Probe primer composition, method and product for quantitative detection of Karenia saddle and Karenia mikimotoi

Abstract

The invention provides a probe primer composition, a method and a product for quantitative detection of Karenia saddle and Karenia mikimotoi, and belongs to the technical field of microbiological detection. According to the primer and the probe as shown in SEQ ID NO.1-6 provided by the invention, the Karenia saddle and the Karenia mikimotoi can be simultaneously and quantitatively detected in one system, so that the detection time is remarkably shortened, the reagent cost is reduced, and the detection method is simpler. The method has the advantages of high specificity, high sensitivity, simplicity in operation, short time consumption and the like, can overcome the limitation of traditional morphological identification, is time-saving, labor-saving and relatively low in price, can realize rapid and accurate qualitative identification and quantitative detection of a large number of samples, and can become an effective technical means for prediction, early warning and large-area monitoring of the Karenia red tide.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and in particular, to a probe primer composition, a method, and a product for quantitatively detecting Karenia selliformis and Karenia mikimotoi. Background Art

[0002] Red tide is a serious marine ecological problem, mainly caused by marine eutrophication, which leads to the explosive reproduction and high density of certain plankton, and can damage the marine ecological environment, resulting in the massive death of marine organisms such as fish, shrimps, crabs, and shellfish, causing serious marine pollution and economic losses.

[0003] Karenia mikimotoi and Karenia selliformis are typical red tide algae. Karenia mikimotoi and Karenia selliformis have highly similar morphological characteristics and often appear simultaneously. When they break out into red tides, they can produce toxins with strong toxic effects, resulting in the death of a large number of marine fish, shellfish, and even invertebrates, posing a serious threat to marine fisheries and the marine ecosystem. Although Karenia selliformis and Karenia mikimotoi are extremely similar in morphology, they have significant differences in physiological growth and toxic effects. Karenia selliformis can produce high concentrations of acutely toxic cyclic imine gymnodimines (GYMs). Compared with Karenia mikimotoi, Karenia selliformis has a shorter toxic time and stronger toxic effects. In order to timely prevent and control the outbreak of harmful red tide events caused by Karenia selliformis and Karenia mikimotoi, it is necessary to have a full understanding of their outbreak mechanisms and to efficiently quantitatively detect the two algae to accurately determine and warn of the disaster losses in aquaculture fisheries. Therefore, a highly specific detection method is needed to identify the two algae.

[0004] Currently, for the detection technology of Karenia selliformis and Karenia mikimotoi, the conventional method is to observe with an optical microscope. However, due to the very small morphological differences between the two, it is not easy to distinguish them, and the morphology of some algal species will change with the environment. Therefore, the morphological analysis method cannot meet the detection requirements. The ordinary PCR method, as a relatively common molecular biology method nowadays, can distinguish these two Karenia algae according to the molecular sequence information of certain specific gene fragments. However, ordinary PCR cannot meet the requirements of quantitative detection and cannot explain the outbreak mechanisms of these two algal red tides. qPCR is developed on the basis of ordinary PCR and can achieve quantitative detection of algal cells. And qPCR using Taqman probes has good specificity. However, the previous qPCR detection methods can only target a single algal species. For multiple Karenia algae, multiple rounds of single qPCR detections are required, which takes a long time for identification and increases the usage amount of template DNA. Given that the single qPCR detection method is not efficient enough for the detection process of red tide events coexisting with Karenia selliformis and Karenia mikimotoi, therefore, there is an urgent need to seek a more efficient and highly specific dual quantitative detection method. Summary of the Invention

[0005] The object of the present invention is to provide a probe primer composition, method and product for quantitative detection of Karenia selliformis and Karenia mikimotoi, which can simultaneously achieve quantitative detection of Karenia selliformis and Karenia mikimotoi in one reaction system, save detection time, and can quickly identify the dominant species causing red tides.

[0006] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a probe primer composition for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi, and the composition of the probe primer composition is as follows:

[0008] Karenia selliformis:

[0009] SEQ ID NO.1 - S5F: TTGTAGTTCAGATATGATAC;

[0010] SEQ ID NO.2 - S5R: CCCTATTGGGATGCGGCT;

[0011] SEQ ID NO.3 - S5P: FAM - AAGATCGTCAATTCCGGAACCAAT - BHQ1;

[0012] Karenia mikimotoi:

[0013] SEQ ID NO.4 - M3F: AACTTGTGTGGTAGTTGGA;

[0014] SEQ ID NO.5 - M3R: CTGGTAACCCAGCTTGTAT;

[0015] SEQ ID NO.6 - M3P:

[0016] CY3 - GGTAGACCAGGTGTCTAGCACTTCAAATGT - BHQ1.

[0017] Preferably, the target gene for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi is the ITS region of ribosomal DNA.

[0018] The present invention also provides a TaqMan duplex fluorescence quantitative detection method for Karenia selliformis and Karenia mikimotoi, which is characterized by including the following steps:

[0019] (1) Extract the DNA of the sample to be tested, and perform TaqMan qPCR amplification on the extracted DNA using the probe primer composition shown in SEQ ID NO.1 to SEQ ID NO.6. After the amplification is completed, detect the Ct values of Karenia selliformis and Karenia mikimotoi respectively;

[0020] (2) According to the Ct values obtained in step (1), calculate the cell numbers of Karenia selliformis and Karenia mikimotoi using the plasmid standard curve, cell standard curve, and cell-plasmid standard curve respectively.

[0021] Preferably, in step (1), the reaction system of the dual TaqMan qPCR is: 10 μL AceQ UniversalU+Probe Master Mix V2, 0.4 μL S5F, 0.4 μL S5R, 0.4 μL M3F, 0.4 μL M3R, 0.2 μL S5P, 0.2 μL M3P, 6 μL ddH2O, and 2 μL DNA template;

[0022] The reaction program is: 37 °C for 2 min; 95 °C for 10 min; 95 °C for 10 sec; 59 °C for 1 min, 45 cycles.

[0023] Preferably, in step (2), the dual TaqMan qPCR plasmid standard curve is:

[0024] For Karenia selliformis:

[0025] y = -3.578x + 40.781, correlation coefficient r = -0.999, amplification efficiency is 90.32%;

[0026] For Karenia mikimotoi:

[0027] y = -3.389x + 40.712, correlation coefficient r = -0.997, amplification efficiency is 97.27%.

[0028] Among them, x represents the logarithm (base 10) of the recombinant plasmid copy number, and y represents the Ct value.

[0029] Preferably, in step (2), the dual TaqMan qPCR cell standard curve is:

[0030] For Karenia selliformis:

[0031] y = -3.692x + 33.764, correlation coefficient r = -0.996, amplification efficiency is 86.57%;

[0032] For Karenia mikimotoi:

[0033] y = -3.544x + 31.698, with a correlation coefficient r = -0.998 and an amplification efficiency of 91.50%.

[0034] Where x represents the logarithm (base 10) of the number of algal cells, and y represents the corresponding Ct value.

[0035] Preferably, in step (2), the dual TaqMan qPCR cell-plasmid standard curve is as follows:

[0036] Karenia selliformis: y = 0.969x - 1.901;

[0037] Karenia mikimotoi: y = 0.956x - 2.543.

[0038] Where x represents the logarithm (base 10) of the recombinant plasmid copy number, and y represents the logarithm (base 10) of the number of cells.

[0039] The present invention also provides a product for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi, which product comprises the above-mentioned probe primer composition for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi.

[0040] Preferably, the product comprises any one of a detection reagent, a detection kit, and a detection chip.

[0041] The present invention also provides an application of a product for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi in detecting Karenia selliformis and Karenia mikimotoi.

[0042] The beneficial effects of the present invention compared with the prior art are as follows:

[0043] (1) The present invention provides a set of probe primer compositions and detection methods for dual quantitative detection of Karenia selliformis and Karenia mikimotoi. The primers and probes shown in SEQ ID NO.1 - 6 provided by the present invention can simultaneously perform quantitative detection of Karenia selliformis and Karenia mikimotoi in one system, significantly shortening the detection time, reducing the reagent cost, and making the detection method simpler.

[0044] (2) The present invention has the advantages of strong specificity, high sensitivity, simple operation, short time consumption, etc. It has a low detection limit for algal cells, can overcome the limitations of traditional morphological identification, saves time and effort, and is relatively inexpensive. It can achieve rapid and accurate qualitative identification and quantitative detection of a large number of samples, and can become an effective technical means for the prediction, early warning, and large-area monitoring of Karenia red tides, and can quickly identify the original causative species of red tides, thus providing strong support for the timely control of harmful red tide events. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0046] Figure 1 This is the specific amplification result diagram of the double TaqMan qPCR for Karenia mikimotoi and Karenia selliformis in Example 1 of the present invention, where 1 represents the DNA of Karenia mikimotoi, 2 represents the DNA of Karenia selliformis, 3 represents the control algal DNA (red), and 4 represents the negative control as deionized water (green);

[0047] Figure 2 This is the standard curve graph of the plasmid of Karenia selliformis in Example 2 of the present invention;

[0048] Figure 3 This is the standard curve graph of the plasmid of Karenia mikimotoi in Example 2 of the present invention;

[0049] Figure 4 This is the standard curve graph of the cells of Karenia selliformis in Example 2 of the present invention;

[0050] Figure 5 This is the standard curve graph of the cells of Karenia mikimotoi in Example 2 of the present invention;

[0051] Figure 6 This is the standard curve graph of the cells - plasmid of Karenia selliformis in Example 2 of the present invention;

[0052] Figure 7 This is the standard curve graph of the cells - plasmid of Karenia mikimotoi in Example 2 of the present invention. Detailed implementation manners

[0053] Now, the various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0054] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0055] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0056] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.

[0057] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0058] Example 1

[0059] In Example 1 of this invention, a probe primer composition for the quantitative detection of Karenia selliformis and Karenia mikimotoi was prepared, and the detection effect of this probe primer composition was detected. The specific steps are as follows:

[0060] (1) Design of specific primers and TaqMan probes

[0061] Filter 300 mL of Karenia selliformis and Karenia mikimotoi algal solutions with a magnetic filter and a 0.22 μm mixed cellulose filter membrane respectively. Discard the filtrate, transfer the filter membrane to a 1.5 mL centrifuge tube, and store it in a -80 °C refrigerator.

[0062] Cut the filtered filter membrane into pieces with a sterilized scissors, and extract the DNA of Karenia selliformis and Karenia mikimotoi respectively according to the instructions of the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (Takara Bio Inc. (Dalian)). The DNA is dissolved in 40 μL of elution buffer to obtain the DNA of Karenia selliformis and the DNA of Karenia mikimotoi.

[0063] Use the universal primers for the ITS region of eukaryotic algae:

[0064] SEQ ID NO.7-TW28: 5′-GGGATCCGTTTCCGTAGGTGAACCTGC;

[0065] SEQ ID NO.8 - AB81: 5'-GGGATCCATATGCTTAAGTTCAGCGGGT。

[0066] PCR amplification was performed on the DNA of Karenia selliformis and the DNA of Karenia mikimotoi. The PCR reaction system was as follows: 10 μL of SuperMix (TransGen Biotech Co., Ltd. (Beijing)), 7 μL of ddH2O, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), and 1 μL of DNA sample. Among them, the amplification program corresponding to the ITS region primers was: 94°C for 3 min, 94°C for 30 s, 57°C for 30 s, 72°C for 1 min, 38 cycles, and 72°C for 6 min. After the PCR products were preliminarily observed to conform to the target fragment length by 1% agarose gel electrophoresis, they were sent to BGI (Shenzhen) for sequencing.

[0067] The Clustal software was used to analyze the sequence differences between the ITS region sequences of the target algae and the control algae to find the specific regions of the target algae. Specific primers and TaqMan probes were designed within Beacon Designer 7, and the specificity of the primers and probes was preliminarily verified using NCBI - Primer Plast. The primers and probes with successful verification were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. A fluorescent reporter group and a fluorescent quenching group were labeled at the 5' end and 3' end of the TaqMan probe respectively. The primer and probe sequences are as follows:

[0068] SEQ ID NO.1 - S5F: TTGTAGTTCAGATATGATAC;

[0069] SEQ ID NO.2 - S5R: CCCTATTGGGATGCGGCT;

[0070] SEQ ID NO.3 - S5P: FAM - AAGATCGTCAATTCCGGAACCAAT - BHQ1;

[0071] Karenia mikimotoi:

[0072] SEQ ID NO.4 - M3F: AACTTGTGTGGTAGTTGGA;

[0073] SEQ ID NO.5 - M3R: CTGGTAACCCAGCTTGTAT;

[0074] SEQ ID NO.6 - M3P:

[0075] CY3 - GGTAGACCAGGTGTCTAGCACTTCAAATGT - BHQ1.

[0076] (2) Specificity test of primers and TaqMan probes

[0077] Using Karenia selliformis and Karenia mikimotoi as target algae, and Karenia hui, Coscinodiscus radiatus, Gymnodinium impudicum, Karlodinium australe, Karlodinium decipien, Karlodinium digitatum, Karlodinium elegans, Karlodinium veneficum, Karlodinium zhouanum, Takayama acrotrocha as control algae. Use L1 medium (salinity about 33±2, pH value about 8.0±2), and carry out algal culture in a light incubator (temperature 20±1°C, light intensity 80 - 100 μmol·s -1 ·m -2 , light-dark ratio 12h:12h).

[0078] Take 1 mL of algal cells in the exponential growth phase, add Lugol's reagent to fix and mix evenly, then take 100 μL of the sample and observe it under a microscope in a plankton counting frame. Filter 300 mL of algal solution with a magnetic filter and a 0.22 μm mixed cellulose filter membrane, discard the filtrate, transfer the filter membrane to a 1.5 mL centrifuge tube, and store it in a -80°C refrigerator.

[0079] Cut the filtered filter membrane into pieces with sterile scissors, extract the algal DNA according to the instructions of the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0, dissolve the DNA in 40 μL of elution buffer, and store it at -20°C for later use.

[0080] Take 5 μL of each of the DNA solutions of various control algae and mix them equally to prepare a control algal DNA solution. Use the TaqMan qPCR reaction system to amplify the DNA of Karenia selliformis and Karenia mikimotoi, the control algal DNA and deionized water (negative control) respectively, so as to verify the specificity of the primers and TaqMan probes of the two algae. Send the amplification products of the target algae to BGI (Shenzhen) for sequencing, and perform homology comparison of the amplification product sequences on NCBI-Blast to further judge the specificity of the primer probes.

[0081] (3) Results of specificity test of primers and TaqMan probes

[0082] In the fluorescence quantitative PCR detection, the specific primers and probe S5F, S5R, S5P of Karenia selliformis only amplify the DNA of Karenia selliformis, and have no reaction with the control algae and negative control, showing good specificity and meeting the experimental requirements; the specific primers and probe M3F, M3R, M3P of Karenia mikimotoi also only produce amplification signals for the DNA of Karenia mikimotoi, and there is no amplification for other control algae and negative control. The results are as Figure 1 shown.

[0083] Figure 1 It shows that the double fluorescence quantitative PCR system for Karenia selliformis - Karenia mikimotoi only has positive amplification signals for Karenia selliformis and Karenia mikimotoi, and does not amplify the DNA of other control algae and negative control, indicating that the primer sets and probes designed for the two algae have high specificity and can be used in the double TaqMan qPCR reaction established in the present invention.

[0084] Example 2

[0085] In Example 2 of the present invention, the conditions of the TaqMan double fluorescence quantitative detection method for Karenia selliformis and Karenia mikimotoi were optimized, and the double TaqMan qPCR plasmid standard curve, double TaqMan qPCR cell standard curve, and double TaqMan qPCR cell - plasmid standard curve for Karenia mikimotoi and Karenia selliformis were established respectively. The specific steps are as follows:

[0086] (1) Condition optimization

[0087] Take the DNA of Karenia selliformis and the DNA of Karenia mikimotoi prepared in step (2) of Example 1. Based on the specific primers and TaqMan probes designed for Karenia selliformis and Karenia mikimotoi respectively, add the specific primers and TaqMan probes of these two Karenia algae in the same qPCR system to establish a double TaqMan qPCR reaction system that can simultaneously detect Karenia selliformis and Karenia mikimotoi. Optimize the conditions of the double reaction system from the following three aspects: ① Probe concentration: Set 5 concentration gradients at intervals of 0.05 μM and optimize within the range of 0.05 - 0.25 μM; ② Primer concentration: Optimize the reaction within the concentrations of 0.1 μM, 0.2 μM, 0.4 μM, 0.6 μM, and 0.8 μM; ③ Annealing temperature: Optimize the temperature at intervals of 1 °C within the range of 58 - 62 °C to determine the optimal reaction conditions and ensure the best detection effect.

[0088] After optimizing the reaction system conditions, it was found that the Ct values of both algae were the lowest when the primer concentration was 0.2 μM, the probe concentration was 0.1 μM, and the annealing temperature was 59 °C. Thus, the dual TaqMan qPCR detection reaction program was successfully established as follows: 37 °C for 2 min; 95 °C for 10 min; 95 °C for 10 sec; 59 °C for 1 min, with 45 cycles. The optimized reaction system is shown in Table 1 (total reaction volume is 20 μL).

[0089] Table 1 Components and concentrations of the reaction system

[0090]

[0091] (2) Establishment of the dual TaqMan qPCR plasmid standard curve:

[0092] Since DNA is unstable and prone to degradation during long-term storage in the refrigerator, resulting in inaccurate quantitative data and experimental result deviations. Therefore, to better detect red tide algae, plasmids with better stability and known sequence lengths were selected to establish plasmid standard curves, and the cell standard curve and plasmid standard curve were combined, so that the cell concentration of algal species could be calculated more accurately through the relationship between plasmid copy number and cell number.

[0093] 1) Construction of recombinant plasmids

[0094] The DNA of Karenia selliformis and Karenia mikimotoi was amplified by PCP using the eukaryotic algal ITS region universal primers TW28 (SEQ ID NO.7: 5'-GGGATCCGTTTCCGTAGGTGAACCTGC) and AB81 (SEQ ID NO.8: 5′-GGGATCCATATGCTTAAGTTCAGCGGGT). The PCR reaction system was as follows: 10 μL of SuperMix, 7 μL of ddH2O, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), and 1 μL of DNA sample. Among them, the amplification program corresponding to the ITS region primers was: 94 °C for 3 min, 94 °C for 30 sec, 57 °C for 30 sec, 72 °C for 1 min, with 38 cycles, and 72 °C for 6 min. After the PCR products were initially observed to conform to the target fragment length by 1% agarose gel electrophoresis, they were sent to BGI (Shenzhen) for sequencing. After the PCR amplification sequences were aligned on the NCBI website and determined to be the required algal species, recombinant plasmid synthesis was carried out by BGI. The mass concentration of the recombinant plasmid was measured using a Picodrop ultra-micro ultraviolet spectrophotometer. According to the formula: copy number concentration (copies / μL) = [mass concentration (ng / μL) × 10 -9 × 6.02 × 10 23 / (number of base pairs × 660), the mass concentration of the recombinant plasmid was converted to copy number concentration.

[0095] (2) Establishment of plasmid standard curve

[0096] Take 10 μL of plasmids of Karenia selliformis and Karenia mikimotoi at the same order of magnitude (10 2 ~10 8 copies / μL) respectively, mix them to prepare a mixed plasmid standard product with a concentration range of 10 2 ~10 8 copies / μL. Using the mixed plasmid as a template, perform dual fluorescence quantitative PCR amplification under the optimized reaction conditions and procedures in step (1) to obtain the amplification curves of the two algae. Taking the logarithm of the recombinant plasmid copy number (lgX) as the abscissa and the corresponding Ct value as the ordinate, obtain the plasmid standard curve:

[0097] Karenia selliformis: Taking the Ct value as the ordinate and the logarithm of the recombinant plasmid copy number (base 10) as the abscissa, establish the plasmid standard curve of Karenia selliformis. Its linear equation is: y = -3.578x + 40.781, as Figure 2 shown (where: x represents the logarithm of the recombinant plasmid copy number (base 10), y represents the Ct value), the correlation coefficient r = -0.999, and the amplification efficiency is 90.32%.

[0098] Karenia mikimotoi: Taking the Ct value as the ordinate and the logarithm of the recombinant plasmid copy number (base 10) as the abscissa, establish the plasmid standard curve of Karenia mikimotoi. Its linear equation is: y = -3.389x + 40.712, as Figure 3 shown (where: x represents the logarithm of the recombinant plasmid copy number (base 10), y represents the Ct value), the correlation coefficient r = -0.997, and the amplification efficiency is 97.27%.

[0099] After calculation, the correlation coefficients r of the plasmid standard curves of the two algae are both greater than -0.99, and the amplification efficiencies are both above 90%.

[0100] (3) Establishment of dual TaqMan qPCR cell standard curve:

[0101] Mix the DNA solutions of algal cells containing Karenia selliformis and Karenia mikimotoi in equal volumes and perform serial 10-fold dilutions. Using the DNA solutions with a concentration of 10 -1 ~10 4 cells / μL as the standard products, perform dual qPCR amplification using the method in step (1). Taking the logarithm of the algal cell number as the abscissa and the corresponding Ct value as the ordinate, plot the cell standard curve.

[0102] Karenia selliformis: With the Ct value as the ordinate and the logarithm (base 10) of the algal cell number as the abscissa, establish the cell standard curve of Karenia selliformis ( Figure 3 ). Its linear equation is: y = -3.692x + 33.764, as shown in Figure 4 (where: x represents the logarithm (base 10) of the algal cell number, y represents the Ct value), the correlation coefficient r = -0.996, and the amplification efficiency is 86.57%.

[0103] Karenia mikimotoi: With the Ct value as the ordinate and the logarithm (base 10) of the algal cell number as the abscissa, establish the cell standard curve of Karenia mikimotoi ( Figure 3 ). Its linear equation is: y = -3.544x + 31.698, as shown in Figure 5 (where: x represents the logarithm (base 10) of the algal cell number, y represents the Ct value), the correlation coefficient r = -0.998, and the amplification efficiency is 91.50%.

[0104] After calculation, the correlation coefficients of the two algal cell standard curves are both greater than -0.99, and the amplification efficiencies are both above 85%.

[0105] (4) Establishment of the dual TaqMan qPCR cell-plasmid standard curve:

[0106] Based on the dual plasmid standard curves and cell standard curves of Karenia lemmermannii and Karenia selliformis, taking the logarithm (base 10) of the recombinant plasmid copy number as the abscissa and the logarithm (base 10) of the corresponding cell number in the DNA solution as the ordinate, respectively obtain the linear equations between the plasmid copy number and the algal cell density of Karenia mikimotoi and Karenia selliformis (dual TaqMan qPCR cell-plasmid standard curve).

[0107] Karenia selliformis: The linear equation of the Karenia selliformis cell-plasmid standard curve is y = 0.969x - 1.901, as shown in Figure 6 . Among them, x represents the logarithm (base 10) of the recombinant plasmid copy number, and y represents the logarithm (base 10) of the cell number.

[0108] Karenia mikimotoi: The linear equation of the Karenia mikimotoi cell-plasmid standard curve is y = 0.956x - 2.543, as shown in Figure 7 . Among them, x represents the logarithm (base 10) of the recombinant plasmid copy number, and y represents the logarithm (base 10) of the cell number.

[0109] (5) Specificity test of dual fluorescence quantitative PCR:

[0110] The mixed DNA of Karenia mikimotoi and Karenia sella, the DNA of control algae, and ddH2O (negative control) were amplified under the optimized dual TaqMaa probe quantitative PCR conditions to verify the specificity of the dual fluorescence quantitative PCR detection method for Karenia mikimotoi and Karenia sella.

[0111] The experimental results showed that the saddle - Mikimotoi dual fluorescence quantitative PCR system had positive amplification signals only for Karenia sella and Karenia mikimotoi, and did not amplify for the DNA of other control algae and the negative control, indicating that the established dual fluorescence quantitative PCR method had good specificity.

[0112] (6) Sensitivity test of dual fluorescence quantitative PCR:

[0113] Recombinant plasmids of 10 0 ~10 8 copies / μL and DNA solutions extracted from 10 -2 ~10 4 cells / μL algal cells of the two target algae were mixed in equal volumes respectively to obtain mixed plasmid standards and mixed DNA standards, and they were used as templates for amplification to obtain the lowest detection limits of the dual fluorescence quantitative PCR method for the two algae.

[0114] The lowest detectable concentration of the plasmid of Karenia sella was 2.76 copies / μL, and the lowest detectable concentration of the corresponding cells in the DNA solution was 0.036 cells / μL; the lowest detectable concentration of the plasmid of Karenia mikimotoi was 1.99 copies / μL, and the lowest detectable concentration of the cells was 0.030 cells / μL. According to the formula: the number of algal cells in the water sample (cells / L) = [the number of corresponding cells in the DNA solution (cells / μL) × the total volume of DNA (μL)] / the volume of the water sample (L), the lowest detectable algal densities of Karenia sella and Karenia mikimotoi in the water body were 5 cells / L and 4 cells / L respectively.

[0115] (7) Repeatability test of dual fluorescence quantitative PCR:

[0116] Recombinant plasmids of 10 4 ~10 6 copies / μL and DNA extracted from mixed algal cells of 10 1 ~10 3 cells / μL were used as templates for repeatability tests. Intra - group repeatability: Recombinant plasmids and DNA solutions at 3 concentrations were used as templates, with three replicates each, to obtain Ct values and calculate the coefficient of variation. Inter - group repeatability: Recombinant plasmids and DNA solutions at 3 concentrations were used as a group respectively for 3 independent experiments, and the coefficient of variation was calculated. The coefficient of variation (CV%) = standard deviation (SD) / mean × 100%. If the coefficient of variation is less than 2%, the repeatability can be considered good.

[0117] Under the dual TaqMan qPCR detection system, the coefficients of variation of the recombinant plasmids and cells of the two algae are both lower than 2%, proving that the established dual fluorescence PCR method has high repeatability.

[0118] Example 3

[0119] In Example 3 of the present invention, the numbers of Karenia mikimotoi and Karenia selliformis in field simulation samples were detected, and the specific steps are as follows:

[0120] (1) Preparation of field simulation samples:

[0121] Take 30 mL of Karenia mikimotoi, Karenia selliformis, Karenia longissima, and Karenia papilionacea solutions with algal densities of 2.4×10 4 cells / mL, 4.5×10 4 cells / mL, 5.2×10 4 cells / mL, and 5.8×10 4 cells / mL respectively, and mix them with 1000 mL of seawater from Qingdao Shazikou Sea Area (not sterilized) to prepare laboratory field simulation samples. Extract the DNA of the simulation samples and perform three groups of concentration dilutions on it so that the number of cells contained in each group of DNA is different.

[0122] (2) Using the DNA of the obtained field simulation samples as a template, and using the probe primer composition shown in SEQ ID NO.1 to SEQ ID NO.6, perform TaqMan qPCR dual fluorescence quantitative amplification by adopting the reaction system (Table 1) and reaction program preferably selected in step (1) of Example 2, and use the t-test to compare the differences between the algal cell densities of Karenia mikimotoi and Karenia selliformis examined by microscopy and the algal cell densities obtained by dual quantitative PCR.

[0123] The results are shown in Table 2. It can be seen from the following table that the difference in the number of cells detected by microscopy and qPCR is not significant (P>0.05), and the algal species detection rate is 100%, indicating that the TaqMan qPCR technology also has good detectability for the target algae under dual conditions.

[0124] Table 2 Comparison of microscopic counting and dual TaqMan qPCR detection results of Karenia selliformis and Karenia mikimotoi

[0125]

[0126] Test Example 1

[0127] In Test Example 1 of the present invention, the single-algae detection method and the dual detection method of Karenia selliformis and Karenia mikimotoi were compared, and the specific steps are as follows:

[0128] (1) Preparation of field simulation samples:

[0129] Take 30 mL each of Karenia mikimotoi, Karenia sella, Karenia longicanalis, and Karenia papilionacea solutions with algal densities of 2.4×10 4 cells / mL, 4.5×10 4 cells / mL, 5.2×10 4 cells / mL, and 5.8×10 4 cells / mL, and mix them with 1000 mL of seawater from Qingdao Shazikou Sea Area (not sterilized) to prepare laboratory field simulation samples. Extract the DNA of the simulation samples and perform three groups of concentration dilutions on it so that the number of cells contained in each group of DNA is different.

[0130] (2) Using the DNA of the above-obtained field simulation samples as a template, and using the probe primer compositions shown in SEQ ID NO.1 to SEQ ID NO.6, perform TaqMan qPCR dual fluorescence quantitative amplification with the reaction system (Table 1) and reaction program preferably selected in step (1) of Example 2 to obtain Ct values. Substitute the Ct values obtained by amplifying Karenia sella and Karenia mikimotoi into the linear equations of the plasmid standard curves of Karenia sella and Karenia mikimotoi in Example 2 to calculate the copy numbers of recombinant plasmid DNA of Karenia sella and Karenia mikimotoi in the samples; then, through the linear relationship between the number of cells and the plasmid copy number established in the cell-plasmid standard curve jointly obtained from the cell standard curve and the plasmid standard curve, calculate the number of cells of Karenia sella and Karenia mikimotoi respectively.

[0131] (3) Use the t-test to compare the differences in the algal cell densities of Karenia mikimotoi and Karenia sella detected by the single-algal TaqMan qPCR detection method and the algal cell densities obtained by the dual TaqMan qPCR.

[0132] The results are shown in Table 3. It can be seen from the following table that there is no significant difference in the number of cells detected by the single-algal TaqMan qPCR detection and the dual TaqMan qPCR detection (P>0.05), and the detection rates of algal species in the laboratory simulation samples are both 100%. Moreover, the dual quantification can simultaneously detect Karenia sella and Karenia mikimotoi in one system, saving more reaction time and reagent costs, and having higher detection timeliness and economic feasibility.

[0133] Table 3 Comparison of the detection results of single-algal TaqMan qPCR and dual TaqMan qPCR for Karenia sella and Karenia mikimotoi

[0134]

[0135] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A probe primer composition for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi, characterized in that, The composition of the probe primer composition is as follows: Karenia selliformis: SEQ ID NO.1-S5F: TTGTAGTTCAGATATGATAC; SEQ ID NO.2-S5R: CCCTATTGGGATGCGGCT; SEQ ID NO.3-S5P: FAM-AAGATCGTCAATTCCGGAACCAAT-BHQ1; Karenia mikimotoi: SEQ ID NO.4-M3F: AACTTGTGTGGTAGTTGGA; SEQ ID NO.5-M3R: CTGGTAACCCAGCTTGTAT; SEQ ID NO.6-M3P: CY3-GGTAGACCAGGTGTCTAGCACTTCAAATGT-BHQ1.

2. The probe primer composition for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi according to claim 1, wherein, The target gene for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi is the ITS region of ribosomal DNA.

3. A TaqMan duplex fluorescence quantitative detection method for Karenia selliformis and Karenia mikimotoi, characterized in that, It includes the following steps: (1) Extract the DNA of the sample to be tested, and use the probe primer composition shown in SEQ ID NO.1~SEQ ID NO.6 to perform TaqMan qPCR amplification on the extracted DNA. After the amplification is completed, detect the Ct values of Karenia selliformis and Karenia mikimotoi respectively; (2) According to the Ct values obtained in step (1), use the plasmid standard curve, cell standard curve, and cell-plasmid standard curve to calculate the cell numbers of Karenia selliformis and Karenia mikimotoi respectively.

4. The TaqMan duplex fluorescence quantitative detection method for Karenia selliformis and Karenia mikimotoi according to claim 3, wherein, In step (1), the reaction system of the duplex TaqMan qPCR is: 10 μL AceQ Universal U+Probe Master Mix V2, 0.4 μL S5F, 0.4 μL S5R, 0.4 μL M3F, 0.4 μL M3R, 0.2 μL S5P, 0.2 μL M3P, 6 μL ddH2O and 2 μL DNA template; the reaction procedure is: 37°C for 2 min; 95°C for 10 min; 95°C for 10 sec; 59°C for 1 min, 45 cycles.

5. The TaqMan duplex fluorescence quantitative detection method for Karenia selliformis and Karenia mikimotoi according to claim 3, characterized in that, In step (2), the duplex TaqMan qPCR plasmid standard curve is: Karenia selliformis: y=-3.578x+40.781, the correlation coefficient r=-0.999, and the amplification efficiency is 90.32%; Karenia mikimotoi: y=-3.389x+40.712, the correlation coefficient r=-0.997, and the amplification efficiency is 97.27%; Among them, x represents the logarithm to the base 10 of the recombinant plasmid copy number, and y represents the Ct value.

6. The TaqMan duplex fluorescence quantitative detection method for Karenia selliformis and Karenia mikimotoi according to claim 3, characterized in that, In step (2), the duplex TaqMan qPCR cell standard curve is: Karenia selliformis: y=-3.692x+33.764, the correlation coefficient r=-0.996, and the amplification efficiency is 86.57%; Karenia mikimotoi: y=-3.544x+31.698, the correlation coefficient r=-0.998, and the amplification efficiency is 91.50%; Among them, x represents the logarithm (base 10) of the algal cell number, and y represents the corresponding Ct value.

7. The TaqMan duplex fluorescence quantitative detection method for Karenia selliformis and Karenia mikimotoi according to claim 3, wherein In step (2), the double TaqMan qPCR cell-plasmid standard curve is as follows: Karenia selliformis: y = 0.969x - 1.901; Karenia mikimotoi: y = 0.956x - 2.543; Among them, x represents the logarithm (base 10) of the recombinant plasmid copy number, and y represents the logarithm (base 10) of the cell number.

8. A product for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi, characterized in that, The product includes the probe primer composition for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi described in claim 1.

9. The product for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi according to claim 7, wherein The product includes any one of a detection reagent, a detection kit, and a detection chip.

10. Application of a product for TaqMan duplex fluorescence quantitative detection of Karenia selliformis and Karenia mikimotoi according to any one of claims 8 or 9 in detecting Karenia selliformis and Karenia mikimotoi.

Images