Akabane disease virus recombinant virus-like particles and preparation method thereof

By optimizing the genes encoding the structural proteins Gn and Gc of Akabane disease virus and expressing them in a baculovirus-insect cell expression system, recombinant virus-like particles of Akabane disease virus were successfully prepared, solving the problem of lack of preparation of Akabane disease virus-like particles in the existing technology and realizing the application of safer virus-like particles in vaccines and immunotherapy.

CN120248055BActive Publication Date: 2025-10-03CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510408467.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-10-03
Estimated Expiration
2045-04-02

AI Technical Summary

Technical Problem

The existing technology has not yet provided a method for preparing recombinant virus-like particles of Akabane disease virus, resulting in adverse effects on biosafety in Bunyavirus-related research and a lack of effective vaccines and immunotherapy.

Method used

The baculovirus-insect cell expression system was used to optimize the genes encoding the Akabane disease virus structural proteins Gn and Gc. Recombinant virus-like particles of Akabane disease virus were obtained by expressing the recombinant plasmid in insect cells and self-assembly.

Benefits of technology

The preparation of safer AKAV virus-like particles has potential applications in vaccines and immunotherapy, providing technical reserves for biosafety monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120248055B_ABST
    Figure CN120248055B_ABST
Patent Text Reader

Abstract

The present invention discloses a recombinant virus-like particle of Akabane disease virus and a preparation method thereof, and belongs to the field of biotechnology. The recombinant virus-like particle of Akabane disease virus is obtained by recombinantly expressing the structural protein Gn and the structural protein Gc of Akabane disease virus in an insect cell-baculovirus expression system and self-assembly; the amino acid sequence of the structural protein Gn is shown in SEQ ID NO.1; the amino acid sequence of the structural protein Gc is shown in SEQ ID NO.2. The present invention optimizes the genes encoding the structural proteins Gn and Gc according to the codon preference of insect cells, and successfully prepares safer AKAV virus-like particles through the baculovirus-insect cell expression system. The AKAV virus-like particles provided by the present invention have application potential in various fields such as AKAV vaccines and immunotherapy, and provide technical reserves for biosafety monitoring.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to Akabane disease virus recombinant virus-like particles and a preparation method thereof. Background Art

[0002] Akabane virus (AKAV) is a highly contagious animal pathogen that can replicate in arthropods and infect host animals through bites. This type of virus not only causes reproductive dysfunction in economic animals such as cattle and sheep, but also seriously threatens the development of my country's animal husbandry industry and human public health safety. AKAV is a negative-strand RNA virus of the SimbuSerogroup of the Bunyaviridae family, genus Orthobunyavirus. In order to circumvent the adverse effects of Bunyavirus-related research on biosafety, existing research mostly prepares virus-like particles (VLPs) to obtain viruses that are immunogenic but not infectious. At present, Bunyaviruses for which VLPs have been prepared include Rift Valley fever virus and fever with thrombocytopenia syndrome virus, but there are no reports on the preparation methods of AKAV VLPs.

[0003] Correct glycosylation is crucial for protein antigenicity and immunogenicity, making the selection of an appropriate expression system particularly important. Currently, the baculovirus expression vector system (BEVS) is a well-established eukaryotic expression system for VLPs. Its suspension culture format is easily scalable, allowing for the simultaneous insertion of multiple exogenous genes and high-level expression of recombinant genes. Using insect cells as an expression host, BEVS can perform post-translational modifications on the expressed exogenous proteins, promoting their correct folding.

[0004] In summary, exploring the preparation method of AKAV virus-like particles is of great significance for the development of vaccines for Bunyavirus-related viruses and the prevention and control of biological risk factors. Summary of the Invention

[0005] The present invention aims to provide recombinant Akabane disease virus (AKAV) virus-like particles (VLPs) and a method for their preparation to address the aforementioned problems of the prior art. The present invention optimizes the genes encoding the structural proteins Gn and Gc according to the codon preference of insect cells and successfully produces safer AKAV VLPs using a baculovirus-insect cell expression system. AKAV VLPs have potential for application in a variety of fields, including AKAV vaccines and immunotherapy, providing a technological foundation for biosafety monitoring.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a recombinant virus-like particle of Akabane disease virus, wherein the recombinant virus-like particle of Akabane disease virus is obtained by recombinantly expressing the structural protein Gn and the structural protein Gc of Akabane disease virus in an insect cell-baculovirus expression system and self-assembling;

[0008] The amino acid sequence of the structural protein Gn is shown in SEQ ID NO.1; the amino acid sequence of the structural protein Gc is shown in SEQ ID NO.2.

[0009] Optionally, the nucleotide sequence of the gene encoding the structural protein Gn is shown as SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is shown as SEQ ID NO.4.

[0010] The present invention also provides a method for preparing the Akabane disease virus recombinant virus-like particles, comprising the following steps:

[0011] The genes encoding the structural protein Gn and the structural protein Gc were connected to an insect cell expression vector to obtain a recombinant plasmid;

[0012] The obtained recombinant plasmid was transformed into Escherichia coli competent cells to obtain the recombinant bacmid;

[0013] The obtained recombinant bacmid is transfected into insect cells to obtain recombinant baculovirus;

[0014] Infecting insect cells with the obtained recombinant baculovirus to express the structural protein Gn and the structural protein Gc, thereby obtaining Akabane disease virus recombinant virus-like particles;

[0015] The nucleotide sequence of the gene encoding the structural protein Gn is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is shown in SEQ ID NO.4.

[0016] The present invention also provides use of the Akabane disease virus recombinant virus-like particles in preparing a drug for preventing Akabane disease.

[0017] Optionally, the medicament comprises a vaccine.

[0018] The present invention also provides a medicine for preventing Akabane disease, which comprises the Akabane disease virus recombinant virus-like particles.

[0019] Optionally, the drug further comprises a pharmaceutically acceptable immune adjuvant.

[0020] Optionally, the medicament comprises a vaccine.

[0021] The present invention discloses the following technical effects:

[0022] In order to avoid the adverse effects of related research on Bunyaviruses such as Akabane disease virus on biosafety, the present invention selected the structural proteins Gn and Gc encoded by the Akabane disease virus M gene as the basic assembly elements, optimized the genes encoding the structural proteins Gn and Gc according to the codon preference of insect cells, constructed a recombinant plasmid with pathogenic structure and immunogenicity but no replication ability, and successfully prepared AKAV virus-like particles with higher safety through the baculovirus-insect cell expression system.

[0023] The AKAV virus-like particles provided by the present invention have application potential in various fields such as AKAV vaccines and immunotherapy, and provide technical reserves for biosafety monitoring. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 Design of recombinant plasmid for Akabane disease virus M gene and PCR amplification results of recombinant bacmid; A: Map of recombinant plasmid pFastBac Dual-AKAV-G; B: PCR amplification results of recombinant plasmid pFastBac Dual-AKAV-G;

[0026] Figure 2 Results of pathological changes in Sf9 cells transfected with recombinant baculovirus; A: normal Sf9 cells; B: transfection reagent control; C: pathological changes in Sf9 cells infected with recombinant baculovirus (5 μg); D: pathological changes in Sf9 cells infected with recombinant baculovirus (10 μg);

[0027] Figure 3 is the expression level of AKAV Gn / Gc protein in Sf9 cells infected with recombinant baculovirus; M: protein relative molecular weight standard;

[0028] Figure 4 The results of indirect immunofluorescence detection of recombinant baculovirus; A and C: normal Sf9 cells in the blank control group; B: Sf9 cells infected with rBac-AKAV-G (AKAV-Gc was used as the primary antibody); D: Sf9 cells infected with rBac-AKAV-G (AKAV-Gn was used as the primary antibody);

[0029] Figure 5Results of AKAV VLP purification and Western blot verification; A: Purification results by sucrose density gradient centrifugation; B: Gc / Gn protein expression in suspension bands collected at different sucrose densities;

[0030] Figure 6 Results of electron microscopy observation of VLPs; A: VLPs particle size measurement, where (1) the particle size is 0.07 μm, (2) the particle size is 0.06 μm, (3) the particle size is 0.08 μm, and (4) the particle size is 0.07 μm; B: VLP double-layer membrane structure; C: VLP glycoprotein spike structure. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1 Preparation and Identification of Akabane Disease Virus Recombinant Virus-Like Particles

[0037] 1 Materials and Methods

[0038] 1.1 Cell lines and antibodies

[0039] DH10Bac competent cells were purchased from Beijing Qingke Biotechnology Co., Ltd. Insect ovary cells (Sf9 cells) and AKAV-Gc / Gn monoclonal antibodies were stored by the Animal Inspection Institute of the Chinese Academy of Quality Inspection and Testing Sciences.

[0040] 1.2 Main Reagents

[0041] Plasmid extraction kit was purchased from Quanshijin Biotechnology Co., Ltd.; SIM SF medium was purchased from SinoBiological Company; penicillin-streptomycin, antibody diluent, SDS-PAGE preparation reagent, HRP-labeled goat anti-mouse IgG and mouse β-actin monoclonal antibody were all purchased from Beijing Solaibao Technology Co., Ltd.; KOD PCR reagent was purchased from TOYOBO Biotechnology Co., Ltd.; ExpiFectamine SF TM Transfection reagents, fetal bovine serum, and DMEM culture medium were purchased from Thermo Fisher Scientific.

[0042] 1.3 Design of the recombinant plasmid pFastBac Dual-AKAV-G

[0043] The CDS gene information for the M segment of the AKAV TJ2016 strain (GenBank sequence accession number MT761688.1) was obtained from the NCBI website. The original ORF was codon-optimized using a baculovirus insect cell expression system. BbsI / KpnI restriction endonuclease sites were added upstream and downstream of the optimized M gene sequence. The optimized sequences, Gn (amino acids 18–309) and Gc (amino acids 533–1340), were inserted downstream of the PpH and Pp10 promoters, respectively, into the p-FastBac Dual plasmid. The insertion sites downstream of the PpH promoter are 5' BamHI and 3' HindIII, while the insertion sites downstream of the Pp10 promoter are 5' BbsI and 3' KpnI. Based on this, the recombinant shuttle vector pFastBac Dual-AKAV-G was constructed. The recombinant plasmid was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0044] SEQ ID NO.1 (Gn amino acid sequence):

[0045] mpprntnggrcfyggdmfrqinstspmseicvrddislvksigyhklaanreviessmsyyrlyyvknwfecnpvqdilgtfmvfdvnhegilapktyacratcsislerdtgnvvlespalnhytihgttikngwfktkvsidldntcedlhitcghktlnvhacfrqhksciryfkgsilpevmiesictnaelillccfsaiscfvaiiltktylvyllipifypfvklyglllqrfckqckncllpihpfspcpttcicgmvynstealkvhrkclnctgyktltktr;

[0046] SEQ ID NO.2 (Gc amino acid sequence):

[0047] kdlhsatihefiaanlypnsfkkhlasagpdsikwktyiqnnnlhlcndhvvkmicrcvikqeecsstkvddgeqiaqyykknkefykadleilytvisraipglvgnllrqvlksqkyeeslhvlnkikkdvsknnqlnsivefliyinskniteevrelrirpdlsirgskftdknpgtpnikecqtplfitctgkrfrslmkqyiacsnggvklyqrpnkplalvdnklcigdkycmiafdpmvideniqkldcyslaatdqsdgmlkpersirllktgeckiagalsriavsinqknykystivhrksdlvdeyclspncdldcypyypanlvdcswsesthstlsqkvishtdiesfissvklslhndliqhhfrplsnmphvkpnfksinvqgtisggkiqdsyitfsiplmtglsqgftlqdhkgntlfdiiayvksarviatynheyktgptvsinvqhneqctgscpssipkkdnwltfsrehtstwgceewgclaigtgcvygscqdvireeatvisrvnneqlevefcvseptstmcntinvlepvlgehmqfevhsvqtnllpevaliknrrvykgsinkkgvfnpqcgsvqsfdgklygvgnpkfdyichalsrkdivvrkcyenhyyscatlkeaveiksnitnsktmlyndnallgsasvkimlgdliyqqasvqekdirghatcggctdcfndvackismtsngvyqcpivsscdsyinnvyinegtndinlkfrclkaeikisicgrempvkseiikdtkkldlasadqtsyikefdkkcatwlcrayneg;

[0048] SEQ ID NO.3 (Optimized Gn nucleotide sequence):

[0049] ATGCCACCACGTAATACCAATGGTGGAAGATGCTTCTATGGTGGTGACATGTTCCGT CAGATCAACTCCACTTCTCCAATGTCGGAAATCTGCGTCCGTGACGACATCTCGTTGGTCAAGTCCATCGGCTACCACAAATTGGCCGCTAACAGGGAGGTGATCGAATCGTCAATGTCATATTACAGGCTGTATTACGTTAAGAACTGGTTCGAGTGTAATCCAGTACAAGACATCTTGGGTACTTTCATGGTGTTCGACGTGAATCACGAGGGTATCTTGGCTCCAAAGACGTATGCTTGCCGCGCTACTTGTTCTATCTCTCTGGAGCGTGACACCGGAAACGTAGTACTTGAAAGTCCAGCACTGAACCACTACACTATTCACGGCACCACCATCAAGAACGGTTGGTTCAAGACTAAGGTGAGCATCGACCTTGACAACACGTGTGAGGACTTGCACATCACATGCGGTCATAAGACACTGAATGTCCACGCTTGCTTCCGTCAGCACAAGAGCTGTATCCGCTACTTCAAGGGTTCCATTCTGCCTGAAGTCATGATCGAGTCGATCTGTACCAACGCTGAACTCATCTTGCTGTGTTGCTTCTCCGCCATTAGCTGCTTCGTGGCGATCATCTTGACAAAGACTTATTTGGTGTACCTGCTGATCCCAATCTTCTACCCATTCGTGAAACTGTACGGATTGCTTCTTCAACGCTTCTGCAAGCAATGCAAGAACTGCCTCTTGCCAATCCATCCGTTCTCTCCATGCCCGACGACTTGCATCTGCGGTATGGTGTACAACTCCACTGAGGCACTCAAAGTGCACCGTAAGTGCTTGAACTGTACAGGTTACAAGACACTGACTAAGACCAGA;

[0050] SEQ ID NO.4 (Optimized Gc nucleotide sequence):

[0051]

[0052] 1.4 Construction and identification of recombinant bacmid rBacmid-AKAV-G

[0053] 1.4.1 Extraction of recombinant bacmid

[0054] Transform the recombinant plasmid pFastBac Dual-AKAV-G into E. coli DH10 Bac competent cells. Lyse the DH10Bac competent cells in an ice bath. Dissolve the recombinant plasmid to a concentration of 100 ng / μL. Take 1 μL and add it to 50 μL of DH10Bac competent cells. Mix gently, then place on ice for 30 minutes. Heat shock the cells in a 42°C water bath for 90 seconds, and then place them on ice again for 2 minutes. Add 700 μL of SOC medium and incubate at 37°C on a shaker at 180 rpm for 4 hours. Evenly spread 40 μL of X-gal (20 mg / mL) and 20 μL of IPTG (40 mg / mL) onto solid LB medium containing triple-antibody (50 μg / mL kanamycin, 10 μg / mL tetracycline, and 7 μg / mL gentamicin) and incubate in a 37°C incubator for 1 hour. Spread 25 μL of the bacterial suspension evenly on the above-mentioned medium and incubate inverted at 37°C for 48 hours before screening for blue-white spots. Continue inoculating single white-spotted colonies onto triple-antibody solid medium using the streak plate method until no blue spots appear. Pick a single, regularly shaped white-spotted colony and inoculate it into triple-antibody LB liquid medium. Incubate at 37°C, 200 rpm, and incubate for 14 hours. Miniprep the plasmid according to the instructions for the EasyPure Plasmaid MiniPrep Kit (Trans, EM101). Neutralize with Neutralization Buffer, centrifuge, and transfer the supernatant to a new EP tube. Add an equal volume of isopropanol and mix thoroughly by inversion. Let stand for 15 minutes to precipitate the DNA. Centrifuge at 12,000 × g for 2 minutes, discard the supernatant, resuspend in 75% ethanol, and centrifuge again. Wash twice with ethanol as described above, discard the ethanol, and let stand at room temperature for 5 minutes to fully evaporate the ethanol. 72°C preheated ddH2O was added to the tube to dissolve the recombinant bacmid rBacmid-AKAV-G, which was labeled and stored at -20°C.

[0055] 1.4.2 Identification of recombinant bacmids

[0056] The gene sequence of the recombinant bacmid, rBacmid-AKAV-G, was identified using universal primers M13-R and M13-F. The reaction system consisted of 0.5 μL of KOD FX Neo, 12.5 μL of 2× KOD FX Neo Buffer, 5 μL of dNTPs, 0.5 μL of each upstream and downstream primer, 5 μL of ddH2O, and 1 μL of recombinant bacmid, for a total of 25 μL. PCR reaction conditions were: 94°C for 2 minutes; 35 cycles of 98°C for 1 second, 55°C for 3 seconds, and 68°C for 3 minutes; and 68°C for 7 minutes.

[0057] 5 μL of PCR product was used for sequencing identification, and sequencing was completed by Beijing Qingke Biotechnology Co., Ltd.

[0058] Mix 5 μL of the PCR product with 1 μL of 6× Gel Loading Dye, run electrophoresis at 150 V for 25 minutes, and visualize on a developer. rBacmid-AKAV-G that matches the expected sequence and has the correct sequencing results can be used for the next step.

[0059] 1.5 Preparation and identification of recombinant baculovirus rBac-AKAV-G

[0060] 1.5.1 Preparation of recombinant baculovirus

[0061] Sf9 cells were subcultured until the cell viability reached 100%, and 1×10 6 Sf9 cells were seeded into a six-well plate at a density of 10 cells / well and placed in a 27°C CO2-free incubator to adhere for 30-60 minutes. TM Invert the Sf transfection reagent 5 to 10 times and mix gently. TM Dilute the Sf transfection reagent with 250 μL Opti-MEM Medium, gently invert 5 to 10 times to mix, and incubate at room temperature for 5 minutes. Add rBacmid-AKAV-G directly to the diluted ExpiFectamine at two concentrations of 5 μg / 10 μg. TM Gently flip 5-10 times in Sf transfection reagent and incubate at room temperature for 5 minutes. Add multiple drops of DNA-lipid mixture to a six-well plate incubated with Sf9 cells and culture in a 27°C carbon dioxide-free incubator for 72 hours until cytopathic effects appear. Repeatedly freeze-thaw cells with pathological changes twice to disrupt the cells to release the virus, and collect the cell supernatant by centrifugation for recombinant virus passage. P2 generation virus is further expanded and cultured at 27°C for 72 hours. Blindly pass to P3 generation, and collect the cell supernatant for further verification.

[0062] 1.5.2 Western blot verification of recombinant baculovirus

[0063] The recombinant baculovirus rBac-AKAV-G in the cell supernatant was verified by Western blot. The collected cell supernatant was mixed with 5× loading buffer and incubated at 95°C for 10 minutes to prepare the WB sample.

[0064] Preparation of SDS-PAGE gel: 12% lower separating gel and 5% upper stacking gel. After sample loading, adjust the electrophoresis instrument voltage to 80V for 35-40 minutes, then change to 120V and continue electrophoresis for 45-55 minutes. Transfer the proteins from the polyacrylamide gel to a PVDF membrane by wet transfer, and electrophorese at 80V constant voltage on ice for 2 hours. After transfer to the PVDF membrane, block with 5% skim milk at room temperature for 2 hours. After washing three times with PBST, incubate with AKAV Gc / Gn monoclonal antibodies as primary antibodies (1:5000) at 4°C overnight. After washing three times with PBST, incubate with HRP-conjugated goat anti-mouse monoclonal antibodies (1:5000) as secondary antibodies at room temperature for 1 hour. Incubate in chemiluminescent solution for 30 seconds and observe on an imager.

[0065] 1.5.3 IFA verification of recombinant baculovirus

[0066] Well-grown Sf9 cells were cultured in 96-well plates and infected with recombinant baculovirus. After 72 hours, the cells were harvested. The supernatant was discarded, and the plates were fixed with ice-cold ethanol for 30 minutes. After washing three times with PBS, the plates were incubated with AKAV Gc / Gn monoclonal antibodies (1:1000) and incubated at 37°C for 1 hour. After washing three times with PBS, the plates were incubated with FITC-conjugated goat anti-mouse IgG secondary antibodies (1:500) for 40 minutes in the dark. After washing with PBS, the plates were observed under a fluorescence microscope.

[0067] Purification and identification of AKAV VLPs

[0068] 1.6.1 Purification of AKAV VLPs

[0069] After identification, rBac-AKAV-G was inoculated again into suspension cultured Sf9 cells, cultured at 120 rpm in a 28°C carbon dioxide-free incubator for 96 hours, and then the cells were collected and frozen in a -80°C refrigerator. The cells were frozen and thawed twice. After collecting all the cell suspensions, the cell pellets were removed by centrifugation at 10,000 rpm and 4°C for 30 minutes, and the supernatant was retained. The cell supernatant was centrifuged at 25,000 rpm and 4°C for 2 hours, and then the supernatant was discarded. The pellet was fully resuspended in PBS and added to the top layer of a density gradient sucrose (20%-40%-60% (w / v) centrifuge pad and centrifuged at 35,000 rpm and 4°C for 3 hours. The white suspension between each sucrose gradient was aspirated with a syringe, and 20 times the volume of pre-cooled PBS was added to mix and desugar. After centrifugation at 25,000 rpm for 2 hours, the cells were resuspended with 1 mL of pre-cooled PBS.

[0070] 1.6.2 Western blot identification

[0071] 40 μL of samples from the upper layer of 20% sucrose, between 20% and 40% sucrose, and between 40% and 60% sucrose were mixed with 10 μL of loading buffer and incubated at 95°C for 10 minutes. 10 μL of each sample was added to the wells of a 5% SDS-PAGE stacking gel. The voltage was set to 80 V and electrophoresis was continued for 40 minutes. The voltage was then adjusted to 120 V, allowing the sample to enter the lower layer of the 12% separating gel. Electrophoresis was continued for another 50 minutes. Proteins were transferred to a PVDF membrane using wet transfer. Electrophoresis was performed at 80 V for 2 hours. The membrane was then removed and blocked in 5% skim milk for 2 hours. The membranes were incubated with AKAV Gc / Gn monoclonal antibodies (1:5000) as primary antibodies at 4°C overnight. After washing with PBST, the membranes were incubated with HRP-conjugated goat anti-mouse monoclonal antibodies (1:5000) as secondary antibodies at room temperature for 1 hour. The membranes were incubated in chemiluminescent solution for 30 seconds and then visualized on an imager.

[0072] 1.6.3 Electron microscopy identification

[0073] A 20 μL sample of AKAV VLPs was placed on a 200-mesh copper mesh and allowed to adsorb at room temperature for 1 minute. The mesh was then placed on a 2% phosphotungstic acid staining solution and negatively stained for 30 seconds before drying at room temperature for 5-10 minutes. The accelerating voltage was adjusted to 80 kV, and the VLPs were imaged, labeled, and analyzed under a transmission electron microscope.

[0074] 2 Test results

[0075] 2.1 Construction of recombinant plasmids and identification of recombinant bacmids

[0076] The Gn and Gc sequences of AKAV were inserted into the pFastBac Dual vector ( Figure 1 The positive clone vector was then identified by PCR. The universal primers M13R and M13F were used to amplify pFastBac Dual-AKAV-G as a template. The amplification results were shown in FIG. Figure 1 As shown in Figure B, the specific amplified fragment is approximately 6000 bp in size, consistent with the expected fragment size (5933 bp). Furthermore, nucleic acid sequencing of the target gene revealed 100% homology to the predicted protein gene, with no adverse mutations or nucleotide deletions observed. Therefore, these results demonstrate that the recombinant plasmid pFastBacDual-AKAV-G was correctly constructed.

[0077] 2.2 Rescue of recombinant baculovirus

[0078] rBacmid-AKAV-G was transfected into Sf9 cells at two concentrations of 5μg / 10μg and serially passaged. At passage P3, after culturing at 27℃ for 72h, the cells showed obvious cytopathic effects, mainly manifested by cell enlargement and rounding, a large number of adherent cells falling off, and an increase in the number of floating cells. Figure 2 As shown, it shows that the recombinant baculovirus rBac-AKAV-G was successfully rescued.

[0079] 2.3 Identification of recombinant baculovirus

[0080] 2.3.1 Western blot verification

[0081] The supernatant of rBac-AKAV-G infected Sf9 cells was collected to prepare samples, and AKAV-Gc and AKAV-Gn monoclonal antibodies were used as primary antibodies. The results of Western blotting showed that Figure 3 As shown, the control group showed no specific bands, while the specific bands that appeared after incubation with Gc monoclonal antibody were located between 100 and 130 kDa, and the specific bands that appeared after incubation with Gn monoclonal antibody were located between 25 and 35 kDa, consistent with the expected protein size. This indicates that Sf9 cells infected with rBac-AKAV-G can accurately express AKAV Gc / Gn proteins.

[0082] 2.3.2 Indirect immunofluorescence identification

[0083] The obtained recombinant baculovirus rBac-AKAV-G was used to infect Sf9 cells for 72 h. After ethanol fixation, AKAV-Gc monoclonal antibody and AKAV-Gn monoclonal antibody were used as primary antibodies. The immunofluorescence results were shown in Figure 2. Figure 4 As shown, the control group showed no fluorescent signal, while cells infected with the recombinant virus showed a large area of ​​green fluorescence, and the number of adherent cells was less than that in the control group. This result further confirmed that the obtained recombinant virus rBac-AKAV-G can express the target protein.

[0084] Purification and identification of AKAV VLPs

[0085] 2.4.1 Western blot verification

[0086] In order to observe the AKAV virus-like particles packaged by the recombinant virus, the virus-like particles were purified by sucrose density gradient centrifugation. The white suspension bands with a sucrose density of 20%, 20% to 40%, and 40% to 60% were collected respectively, and the samples were prepared after desugaring ( Figure 5Western blot analysis using AKAV-Gc and AKAV-Gn monoclonal antibodies as primary antibodies showed no obvious bands in suspensions with a sucrose density above 40%, while clear bands were observed between 40% and 60%, which were 105 kDa (Gc) and 28 kDa (Gn), respectively. Figure 5 Middle B) indicates that the expected AKAV VLPs can be obtained between 40% and 60% sucrose gradient.

[0087] 2.4.2 Electron microscopy verification

[0088] To further identify whether the expressed AKAV Gn / Gc proteins were packaged into complete VLPs, the purified VLPs were observed using transmission electron microscopy. The results showed that the prepared virus-like particles were round and spherical with a capsule, with a diameter of about 60 to 100 nm ( Figure 6 In addition, the double-layer membrane structure of AKAV VLP can be clearly seen under the electron microscope ( Figure 6 B), and the thorn-like structure on the particle surface composed of viral glycoproteins Gn and Gc ( Figure 6 The results showed that VLPs were mainly assembled from AKAV glycoproteins, confirming that the VLPs expressed in this study were AKAV VLPs and could be used in subsequent related research.

[0089] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A recombinant virus-like particle of Akabane disease virus, characterized in that The Akabane disease virus recombinant virus-like particles are obtained by recombinantly expressing the structural protein Gn and the structural protein Gc of the Akabane disease virus in an insect cell-baculovirus expression system and self-assembling; The amino acid sequence of the structural protein Gn is shown in SEQ ID NO.1; the amino acid sequence of the structural protein Gc is shown in SEQ ID NO.

2.

2. The Akabane disease virus recombinant virus-like particle according to claim 1, wherein The nucleotide sequence of the gene encoding the structural protein Gn is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is shown in SEQ ID NO.

4.

3. The method for preparing recombinant virus-like particles of Akabane disease virus according to claim 1, wherein The following steps are involved: The genes encoding the structural protein Gn and the structural protein Gc were connected to an insect cell expression vector to obtain a recombinant plasmid; The obtained recombinant plasmid was transformed into Escherichia coli competent cells to obtain the recombinant bacmid; The obtained recombinant bacmid is transfected into insect cells to obtain recombinant baculovirus; Infecting insect cells with the obtained recombinant baculovirus to express the structural protein Gn and the structural protein Gc, thereby obtaining Akabane disease virus recombinant virus-like particles; The nucleotide sequence of the gene encoding the structural protein Gn is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is shown in SEQ ID NO.

4.

4. Use of the Akabane disease virus recombinant virus-like particles according to claim 1 in the preparation of a medicament for preventing Akabane disease.

5. The use according to claim 4, characterized in that The medicines include vaccines.

6. A drug for preventing Akabane disease, characterized in that The drug comprises the Akabane disease virus recombinant virus-like particles according to claim 1.

7. The drug according to claim 6, characterized in that The medicament further comprises a pharmaceutically acceptable immune adjuvant.

8. The drug according to claim 6, wherein The medicines include vaccines.

Citation Information

Patent Citations

  • Whole genome sequence of akabane virus AKAV / JL / 2022 and amplification primer thereof

    CN116836244A

  • Anti-akabane disease virus monoclonal antibody, hybridoma cell secreting anti-akabane disease virus monoclonal antibody and application of hybridoma cell

    CN117447590A