned Haemonchus contortus antigen protein combination, the antigen proteins MEP3, AP1, AP8, H11-2, H11-4, and AP5 are all obtained by eukaryotic expression. The expression host is the Hi-5 insect cell line, and the expression vector is the pFastBacDual vector. The antigen proteins are tandemly expressed with galactosyltransferase HcGALT, and the galactosylated modified antigen proteins are purified through the tag during protein purification, without retaining galactosyltransferase.

[0012] Use of the above-mentioned Haemonchus contortus antigen protein combination in the preparation of a Haemonchus contortus vaccine.

[0013] A Haemonchus contortus subunit vaccine, comprising the above-mentioned Haemonchus contortus antigen combination and further comprising an adjuvant. The adjuvant is preferably a saponin adjuvant.

[0014] The present invention has the following advantages and effects compared with the prior art: (1) The subunit vaccine prepared from the antigen protein combination of the present invention can provide effective immune protection after goats are infected with Haemonchus contortus, and the egg-laying rate is reduced by 81.43%, which is the best among the reported recombinant proteins so far.

[0015] (2)Currently, the commercial vaccine Barbervax® against Haemonchus contortus is derived from the natural intestinal tract of the worm. However, since the worm cannot be cultured in vitro, the yield of natural protein antigens is low. Recombinant subunit vaccines can be expressed and purified in large quantities in vitro, reducing production costs.

[0016] (3)This invention lays a foundation for the development of an efficient subunit vaccine against Haemonchus contortus, provides an effective technical means for the prevention and control of this disease, and has important application value and promotion prospects. Brief Description of the Drawings

[0017] Figure 1 Schematic diagram for the construction of the recombinant donor plasmid.

[0018] Figure 2 PCR identification results of Bacmid.

[0019] Figure 3 Western-bolt identification results of the supernatant of each virus solution.

[0020] Figure 4 SDS-PAGE electrophoresis picture of the recombinant protein.

[0021] Figure 5 Mass spectrometry diagram of N-glycans released by PNGase F digestion of the recombinant protein.

[0022] Figure 6 Immunization and challenge procedures for animal experiments.

[0023] Figure 7 Counting results of Haemonchus contortus eggs in the feces of goats after immunization with the subunit vaccine.

[0024] Figure 8 Specific antibody levels in the sera of goats in each group.

[0025] Figure 9 Western-blot diagrams of the serum antibodies of immunized goats and control serum antibodies with the recombinant protein respectively. Detailed Description of the Invention

[0026] The present invention will be further described in detail below in conjunction with the embodiments and the drawings, but the embodiments of the present invention are not limited thereto.

[0027] Example 1: Expression of galactosylated antigen proteins MEP3, AP1, AP8, H11-2, H11-4, and AP5 of Haemonchus contortus 1. Construction of the recombinant donor plasmid The glycosyltransferase HcGALT or related antigen protein in the present invention is a truncated protein fragment designed according to the sequences published in GenBank (HcGALT: CDJ84420.1, MEP3: AAC31568.1, AP1: AML39755.1, AP8: XGW06241.1, H11-2: CAB57358.1, H11-4: CAC39009.1, AP5: AML39759.1): the HcGALT protein 27-442 AAs (glycosyltransferase HcGALT), the MEP3 protein 30-837 AAs (antigen protein MEP3), the AP1 protein 36-971 AAs (antigen protein AP1), the AP8 protein 74-978 AAs (antigen protein AP8), the H11-2 protein 36-972 AAs (antigen protein H11-2), the H11-4 protein 36-971 AAs (antigen protein H11-4), the AP5 protein 36-973 AAs (antigen protein AP5). The nucleotide sequences encoding each protein fragment were codon-optimized. The optimized nucleotide sequence encoding the HcGALT protein 27-442 AAs is shown in SEQ ID NO.8, the optimized nucleotide sequence encoding the MEP3 protein 30-837 AAs is shown in SEQ ID NO.9, the optimized nucleotide sequence encoding the AP1 protein 36-971 AAs is shown in SEQ ID NO.10, the optimized nucleotide sequence encoding the AP8 protein 74-978 AAs is shown in SEQ ID NO.11, the optimized nucleotide sequence encoding the H11-2 protein 36-972 AAs is shown in SEQ ID NO.12, the optimized nucleotide sequence encoding the H11-4 protein 36-971 AAs is shown in SEQ ID NO.13, and the optimized nucleotide sequence encoding the AP5 protein 36-973 AAs is shown in SEQ ID NO.14.

[0028] (1) Insert the Kozak sequence, SIP signal peptide, and Flag tag at the N-terminus of the HcGALT protein 27-442 AAs. Entrust Pujian Biology (Wuhan) Technology Co., Ltd. to synthesize the Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-optimized HcGALT protein 27-442 AAs coding sequence, and insert the synthesized sequence between the XhoI and KpnI sites of pFastBacDual to construct the pFastBacDual-Hcgalt plasmid.

[0029] The Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-optimized HcGALT protein 27-442 AAs coding sequence is: GCCGCCACCATGAAAACTATTATCGCCTTGTCTTATATATTCTGCCTTGTTTTTGCGGCCGGGGGCTCGGATTACAAGGATGATGATGATAAAGGGTCA (SEQ ID NO.16) - the sequence shown in SEQ ID NO.8.

[0030] (2) Insert the Kozak sequence, SIP signal peptide, Flag tag, and 10×His tag at the N-terminus of MEP3 protein 30 - 837 AAs, AP1 protein 36 - 971 AAs, AP8 protein 74 - 978 AAs, H11 - 4 protein 36 - 971 AAs, and AP5 protein 36 - 973 AAs respectively. Entrust PuJian Biotechnology (Wuhan) Co., Ltd. to synthesize the relevant sequences, and insert the synthesized sequences into the middle of the BamHI and EcoRI sites of the pFastBacDual-Hcgalt plasmid to construct pFastBacDual-Hcgalt-MEP3, pFastBacDual-Hcgalt-AP1, pFastBacDual-Hcgalt-AP8, pFastBacDual-Hcgalt-H11 - 4, and pFastBacDual-Hcgalt-AP5 plasmids.

[0031] Insert the Kozak sequence, SIP signal peptide, and 10×His tag at the N-terminus of H11 - 2 protein 36 - 972 AAs. Entrust PuJian Biotechnology (Wuhan) Co., Ltd. to synthesize the Kozak sequence - SIP signal peptide coding sequence - 10×His tag coding sequence - optimized H11 - 2 protein 36 - 972 AAs coding sequence, and insert the synthesized sequence into the middle of the BamHI and EcoRI sites of the pFastBacDual-Hcgalt plasmid to construct pFastBacDual-Hcgalt-H11 - 2 plasmid.

[0032] Among them, the Kozak sequence - SIP signal peptide coding sequence - Flag tag coding sequence - 10×His tag coding sequence - optimized MEP3 protein 30 - 837 AAs coding sequence is: GCCGCCACCATGAAGACCATCATCGCCCTCTCATACATCTTTTGCCTCGTGTTCGCCGCCGGCGGCAGCGACTACAAGGACGACGACGACAAGGGTAGCCACCACCATCACCACCATCACCACCACCACGGTAGC (SEQ IDNO.17) - the sequence shown in SEQ ID NO.9.

[0033] The Kozak sequence - SIP signal peptide coding sequence - Flag tag coding sequence - 10×His tag coding sequence - optimized coding sequence of AP1 protein 36 - 971 AAs is: GCCGCCACCATGAAAACAATAATAGCGCTGAGCTATATATTCTGCCTCGTGTTTGCCGCCGGCGGTTCTGATTATAAAGATGACGACGACAAGGGTTCTCATCACCACCACCATCATCATCATCATCATGGTTCT (SEQ ID NO.18) - the sequence shown in SEQ ID NO.10.

[0034] The Kozak sequence - SIP signal peptide coding sequence - Flag tag coding sequence - 10×His tag coding sequence - optimized coding sequence of AP8 protein 74 - 978 AAs is: GCCGCCACCATGAAGACTATAATCGCTCTCTCGTATATTTTTTGCCTGGTCTTCGCCGCAGGTGGGTCGGATTATAAGGATGACGATGACAAAGGATCACACCATCATCATCACCATCATCACCATCACGGAAGT (SEQ ID NO.19) - the sequence shown in SEQ ID NO.11.

[0035] The Kozak sequence - SIP signal peptide coding sequence - Flag tag coding sequence - 10×His tag coding sequence - optimized coding sequence of H11 - 4 protein 36 - 971 AAs is: GCCGCCACCATGAAGACAATCATTGCACTGAGTTACATATTCTGTCTCGTCTTCGCAGCTGGTGGTTCGGACTACAAAGACGACGACGATAAAGGAAGTCATCACCACCACCACCACCACCATCATCATGGGAGC (SEQ ID NO.20) - the sequence shown in SEQ ID NO.13.

[0036] The Kozak sequence - SIP signal peptide coding sequence - Flag tag coding sequence - 10×His tag coding sequence - optimized coding sequence of AP5 protein 36 - 973 AAs is: GCCGCCACCATGAAAACTATAATTGCTCTTAGTTACATCTTCTGTCTTGTGTTCGCGGCCGGAGGCTCAGATTACAAGGACGATGACGATAAAGGGTCCCACCACCATCATCATCACCATCATCATCATGGGTCG (SEQ ID NO.21) - the sequence shown in SEQ ID NO.14.

[0037] The Kozak sequence - the SIP signal peptide coding sequence - the 10×His tag coding sequence - the optimized H11-2 protein 36-972 AAs coding sequence is: GCCGCCACCATGAAAACTATCATAGCATTGTCGTACATATTCTGCCTCGTTTTCGCCGCAGGTGGTTCCCATCATCACCACCACCATCACCACCATCACGGATCG (SEQ ID NO.22) - the sequence shown in SEQ ID NO.12.

[0038] The schematic diagram of the construction of the above recombinant plasmid is as Figure 1 shown.

[0039] 2. Construction of recombinant Bacmid (baculovirus plasmid) (1) Thaw the DH10Bac competent cells on ice.

[0040] (2) Add 200 ng of pFastBacDual-Hcgalt-MEP3, pFastBacDual-Hcgalt-AP1, pFastBacDual-Hcgalt-AP8, pFastBacDual-Hcgalt-H11-2, pFastBacDual-Hcgalt-H11-4, pFastBacDual-Hcgalt-AP5 plasmids into the competent cells respectively. After gently flicking the tube wall to mix, let it stand on ice for 30 min, and then place it in a 42°C water bath for heat shock for 60 s.

[0041] (3) Quickly transfer it to an ice bath. After cooling for 2 min, add 500 μL of sterile LB medium without antibiotics to the EP tube, mix well, and then place it in a shaker at 37°C and 220 rpm for 4 h.

[0042] (4)Perform 10-fold serial dilutions with LB medium. Take 100 μL of the bacterial solution diluted 100-fold and spread it on an LB plate containing 50 mg / mL kanamycin, 7 mg / mL gentamicin, 10 mg / mL tetracycline, 100 mg / mL X-gal, and 40 mg / mL IPTG. Invert the plate and place it in an incubator at 37 °C for 48 h.

[0043] (5)Select white single colonies and streak them on an LB plate containing 50 mg / mL kanamycin, 7 mg / mL gentamicin, 10 mg / mL tetracycline, 100 mg / mL X-gal, and 40 mg / mL IPTG. Invert the plate and place it in an incubator at 37 °C for 24 h. As long as the grown colonies are all white colonies.

[0044] 3. Extraction and Identification of Recombinant Bacmid Inoculate the above-mentioned white single colonies into an LB liquid medium containing 50 mg / mL kanamycin, 7 mg / mL gentamicin, and 10 mg / mL tetracycline. Shake the bacteria at 37 °C and 220 rpm for 12 - 16 h. Collect the bacterial solution and use the Biyuntian baculovirus shuttle vector bacmid miniprep kit to extract bacmid. Perform PCR amplification according to the primer sequences in Table 1. The electrophoresis result of the product is as Figure 2 shown, indicating that a fragment consistent with the size of the target fragment has been successfully amplified and the sequencing is correct, proving that the recombinant baculovirus plasmid has been successfully constructed.

[0045] Table 1 PCR Primers for Identification of Recombinant Plasmids Primer Name Primer Sequence M13-Forward 5’-TGTAAAACGACGGCCAGT-3’ (SEQ ID NO.23) M13-Reserve 5’-CAGGAAACAGCTATGACC-3’ (SEQ ID NO.24) 4. Transfect Sf9 Cells with Recombinant Bacmid for Virus Packaging (1)Culture of Sf9 insect cells: Sf9 cells are a semi-adherent cell line and can be cultured in suspension. Their optimal culture temperature is 27 °C - 28 °C, and they do not require CO2 during growth. They have a relatively fast growth rate, and the passage time is about 3 days.

[0046] (2)Count the cultured Sf9 cells and take about 1×10 6 Sf9 cells and place them in a six-well plate. Let them stand in the cell culture incubator for 20 min - 40 min to wait for the cells to adhere.

[0047] (3)Prepare the plasmid and transfection reagent: Take 2 sterile EP centrifuge tubes. Add 100 μL of cell culture medium Sf-900TM SFM and 8 μL of transfection reagent Cellfectin to one tube, and add 100 μL of cell culture medium Sf-900TM SFM and 3 μg of baculovirus plasmid (volume about 2 μL) to the other tube. Let them stand for 5 min and then mix well, and then let them stand for another 30 min.

[0048] (4) After the cells are completely adherent, tilt the six-well plate, aspirate the culture medium along the well wall, then add 800 μL of Sf-900TM SFM culture medium along the well wall, and then add 210 μL of the mixed Bacmid and transfection reagent.

[0049] (5) After covering the six-well plate, make marks on the experimental group, negative control, and blank control, and place them in an incubator for 4 h to successfully transfect the Sf9 insect cells with the baculovirus.

[0050] (6) After 4 h, tilt the six-well plate, aspirate the culture medium along the well wall, then add complete culture medium (Sf-900TM SFM culture medium containing 10% fetal bovine serum) along the well wall, stick on the sealing film and place it in an incubator for 96 h until the cells show typical signs of virus infection, the cell diameter becomes larger, the cells become brighter and rounder, indicating successful transfection. The packaging of P0-generation recombinant baculoviruses P0-rBV-Hcgalt-MEP3, P0-rBV-Hcgalt-AP1, P0-rBV-Hcgalt-AP8, P0-rBV-Hcgalt-H11-2, P0-rBV-Hcgalt-H11-4, P0-rBV-Hcgalt-AP5 is completed, and the supernatant is collected as the virus solution containing P0-generation recombinant baculoviruses.

[0051] 5. Amplification of P1, P2, and P3-generation viruses Prepare Sf9 cells in the exponential growth phase with a density of 2×10 6 cells / mL, inoculate the P0-generation recombinant baculovirus solution at a ratio of 1:30, centrifuge to collect the virus after culturing for 4 - 5 d, and the supernatant is the P1-generation recombinant baculovirus. Similarly, amplify the P2 and P3-generation recombinant baculoviruses.

[0052] 6. Verification of protein expression Prepare High Five (Hi-5) cells in the exponential growth phase with a density of 2×10 6 cells / mL, infect Hi-5 cells with the P3-generation recombinant baculovirus at a multiplicity of infection (MOI) of 0.1, culture at 28 °C and 120 rpm for 96 h, and centrifuge to collect the supernatant. Detect the protein expression by western blot. The primary antibody used is anti-His mouse monoclonal antibody, and the secondary antibody is HRP-goat anti-mouse secondary antibody. The results are as Figure 3 shown, and all proteins are successfully expressed in Hi-5 cells.

[0053] 7. Protein purification The purification of recombinant proteins is mainly carried out through the His-tag on the target protein. The galactosyltransferase HcGALT functions in the virus solution to transfer galactose residues to the N-glycosylation modification of the target protein. Since it does not carry the His-tag, it will not bind to the filler and will not appear in the eluate. Finally, the galactosylated target proteins Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4, Gal-rAP5 ( Figure 4 ). The concentration of the purified target protein was determined by the BCA method.

[0054] 8. Preparation of N-glycans and MALDI-ToF analysis of protein samples The workflow for N-glycan preparation includes enzymatic digestion, enrichment, and permethylation derivatization of glycans. The specific steps for processing each protein sample are as follows: (1) Treatment of protein samples: Take 200 μg of the above-mentioned purified target protein, add methanol, sterile water, and chloroform in a ratio of methanol: water: chloroform = 600 μL: 600 μL: 150 μL. After pipetting and mixing well with a pipette tip, vortex. At this time, the sample solution is milky white; centrifuge the sample solution at 10,000 r / min for 3 min, and a white flocculent film appears in the middle of the solution. Aspirate and discard the supernatant; add 500 μL of methanol to wash the protein film, pipette and vortex to mix well, centrifuge at 12,000 r / min for 3 min, discard the supernatant and retain the precipitate, and place the precipitate sample in a vacuum rotary evaporator for about 30 min.

[0055] (2) PNGase F digestion and enrichment of glycans: Use the PNGase F deglycosylation kit from Beyotime. Add 2 μL of 10×Denaturing Buffer and 18 μL of ddH2O to the dried protein sample. After vortexing thoroughly, boil at 100 °C for 10 min for denaturation. After the denaturation is completed, immediately place it on ice for pre-cooling for 1 min. Then, add 4 μL of 10×ReactionBuffer, 4 μL of 10×Renaturing Buffer, and 12 μL of ddH2O in sequence. After vortexing thoroughly, add 2 μL of PNGase F enzyme, vortex thoroughly, and incubate at 37 °C for 1 - 4 hours.

[0056] (3) Desalt and purify the glycan released by PNGase F using a porous graphitic carbon column (PGC column). The specific steps are as follows: First, activate the PGC column with 3 mL of acetonitrile and 3 mL of cleaning solution, and then equilibrate the PGC column with 3 mL of equilibration solution. Next, load the sample diluted with the equilibration solution onto the PGC column. After the sample in the PGC column settles by natural gravity, rinse it 3 times with 3 mL of equilibration solution to remove impurities such as proteins, polypeptides, and salts. Finally, elute the sample with 1 mL of elution solution and dry the sample using a vacuum rotary evaporator.

[0057] (4) Global methylation derivatization of the glycan: Dissolve the glycan sample released by PNGase F in 50 μL of dimethyl sulfoxide (DMSO), and then add it to 100 μL of DMSO-NaOH homogenate and mix well. Then, add 50 μL of methyl iodide in a fume hood and vortex thoroughly at room temperature for 15 min until the solution turns milky white. Then, add 500 μL of ultrapure water to terminate the reaction, and add 250 μL of chloroform for extraction. After liquid phase separation, gently remove the upper layer, and thoroughly wash the lower organic phase containing the glycan with 1 mL of ultrapure water 5 times. Finally, transfer the two organic phases to a new centrifuge tube and dry them using a vacuum rotary evaporator.

[0058] MALDI-ToF analysis, the specific steps are as follows: (1) Dissolve the dried global methylation derivatized glycan in 15 μL of methanol solution.

[0059] (2) Mix 1 μL of the glycan solution with 1 μL of DHB (2,5-dihydroxybenzoic acid) thoroughly.

[0060] (3) Spot 1 μL of the sample to be tested on the MALDI metal plate and let it crystallize at room temperature.

[0061] (4) Then use SCIEX's MALDI 5800 ToF / ToF to detect the sample: The relevant parameters of the instrument are set as follows: detection mode, positive ion reflector mode (Reflector Positive); acceleration voltage 20 kV; laser intensity 5000; use 2 kV collision energy and perform MS / MS analysis with air as the CID gas; each spectrum consists of 1000 shots.

[0062] (5) The final data is analyzed by software Data Explorer 4.0, and the putative N-glycan structures are obtained by analyzing with software GlycoWorkbench 2.1. The N-glycosylation profile results of the recombinant protein are as Figure 5As shown, an ion peak at m / z 1550.0 (±0.4) was present in the glycan samples isolated from Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4, and Gal-rAP5 proteins ( Figure 5 as indicated by the arrow). Its size was a galactose structure added to the glycan structure with an ion peak at m / z 1345.7, indicating that the galactosyltransferase HcGALT successfully performed the function of transferring galactose to α1,6 fucose.

[0063] Example 2: Immunoprotection experiment of the antigen protein combination of Haemonchus contortus The above six purified proteins were mixed for a goat immunoprotection experiment, and an adjuvant control group and an immunization group were set up, with 5 goats in each group. Before the experiment, the animals were examined for feces 5 times, and no eggs were found. Each goat in the experimental group was immunized with 50 μg of each of the recombinant proteins Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4, and Gal-rAP5 in combination with 500 μg of Quil-A (saponin) adjuvant. Each goat in the control group was only immunized with 500 μg of Quil-A adjuvant. All were immunized by multiple subcutaneous injections in the neck and back, once every three weeks for three times, and the fourth immunization was two weeks after the third immunization, for a total of four immunizations. At the 3rd immunization, all goats were orally infected with 7000 infective third-stage larvae of Haemonchus contortus. Starting from the first immunization, blood samples were collected once every 7 days, and a total of 11 sera were collected. The changes in the antibody levels in goat sera were detected by indirect ELISA. The overall protocol of the animal experiment was as Figure 6 shown. Starting from the 18th day after the challenge, fecal samples were collected from the rectum every 1 day for fecal egg count (FEC) to determine the number of eggs per gram of feces in goats. A total of six collections were made, and the egg reduction rate was calculated as = (egg count in the control group - egg count in the immunization group) / egg count in the control group.

[0064] The results of the fecal egg count were as Figure 7 shown. The egg reduction rate on the 62nd day of the animal experiment was 90.13%, on the 64th day was 85.22%, on the 66th day was 75.12%, on the 68th day was 81.59%, on the 70th day was 82.89%, and the cumulative egg reduction rate was 81.43%, which was the best egg reduction effect among all reported recombinant proteins to date.

[0065] The dynamic detection of the serum specific IgG antibody level against the immunized mixed recombinant antigen was carried out by ELISA method, and the results were as Figure 8As shown, after the first immunization, the serum IgG antibodies of the experimental group goats showed a significant upward trend, reached the peak one week after the second immunization, and then showed a slight downward trend, but the antibody levels remained at a relatively high level.

[0066] The Western-blot results of the serum antibodies of the immunized group goats and the control group goats with the recombinant protein are as Figure 9 shown. Compared with the adjuvant control group, specific IgG antibodies against Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4, and Gal-rAP5 were detected in the sera of the immunized groups, indicating that all six recombinant proteins had good immunogenicity.

[0067] The above embodiments are only used to help illustrate the present invention. The implementation manners of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement manners and are all included in the protection scope of the present invention.

Claims

1. A combination of Haemonchus contortus antigen proteins, characterized in that: Antigenic proteins MEP3, AP1, AP8, H11-2, H11-4, and AP5 of Haemonchus contortus containing galactosylation modification; wherein the galactosylation modification is achieved by co-expressing the glycosyltransferase HcGALT of Haemonchus contortus with one or more of the above proteins in eukaryotic cells; The amino acid sequence of the glycosyltransferase HcGALT is shown in SEQ ID NO.1, the amino acid sequence of the antigenic protein MEP3 is shown in SEQ ID NO.2, the amino acid sequence of the antigenic protein AP1 is shown in SEQ ID NO.3, the amino acid sequence of the antigenic protein AP8 is shown in SEQ ID NO.4, the amino acid sequence of the antigenic protein H11-2 is shown in SEQ ID NO.5, the amino acid sequence of the antigenic protein H11-4 is shown in SEQ ID NO.6, and the amino acid sequence of the antigenic protein AP5 is shown in SEQ ID NO.

7.

2. The preparation method of the Haemonchus contortus antigen protein combination according to claim 1, characterized in that: It includes the following steps: constructing the nucleotide sequence encoding the glycosyltransferase HcGALT and the nucleotide sequence encoding the antigenic protein onto the same eukaryotic expression vector or two eukaryotic expression vectors, transfecting the constructed eukaryotic expression vector into eukaryotic cells, culturing the cells to express the HcGALT protein and the antigenic protein, and subjecting the antigenic protein to galactosylation modification, and obtaining the galactosylation-modified antigenic protein through purification.

3. The preparation method of the antigen protein combination of Haemonchus contortus according to claim 2, wherein: A signal peptide is linked to the N-terminus of the glycosyltransferase HcGALT or the antigenic protein, and a tag is linked to the N-terminus or C-terminus of the antigenic protein.

4. The preparation method of the antigen protein combination of Haemonchus contortus according to claim 2, wherein: It includes the following steps: The nucleotide sequence of the optimized and modified glycosyltransferase HcGALT was constructed onto pFastBacDual to obtain the recombinant plasmid pFastBacDual-Hcgalt. The nucleotide sequence of the optimized and modified antigen protein was constructed onto pFastBacDual-Hcgalt to obtain the recombinant plasmids pFastBacDual-Hcgalt-MEP3, pFastBacDual-Hcgalt-AP1, pFastBacDual-Hcgalt-AP8, pFastBacDual-Hcgalt-H11-2, pFastBacDual-Hcgalt-H11-4, or pFastBacDual-Hcgalt-AP5. Through transposition, the recombinant bacmids rbacmid-Hcgalt-MEP3, rbacmid-Hcgalt-AP1, rbacmid-Hcgalt-AP8, rbacmid-Hcgalt-H11-2, rbacmid-Hcgalt-H11-4, or rbacmid-Hcgalt-AP5 were obtained. After transfection of Sf9 cells, the recombinant baculoviruses rBV-Hcgalt-MEP3, rBV-Hcgalt-AP1, rBV-Hcgalt-AP8, rBV-Hcgalt-H11-2, rBV-Hcgalt-H11-4, or rBV-Hcgalt-AP5 were packaged. The target proteins were expressed by infecting Hi5 cells with the recombinant baculoviruses rBV-Hcgalt-MEP3, rBV-Hcgalt-AP1, rBV-Hcgalt-AP8, rBV-Hcgalt-H11-2, rBV-Hcgalt-H11-4, or rBV-Hcgalt-AP5, and galactosylated MEP3, AP1, AP8, H11-2, H11-4, or AP5 were purified. The nucleotide sequence of the optimized and modified glycosyltransferase HcGALT is shown in SEQ ID NO.

8. The nucleotide sequence of the optimized and modified antigen protein MEP is shown in SEQ ID NO.

9. The nucleotide sequence of the optimized and modified antigen protein AP1 is shown in SEQ ID NO.

10. The nucleotide sequence of the optimized and modified antigen protein AP8 is shown in SEQ ID NO.

11. The nucleotide sequence of the optimized and modified antigen protein H11-2 is shown in SEQ ID NO.

12. The nucleotide sequence of the optimized and modified antigen protein H11-4 is shown in SEQ ID NO.

13. The nucleotide sequence of the optimized and modified antigen protein AP5 is shown in SEQ ID NO.

14.

5. The preparation method of the antigen protein combination of Haemonchus contortus according to claim 4, characterized in that: The N-terminus of the glycosyltransferase HcGALT or the antigen protein is linked with a Kozak sequence, a signal peptide sequence, and a tag sequence.

6. The preparation method of the Haemonchus contortus antigen protein combination according to claim 5, characterized in that: The signal peptide sequence is MKTIIALSYIFCLVFAAG, and the tag is one or both of the Flag tag and the 10×His tag. The signal peptide, the tag, and the antigen protein are connected by a flexible Linker.

7. Use of the Haemonchus contortus antigen protein combination according to claim 1 in the preparation of a Haemonchus contortus vaccine.

8. A subunit vaccine against Haemonchus contortus, characterized in that: Comprising the Haemonchus contortus antigen combination according to claim 1.

9. The subunit vaccine of Haemonchus contortus according to claim 8, wherein: It also comprises an adjuvant.

Images