Recombinant pigeon alpha interferon and its application in preparing drugs for resisting pigeon paramyxovirus infection

Through the CHO cell expression system and Fc fusion protein technology, a highly efficient and stable recombinant pigeon α interferon piINF-5 was prepared, which solved the shortcomings of existing interferon treatment in pigeon paramyxovirus infection and achieved significant antiviral effects and a longer half-life.

CN120289651BActive Publication Date: 2025-09-19HUAZHONG AGRI UNIV +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510461679.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-09-19
Estimated Expiration
2045-04-14

AI Technical Summary

Technical Problem

Existing interferon treatments have problems such as species differences, immune tolerance and limited short-term efficacy, especially the lack of effective drugs for the treatment of pigeon paramyxovirus infection.

Method used

Through the CHO cell expression system, combined with pigeon α interferon and Fc fusion protein technology, a highly efficient and stable recombinant pigeon α interferon piINF-5 was prepared, which enhanced its efficacy and prolonged its half-life in the body.

Benefits of technology

Recombinant pigeon α-interferon piINF-5 exhibits high antiviral activity, high yield, and an antiviral titer of 3.5×106IU/mg. It has no obvious cytotoxicity, significantly reduces the titer and hemagglutination value of pigeon paramyxovirus, and enhances the disease resistance of pigeon flocks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005357310250000061
    Figure BDA0005357310250000061
  • Figure BDA0005357310250000081
    Figure BDA0005357310250000081
  • Figure BDA0005357310250000091
    Figure BDA0005357310250000091
Patent Text Reader

Abstract

The present invention belongs to the field of interferon genetic engineering, and discloses recombinant pigeon alpha interferon and its application in the preparation of medicines for resisting pigeon paramyxovirus infection. The present invention constructs recombinant pigeon interferon piINF 5, realizes efficient expression and purification in CHO cell expression system, significantly prolongs its half-life and improves stability. Recombinant pigeon interferon piINF 5 has no toxic effect on DF1 and VERO cells, and can effectively stimulate the transcription level of interferon-stimulated genes, can significantly inhibit the replication of pigeon paramyxovirus, reduce viral copy number and hemagglutination value. In vivo animal attack experiment shows that the recombinant pigeon interferon piINF 5 can well protect pigeons from the attack of pigeon paramyxovirus, and the survival rate reaches 80%, and there is no detoxification in the first five days after the attack, and only 20% of animals have detoxification in the later stage. The present invention provides an efficient and stable new drug selection for the treatment of pigeon paramyxovirus disease, with good commercial application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of interferon genetic engineering, and specifically relates to recombinant pigeon alpha interferon and its use in the preparation of a drug for preventing pigeon paramyxovirus infection. The pigeon alpha interferon provided by the present invention has the characteristics of high activity, antiviral effect and long half-life. Background Art

[0002] Pigeon Paramyxovirus (PPMV) is a major pathogen in the pigeon industry, causing respiratory, digestive, and neurological illnesses, and even death. The virus is highly contagious, and due to its high variability, current vaccines and drug treatments are limited in effectiveness, necessitating the development of effective antiviral drugs. Currently, there are no widely available treatments for PPMV, and conventional antiviral drugs are ineffective and prone to developing drug resistance. Therefore, finding a treatment that can significantly enhance antiviral activity, particularly an immune agent that can activate the host immune system and combat the virus, is of great scientific and practical value.

[0003] Interferons (IFNs) are a class of cytokines that activate the host immune system and inhibit viral replication. Clinically, pigeon viral diseases frequently occur. As a natural, broad-spectrum, and highly effective antiviral drug, pigeon interferon has a significant market demand. However, there are currently no commercially available pigeon interferon products, and avian interferon is the only treatment option. Therefore, there is an urgent need to develop a pigeon interferon preparation that possesses both antiviral and immunomodulatory properties.

[0004] However, existing interferon treatments have some problems, such as species differences, drug immune tolerance, and limited short-term efficacy. Among them, there are relatively few studies on pigeon interferon. Therefore, improving the half-life, stability, and activity of pigeon interferon has become an important direction of pigeon interferon research. Fc fusion protein technology can significantly prolong the half-life of the protein and enhance its stability by fusing the target protein with the Fc fragment of immunoglobulin G (IgG). To further optimize the therapeutic effect of pigeon interferon, pigeon α interferon combined with Fc fusion protein technology is used. This solution not only enhances the efficacy of interferon, but also prolongs its half-life in the body, providing a more efficient and long-lasting solution for antiviral treatment.

[0005] CHO cells (Chinese Hamster Ovary cells) are a commonly used eukaryotic expression system with the ability to efficiently and stably express exogenous proteins. Compared to other expression systems, CHO cells can provide accurate glycosylation modifications, which contribute to the correct folding and retention of biological activity of recombinant proteins. CHO cells have become an ideal system for large-scale production of recombinant proteins and are widely used in the pharmaceutical industry. Therefore, the CHO system can provide high-yield, high-purity, and biologically active recombinant pigeon interferon protein products. Summary of the Invention

[0006] The object of the present invention is to provide an artificially synthesized recombinant pigeon alpha interferon piINF-5, the amino acid sequence of the interferon is shown in SEQ ID NO.13, and one of the nucleotide sequences encoding it is shown in SEQ ID NO.14.

[0007] Another object of the present invention is to provide the use of recombinant pigeon alpha interferon in the preparation of drugs for resisting pigeon paramyxovirus infection.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] The applicant decomposed and combined the Fc fragments of pigeon α interferon and pigeon IgG respectively, and simultaneously optimized the codons, ultimately screening out the optimal combination to obtain recombinant pigeon α interferon piINF-5. The amino acid sequence of the interferon piINF-5 is shown in SEQ ID NO.13, which is a recombinant protein.

[0010] The protection scope of the present invention also includes:

[0011] The gene encoding the recombinant protein described in SEQ ID NO.13.

[0012] An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above-mentioned coding gene.

[0013] The use of the above-mentioned recombinant protein, recombinant protein encoding gene or expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell in the preparation of recombinant pigeon interferon.

[0014] The use of the above recombinant protein, recombinant protein encoding gene or expression cassette having the above encoding gene, recombinant vector, recombinant microorganism or in vitro recombinant cell in the preparation of drugs for treating or preventing pigeon virus infection.

[0015] In the above application, preferably, the pigeon virus includes: pigeon paramyxovirus or vesicular stomatitis virus.

[0016] The in vitro recombinant cells described in the above application are in vitro recombinant CHO cells.

[0017] The coding gene mentioned above is preferably shown as SEQ ID NO.14.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention relates to a highly efficient, stable and biologically active recombinant pigeon interferon. The applicant has successfully overcome the low efficiency and instability of traditional monomeric interferons through a CHO cell expression system, providing a new drug option for the treatment of pigeon paramyxovirus disease.

[0020] The recombinant pigeon interferon piINF-5 of the present application has the following characteristics: high yield, reaching 0.6g / L; strong antiviral activity, reaching 3.5×10 6 IU / mg, and without significant cytotoxicity. This recombinant pigeon interferon can effectively stimulate cells to increase the transcription levels of multiple immune-related genes, including ISG15, Mx, IFIT5, and IFITM10, showing significant biological activity.

[0021] Further studies have shown that the recombinant pigeon interferon piINF-5 can significantly reduce the titer and hemagglutination value of pigeon paramyxovirus in vitro, thereby enhancing the disease resistance of pigeon flocks.

[0022] The half-life of recombinant pigeon interferon piINF-5 is 8.16 hours, and it has certain preventive and therapeutic properties.

[0023] In vivo animal challenge experiments showed that the recombinant pigeon interferon piINF-5 can effectively protect pigeons against attacks by pigeon paramyxovirus, with a survival rate of 80%. There was no detoxification in the first five days after the challenge, and only 20% of the animals had detoxification in the later period. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Figure 2 is an SDS-PAGE image of the purified recombinant pigeon interferon piINF-2.

[0025] Figure 2 Figure 2 is an SDS-PAGE image of the purified recombinant pigeon interferon piINF-3.

[0026] Figure 3 Figure 2 is an SDS-PAGE image of the purified recombinant pigeon interferon piINF-5.

[0027] Figure 4 This is the cytotoxicity assay of purified recombinant pigeon interferon piINF-5.

[0028] Figure 5This is the transcription level of ISG15, Mx, IFIT5, and IFITM10 genes in Vero cells after inoculation of recombinant pigeon interferon piINF-5.

[0029] Figure 6 The copy number changes of pigeon paramyxovirus after DF1 cells were inoculated with recombinant pigeon interferon piINF-5.

[0030] Figure 7 The changes in the hemagglutination titer of pigeon paramyxovirus after DF1 cells were inoculated with recombinant pigeon interferon piINF-5.

[0031] Figure 8 This is the blood concentration-time curve of recombinant pigeon interferon piINF-5 in pigeons.

[0032] Figure 9 This is a statistical chart of the survival of each group of pigeons after treatment with recombinant pigeon interferon piINF-5.

[0033] Figure 10 Schematic diagram of the mRNA expression of ISGs in the immune organs of pigeons in the blank group, challenge group and high-dose treatment group after treatment with recombinant pigeon interferon piINF-5. DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. The following specific implementation cases are intended to illustrate the contents of the present invention but are not intended to limit the scope of the present invention. Any modification or replacement of the methods, steps or conditions of the present invention without departing from the spirit and essence of the present invention should be considered as part of the present invention.

[0035] Unless otherwise specified, the technical means used in the examples are conventional techniques well known to those skilled in the art.

[0036] Example 1:

[0037] Screening and preparation of recombinant pigeon interferon α

[0038] In order to prepare a recombinant pigeon interferon α protein that can be efficiently and correctly expressed in eukaryotic cells, the applicant decomposed and combined the Fc fragments of pigeon interferon α and pigeon IgG, and simultaneously optimized the codons to finally screen out the optimal combination. The specific steps are as follows:

[0039] The Fc fragment of pigeon IgG binding protein was obtained from GenBank (accession number: PKK16796.1) (the protein sequence is shown in SEQ ID NO.3, and the gene encoding it is shown in SEQ ID NO.4), and the Fc fragment was codon optimized and decomposed.

[0040] The pigeon interferon-α gene (protein sequence shown in SEQ ID NO. 1, gene encoding it shown in SEQ ID NO. 2) was obtained from GenBank (accession number: MG833835.1). Based on the signal peptide region prediction results from the Uniprot website, the pigeon interferon-α was truncated and optimized in different ways, and an Fc fragment was added to the C-terminus or N-terminus. Finally, a Kozak sequence (5'-GCCACCAUGG-3') was added to the N-terminus of the resulting fusion protein.

[0041] The applicant uses the following six screening schemes as examples for illustration. The combinations attempted in the experimental exploration stage of the present invention are not limited to the following six:

[0042] Scheme 1: The C-terminus of the artificially optimized pigeon interferon α1 is linked to the pigeon Fc1 fragment to form the recombinant protein piINF-1, the amino acid sequence of which is shown in SEQ ID NO.5, and the nucleotide sequence of which is shown in SEQ ID NO.6.

[0043] Solution 2: The C-terminus of the artificially optimized pigeon interferon α1 is linked to the pigeon Fc2 fragment to form the recombinant protein piINF-2, the amino acid sequence of which is shown in SEQ ID NO.7, and the nucleotide sequence of which is shown in SEQ ID NO.8.

[0044] Option 3: The C-terminus of the artificially optimized pigeon interferon α1 is linked to the pigeon Fc3 fragment to form the recombinant protein piINF-3, the amino acid sequence of which is shown in SEQ ID NO.9, and the nucleotide sequence of which is shown in SEQ ID NO.10.

[0045] Scheme 4: The N-terminus of the artificially optimized pigeon interferon α1 is linked to the pigeon Fc1 fragment to form the recombinant protein piINF-4, the amino acid sequence of which is shown in SEQ ID NO.11, and the nucleotide sequence of which is shown in SEQ ID NO.12.

[0046] Scheme 5: The C-terminus of the artificially optimized pigeon interferon α2 is linked to the pigeon Fc1 fragment to form the recombinant protein piINF-5. The amino acid sequence is shown in SEQ ID NO.13, and the nucleotide sequence is shown in SEQ ID NO.14.

[0047] Scheme 6: The N-terminus of the artificially optimized pigeon interferon α2 is linked to the pigeon Fc1 fragment to form the recombinant protein piINF-6. The amino acid sequence is shown in SEQ ID NO.15, and the nucleotide sequence is shown in SEQ ID NO.16.

[0048] Example 2:

[0049] CHO cell electroporation and identification

[0050] The six polynucleotides to be expressed obtained in Example 1 were cloned into the eukaryotic expression vector PXC17.4 to obtain a recombinant plasmid. The above recombinant plasmid was prepared by Wuhan Aokebot Biotechnology Co., Ltd.

[0051] Under sterile conditions, electrotransfection was performed using an Xcell Gene Pulser (Bio-Rad). The electrotransfection instrument was turned on, the cuvette mode was selected, and the experimental parameters were set: number of electrotransfections: 6, voltage: 200 V, interval: 1000 ms, pulse width: 1000 μs. Wild-type CHO cells were counted, the culture medium discarded by centrifugation, and the CHO cells were resuspended in PBS and counted again. The cells were then dispensed into 1.5 mL EP tubes, with a cell count of 1 × 10 cells per tube. 7 More than times, discard PBS after centrifugation. The electroporation cup can hold 200μL. Add 150μL of electroporation solution and 20ng of plasmid to each EP tube, mix well and add to the electroporation cup. Place the electroporation cup in the electrotransfection instrument and start the program. After the end, transfer the cells in the electroporation cup into a shaking bottle, add 30mL of basic culture medium, and culture in a shaker at 36-37°C and 5% CO2 (shaking speed 135rpm) for 24h. Subsequently, collect the cells by low-speed centrifugation and replace with glutamine-free basic culture medium containing 50μM MSX. Cells are suspended and cultured. Samples are taken after about 48h. WB is used to detect whether the protein is secreted and expressed.

[0052] Among them, the recombinant proteins piINF-4 and piINF-6 were not expressed, the recombinant protein piINF-1 was expressed at a low level and severely degraded, and the recombinant proteins piINF-2, piINF-3, and piINF-5 were able to be secreted and expressed at relatively high levels. Therefore, piINF-2, pi INF-3, and piINF-5 were selected for the preparation of recombinant pigeon interferon and the subsequent determination of its antiviral potency.

[0053] Example 3:

[0054] Preparation of recombinant pigeon interferon α

[0055] The cells successfully secreted and expressed in Example 2 were cultured by gradually changing the medium until the cell viability recovered. The culture volume was expanded according to the experimental needs, and the cell density reached 4×10 6 The above was supplemented with a feed culture according to the total volume of cell culture of 2% solution A and 0.2% solution B, and the cell viability dropped to about 80% before harvesting. Cell debris was removed by centrifugation to obtain a supernatant containing recombinant pigeon interferon. Protein purification was performed by affinity chromatography, and elution was performed using a suitable buffer (0.02 mol / L PB, 300 mmol / L imidazole, pH 7.4). After purification, the molecular weight and purity of the recombinant protein were verified by SDS-PAGE. The SDS-PAGE identification results are shown in FIG. Figure 1As shown: the relative molecular mass of the obtained recombinant protein piINF-2 is 57kDa; the results are as follows Figure 2 As shown: The relative molecular mass of the recombinant protein piINF-3 is 52kDa; the results are as follows Figure 3 As shown: the relative molecular mass of the recombinant protein piINF-5 is 70 kDa, which is consistent with the expected value. The purified recombinant pigeon interferon was concentrated and freeze-dried for storage.

[0056] After conversion, the yield of recombinant protein piINF-2 was 0.5 g / liter of cell fluid, the yield of recombinant protein piINF-3 was 0.53 g / liter of cell fluid, and the yield of recombinant protein piINF-5 was 0.6 g / liter of cell fluid.

[0057] Example 4:

[0058] Detection of potency and cytotoxicity of recombinant pigeon interferon α

[0059] For the potency determination of recombinant pigeon interferon α, Vero cells were seeded in 96-well plates and cultured overnight to 80% confluency. Serial dilutions of recombinant pigeon interferon α at different concentrations (2.5 μg / ml to 100 μg / ml) were added to each well. After incubation for 24 hours, 100 TCID 50 Vesicular stomatitis virus (VSV-GFP virus) was added to each well, 100 μl per well, and cultured for 24 hours. GFP-positive cells were observed under an inverted fluorescence microscope (fluorescence counts greater than 50% were pathological cells), and an inhibition microassay based on CPE (cytopathic effect) inhibition was used. The reciprocal of the dilution at which the highest dilution of interferon per ml could still protect half of the cells (50) from viral attack was defined as the interferon unit. The percentage of normal cells at different interferon dilutions was calculated, and the distance ratio = (percentage above 50% - 50) / (percentage above 50% - percentage below 50%) was calculated to obtain the international unit of interferon (expressed in IU / mL), which was then divided by the concentration of recombinant pigeon interferon α to obtain the potency of each recombinant protein.

[0060] The results showed that the titer of the recombinant protein piINF-2 was 9×10 5 IU / mg, and the potency of the recombinant protein piINF-3 was 1.3×10 6 IU / mg, and the potency of the recombinant protein piINF-5 was 3.5×10 6 IU / mg. Among them, the recombinant protein piINF-5 has the highest potency and will be used in subsequent applications for antiviral activity.

[0061] Vero and DF-1 cells were seeded in 96-well plates at a cell number of 1×10 4Cells were cultured overnight to 80% confluency. Serial dilutions of the recombinant pigeon interferon piINF-5 to be tested were added to each well at varying concentrations (2.5 μg / ml to 100 μg / ml), with five replicates per well. After 24 and 48 hours of treatment, 10 μL of CCK-8 reagent was added to each well. The cells were incubated for an additional 1-4 hours. OD values ​​were read at 450 nm using a microplate reader to calculate cell viability. Cell viability = (OD value of the treated group - OD value of the blank group) / (OD value of the control group - OD value of the blank group) × 100%.

[0062] The cytotoxic effects of recombinant pigeon interferon piINF-5 on DF1 cells and Vero cells Figure 4 As shown in the results, the recombinant pigeon interferon had no obvious toxicity to Vero and DF1 cells in the concentration range of 2.5ug / ml to 100ug / ml.

[0063] Example 5:

[0064] Activation of downstream signaling molecules by recombinant pigeon interferon α piINF-5

[0065] Vero cells were seeded in 24-well plates and cultured overnight until 80% confluence. 0.5 mL of culture medium (2% DMEM culture medium) was added to each well, and recombinant pigeon interferon piINF-5 was added to a concentration of 1000 IU / well. Blank control cells were set up and incubated for 0 h, 6 h, 12 h, 24 h, 36 h, and 48 h, respectively. Cell lysate was collected and total RNA was extracted using trizol reagent (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cDNA was synthesized using a reverse transcription kit (purchased from Nanjing Novozymes Biotechnology Co., Ltd.). Four interferon-stimulated genes (ISG15, MX, IFIT5, IFITM10) were selected, and qPCR reactions were performed using the designed primers (as shown in Table 1). The SYBR Green fluorescent probe method was used, and 3 replicate wells were set up for each sample. The results were analyzed by 2 -ΔΔCT Methods The relative gene expression levels were calculated and normalized using GAPDH as an internal reference gene.

[0066] The results are as follows Figure 5 The results showed that in the recombinant pigeon interferon-treated group, ISG15 and MX reached peak expression at 6 hours after cell treatment, while IFIT5 and IFITM10 reached peak expression at 24 hours. Recombinant pigeon interferon can effectively activate the expression of these antiviral-related genes, initiating an antiviral immune response. The activation time of different genes varies, reflecting their different response mechanisms.

[0067] Table 1 Real-time fluorescence quantitative PCR primers

[0068]

[0069] Example 6:

[0070] Effect of recombinant pigeon interferon α piINF-5 on pigeon paramyxovirus

[0071] In the in vitro experiment of recombinant pigeon interferon against pigeon paramyxovirus, DF1 cells were seeded into 6-well plates and cultured overnight until 80% confluence. Recombinant pigeon interferon piINF-5 was added so that the titer of each well was in a concentration gradient. After incubation for 0h, 3h, 6h, 12h, 24h, and 36h, 20uL of pigeon paramyxovirus (the virus was isolated by itself and the titer was 10 7 TCID 50 / 0.1mL) and continued incubation until 80% cytopathic effect developed. Cells were harvested and frozen and thawed twice at -80°C. Viral RNA was extracted using an RNA extraction kit (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.) and reverse transcribed into cDNA. Real-time quantitative PCR (qPCR) was used to measure viral copy number and evaluate the inhibitory effect of recombinant pigeon interferon-α piINF-5 on viral replication. (Primers and probes used for qPCR: PPMV-F: ATGTACTCAAAGACTGAAGGCG; PPMV-R: TCTCCATAATTTTGCGATATGATACC; PPMV-P: 5'-FAM-ACGCCATACATGGCCCT CAAAGGCTCAGT-BHQ1-3').

[0072] The results are as follows Figure 6 The results showed that when cells were incubated with recombinant pigeon interferon α piINF-5 at a concentration of 10,000 IU / well for 6 hours, the copy number of pigeon paramyxovirus was significantly reduced, showing an obvious antiviral effect.

[0073] Hemagglutination test:

[0074] Add the cell virus solution from each well of the above experiment to the hemagglutination plate, and then perform a gradient dilution of the samples in different columns to obtain a series of test samples with different concentrations; add a 5% red blood cell suspension to the test wells and mix thoroughly; then let it react at room temperature for 15 minutes; and observe the hemagglutination titer (the highest dilution of the antigen that causes complete agglutination of the red blood cells is used as the hemagglutination titer of the antigen).

[0075] The results are as follows Figure 7 As shown in the results, it was further shown that recombinant pigeon interferon alpha piINF-5 significantly reduced the hemagglutination titer of pigeon paramyxovirus, further verifying its significant antiviral effect. These results indicate that recombinant pigeon interferon alpha piINF-5 has significant antiviral activity against pigeon paramyxovirus.

[0076] Example 7:

[0077] Determination of the half-life of recombinant pigeon interferon α piINF-5

[0078] Recombinant pigeon α interferon piINF-5 was injected into the pigeons by leg muscle injection at a dose of 50,000 IU / kg. Blood samples were collected from the pigeons at different time points (0h, 1h, 2h, 4h, 6h, 8h, 12h, 24h, and 48h). The interferon titer in the serum was determined using the cytostatic lesion assay, thereby indirectly estimating the interferon concentration in the serum. Based on the interferon concentration data at different time points, the blood drug concentration-time curve was drawn as shown in Figure 2. Figure 8 As shown, the first-order kinetic model (C = C0 * e^ (-kt)) was used to fit the data to calculate the half-life of recombinant pigeon α interferon piINF-5 in vivo. By this method, the half-life of recombinant pigeon α interferon piINF-5 was obtained to be 8.16 hours, reflecting its metabolism and clearance rate in pigeons. Example 8:

[0079] Application of recombinant pigeon interferon alpha piINF-5 in the preparation of drugs for preventing pigeon paramyxovirus infection

[0080] Twenty healthy experimental pigeons were randomly divided into four groups. The pigeon paramyxovirus solution was diluted to 1×10 9 TCID 50 / 0.1mL, dilute the freeze-dried recombinant pigeon α interferon piINF-5 (hereinafter referred to as recombinant pigeon interferon) prepared in Example 3 to 10 5 IU / mL and 10 6 IU / mL, and the specific grouping is shown in Table 2. Group A is the high-dose recombinant pigeon interferon treatment group, Group B is the low-dose recombinant pigeon interferon treatment group, Group C is the pigeon paramyxovirus control group, and Group D is the blank control group. After the first day of challenge, the experimental group received an intramuscular injection of interferon once a day for 7 consecutive days. The challenge and injection doses are shown in Table 2.

[0081] Table 2 Interferon treatment trial groups

[0082]

[0083] Clinical symptom monitoring

[0084] Clean water and feed were provided every day, and the mortality, diet, body temperature changes, feces and neurological status (typical clinical symptoms of pigeon paramyxovirus such as lameness and paralysis) of the experimental group pigeons were observed and recorded daily. The score was used (normal was recorded as 0 points, depression and neck retraction were recorded as 1 point, drooping wings, torticollis, and ataxia were recorded as 2 points, complete paralysis and collapse were recorded as 3 points, and death was recorded as 4 points). The higher the score, the more serious the disease.

[0085] Results The survival statistics of each group of pigeons after treatment are as follows Figure 9 As shown, group A is the high-dose interferon treatment group with a mortality rate of 20%, group B is the low-dose interferon treatment group with a mortality rate of 40%, group C is the challenge control group with a mortality rate of 100%, and group D is the blank control group with a mortality rate of 0%.

[0086] Table 3 shows the statistical results of clinical symptom scores for each group of pigeons after treatment. Group A (high-dose treatment group): On days 1-3, some pigeons experienced brief depression, but no severe neurological symptoms. On days 4-7, symptoms gradually subsided, with only a few pigeons occasionally experiencing neck retraction. On days 8-10, 80% of pigeons recovered, but one pigeon developed ataxia on day 8, which rapidly worsened and ultimately led to death. Group B (low-dose treatment group): On days 1-4, depression and neck retraction were common, with 20% experiencing wing droop. On days 5-7, symptoms worsened, with 40% developing torticollis or ataxia, and three becoming completely paralyzed. On days 7-9, two pigeons died. Group C (challenge control group): On days 3-5, 80% of pigeons developed ataxia or wing droop. On days 6-8, all pigeons collapsed and died before day 10. Group D (blank control group): No abnormalities were observed throughout the treatment, and all pigeons maintained a score of 0.

[0087] Table 3 Clinical scores of treatment trials

[0088]

[0089]

[0090] Detoxification monitoring

[0091] Anal swabs were collected from the test pigeons at regular intervals every day, centrifuged at 12,000 rpm for 10 minutes, and the supernatant was used for RNA extraction and reverse transcription. The viral copy number was detected by real-time quantitative PCR (qPCR). The primers were shown in Example 6.

[0092] The results of detoxification in each group are shown in Table 4. The high-dose treatment group did not detoxify in the first 5 days, only one pigeon in the low-dose treatment group continued to detoxify, and all pigeons in the challenge control group continued to detoxify.

[0093] Table 4 Detoxification status of treatment trials

[0094]

[0095] Detection of ISGs mRNA expression in immune organs

[0096] After autopsy, the spleen of each group was collected, and RNA was extracted from the tissue using the Trizol method and reverse transcribed. Graphpad Prism 8.0 software was used for plotting according to the fluorescence quantitative detection method.

[0097] The qPCR method was used to detect the mRNA expression of ISGs in the spleen tissue of the blank group, the challenge group and the high-dose treatment group (hereinafter referred to as the treatment group). Figure 10 As shown, the expression of ISGs in pigeons treated with high-dose interferon was significantly induced, and the expression of ISGs in pigeons challenged with interferon was also increased. The ISG15 gene was upregulated by about 2-fold in the treatment group compared with the challenge group and about 18-fold in the treatment group compared with the blank group; the MX gene was upregulated by about 3-fold in the treatment group compared with the challenge group and about 35-fold in the treatment group compared with the challenge group; the IFIT5 gene was upregulated by about 5-fold in the treatment group compared with the challenge group and about 22-fold in the treatment group compared with the challenge group; and the IFITM10 gene was upregulated by about 5-fold in the treatment group compared with the challenge group and about 42-fold in the treatment group compared with the challenge group.

[0098] This invention provides recombinant pigeon interferon alpha, piINF-5, and demonstrates its use against pigeon paramyxovirus. Using a CHO cell expression system, we have successfully overcome the inefficiency and instability of traditional monomeric interferons, providing a new drug option for the treatment of pigeon paramyxovirus disease. Recombinant pigeon interferon alpha, piINF-5, not only exhibits high antiviral efficacy but also possesses excellent pharmacological properties, demonstrating significant potential for clinical application.

Claims

1. A synthetic recombinant protein, the amino acid sequence of which is shown in SEQ ID NO.

13.

2. The gene encoding the recombinant protein according to claim 1.

3. The coding gene according to claim 2, wherein the gene is shown as SEQ ID NO.

14.

4. An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell containing the coding gene according to claim 2.

5. The recombinant cell according to claim 4, characterized in that The recombinant cells are in vitro recombinant CHO cells.

6. Use of the recombinant protein according to claim 1, the coding gene according to claim 2, or the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the coding gene according to claim 2 according to claim 4 in the preparation of recombinant pigeon interferon.

7. Use of the recombinant protein according to claim 1, the coding gene according to claim 2, or the expression cassette, recombinant vector, recombinant microorganism, or in vitro recombinant cell having the coding gene according to claim 2 according to claim 4 in the preparation of a medicament for treating or preventing pigeon virus infection, wherein the pigeon virus is pigeon paramyxovirus or vesicular stomatitis virus.

Citation Information

Patent Citations

  • Porcine fusion interferon

    CN104292337A

  • Recombinant pigeon interferon alpha as well as expression engineering strain and preparation method thereof

    CN116143900A