Fermented lactobacillus mucilaginosus BM01 with bowel relaxing effect and application of fermented lactobacillus mucilaginosus BM01

Abstract

The invention belongs to the technical field of probiotics, and particularly relates to fermented lactobacillus mucus BM01 with an effect of relaxing bowel and application of the fermented lactobacillus mucus BM01. A new fermented lactobacillus mucus BM01 strain is separated from excrement of a healthy infant in Guangzhou city, Guangdong province, a zebra fish constipation model is constructed through loperamide hydrochloride, and research finds that the strain can remarkably promote intestinal tract movement, increase the content of in-vivo serotonin and inhibit the enzyme activity of dipeptidyl peptidase-4, so that the constipation of the zebra fish can be inhibited, the constipation of the zebra fish can be inhibited, and the constipation of the zebra fish can be inhibited. Therefore, the bowel relaxing effect is achieved. It is indicated that the BM01 strain can play the bowel relaxing effect through multiple mechanisms, has significant application value, can be used for research and development of drugs for treating constipation, irritable bowel syndrome and other intestinal diseases or development of health care products with the bowel relaxing effect, and can also be used as a feed additive to improve animal intestinal health and reduce disease risks. The culture benefit is improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of probiotics, and particularly relates to a fermented Lactobacillus mucosae BM01 with the efficacy of moistening the intestines and relieving constipation and its application. Background Art

[0002] The term "probiotics" originated from Greek. With the in-depth understanding of probiotics, keywords such as regulating the intestinal flora, indigenous bacteria, live microorganisms, and viable cell count have been incorporated into the concept of probiotics. Currently, the widely accepted definition of probiotics by the Food and Agriculture Organization of the United Nations / World Health Organization is that when administered in sufficient amounts, they are live microorganisms that are beneficial to the host. In recent years, probiotic cells and their lysates have also been proven to provide beneficial effects to the human body.

[0003] With the acceleration of the social rhythm and the change of the diet structure, the incidence of constipation shows a gradually increasing trend. Constipation is that the waste and toxins in the human body cannot be discharged normally, forming fecal impaction that accumulates in the intestine. The toxins in the fecal impaction are repeatedly absorbed by the intestine, causing problems such as loss of appetite, gastrointestinal discomfort, abdominal bloating, and the appearance of chloasma, color patches, acne, etc. on the skin. Severe constipation can lead to electrolyte and acid-base balance disorders, causing diseases such as hemorrhoids and varicose veins of the lower extremities, affecting people's lives. In addition, the accumulation of toxins or harmful metabolites caused by poor intestinal defecation is closely related to the occurrence and development of various chronic diseases. Probiotics are live organisms, and when given in sufficient amounts, they will bring health benefits to the host and have important application prospects in improving constipation. However, probiotics have strain specificity, and not all probiotic strains have the effect of moistening the intestines and relieving constipation.

[0004] Limosilactobacillus fermentum belongs to the genus Lactobacillus in the family Lactobacillaceae and is a normal flora in the intestines, oral cavity, and vagina of humans and animals. It has the ability to maintain the stability of the gut microbiota and improve the host's internal environment, and is one of the most important types of lactic acid bacteria that promote human health. Limosilactobacillus fermentum plays a key role in multiple fields. In the food industry, it is widely used in the production of fermented foods such as yogurt, pickles, and fermented soy products. Taking yogurt as an example, Limosilactobacillus fermentum participates in the fermentation process, not only turning milk into delicious yogurt, but also increasing the nutritional value of yogurt and enhancing the absorption and utilization rate of minerals such as calcium and phosphorus by the human body. In the feed industry, Limosilactobacillus fermentum is used as a feed additive, which can improve the microecological balance of animal intestines, enhance animal immunity, and promote animal growth. In the medical field, relevant research has found that Limosilactobacillus fermentum may have potential effects on regulating the human gut microbiota, relieving diarrhea, and reducing cholesterol, providing new ideas for the development of new functional foods and drugs. However, the current research on Limosilactobacillus fermentum is still in a relatively preliminary stage, and there are relatively few studies on using Limosilactobacillus fermentum for laxative effects.

[0005] In summary, based on the current still difficult-to-control problem of constipation, and the probiotic characteristics vary at the strain level, and there are differences in the efficacy and action mechanisms of probiotic strains of the same species but different strains, screening and obtaining probiotic strains with outstanding laxative effects and clear action mechanisms is still the difficulty and focus of current research. Summary of the Invention

[0006] In order to overcome the above deficiencies of the prior art, the present invention isolated a new strain of Limosilactobacillus fermentum BM01 from the feces of a healthy infant in Guangzhou, Guangdong Province. This strain can play a laxative effect by promoting intestinal peristalsis, increasing the content of serotonin (5-HT) in the body, and inhibiting the activity of dipeptidyl peptidase-4, and has significant application value in multiple fields such as medicine and feed.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a strain of Limosilactobacillus fermentum BM01, which is isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, and its deposit number is CCTCC NO: M 20242113.

[0009] Preferably, the 16S rDNA of the Limosilactobacillus fermentum BM01 strain is as shown in SEQ ID No: 1.

[0010] The second aspect of the present invention provides the use of the Limosilactobacillus fermentum BM01 strain in the preparation of a product for moistening the intestines and relieving constipation.

[0011] Preferably, the product for moistening the intestines and relieving constipation is suitable for improving functional constipation.

[0012] Preferably, the moistening of the intestines and relieving of constipation is to promote intestinal peristalsis, and / or increase the content of serotonin (5-HT) in the body, and / or inhibit the activity of dipeptidyl peptidase-4 enzyme.

[0013] Preferably, the product includes drugs, feeds, or health products.

[0014] The third aspect of the present invention provides a probiotic agent, which uses the Limosilactobacillus fermentum BM01 strain as the main active ingredient.

[0015] Preferably, in the probiotic agent, the number of BM01 strains is not less than 1×10 4 CFU / mL.

[0016] Preferably, the probiotic agent further includes excipients acceptable in the fields of pharmacy, feed, or health products.

[0017] Preferably, the probiotic agent of the present invention can be a liquid probiotic agent or a solid probiotic agent, and can be prepared by adding excipients allowed in the field of microbial agents using conventional technical means.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] A new strain of Limosilactobacillus fermentum BM01 was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. Through the construction of a zebrafish constipation model with loperamide hydrochloride, it was found that this strain could significantly promote intestinal peristalsis, increase the content of serotonin (5-HT) in the body, and inhibit the activity of dipeptidyl peptidase-4, thereby exerting the effect of moistening the intestines and relieving constipation. It shows that strain BM01 can exert the effect of moistening the intestines and relieving constipation through multiple mechanisms. First, promoting intestinal peristalsis can accelerate the movement of food in the intestines, reduce excessive water absorption, and make the feces moist and easy to excrete. Second, increasing the content of serotonin can regulate intestinal motility and secretion functions, strengthen intestinal peristalsis and promote mucus secretion, and soften feces. Third, inhibiting the activity of dipeptidyl peptidase-4 can increase the level of incretin, thereby promoting intestinal peristalsis, inhibiting gastric acid secretion and delaying gastric emptying, and jointly improving intestinal digestion and excretion functions. Therefore, this strain has significant application value and can be used to develop drugs for treating intestinal diseases such as constipation and irritable bowel syndrome, or develop health care products with the effect of moistening the intestines and relieving constipation. It can also be used as a feed additive to improve animal intestinal health, reduce disease risks, and improve breeding efficiency. Brief Description of the Drawings

[0020] Figure 1 It is the phylogenetic tree of Limosilactobacillus fermentum BM01 strain (the strains for tree construction are from the Genome database of NCBI);

[0021] Figure 2 It is the intuitive diagram (A) and statistical chart (B) of the intestinal colonization of Limosilactobacillus fermentum BM01 strain (n = 6);

[0022] Figure 3 It is the intuitive diagram (A) and statistical chart (B) of the effect of Limosilactobacillus fermentum BM01 on zebrafish intestinal peristalsis (n = 6);

[0023] Figure 4 It is the statistical chart of the effect of Limosilactobacillus fermentum BM01 on the content of 5-HT in zebrafish (n = 3);

[0024] Figure 5 It is the statistical chart of the effect of Limosilactobacillus fermentum BM01 on the activity of dipeptidyl peptidase-4 in zebrafish (n = 3). Detailed Embodiments

[0025] The following further describes the detailed embodiments of the present invention. It should be noted here that the description of these embodiments is for helping to understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0026] In the following examples, the experimental methods are conventional methods unless otherwise specified. The test materials used in the following examples are commercially available through conventional channels unless otherwise specified.

[0027] In the following examples, the E3 culture water was prepared as follows: Weigh 11.7 g of sodium chloride, 0.506 g of potassium chloride, 1.465 g of anhydrous magnesium sulfate and 1.584 g of anhydrous calcium chloride, mix them, add an appropriate amount of pure water and stir well, then add an appropriate amount of pure water to dilute to 4 L to obtain 10×E3 culture water. Store at room temperature for no more than 7 days (all reagents used for preparation are analytical pure reagents, all purchased from Macklin, and the conductivity of pure water should be less than or equal to 10 us / cm). When using, measure 400 mL of the 10×E3 culture water prepared in the previous step into a suitable container, add 3.6 L of pure water, and stir well.

[0028] In the following examples, the bacteria solution, the drugs used in the positive group, and the drugs used to establish the model were all diluted to the corresponding concentrations with E3 culture water.

[0029] Example 1: Obtaining of Limosilactobacillus fermentum BM01 strain

[0030] The Limosilactobacillus fermentum BM01 strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. The specific method is as follows:

[0031] Collect fresh feces using a 50 mL sterile centrifuge tube, transport them to the laboratory under cold chain, and after surface disinfection, transfer the sample to a biosafety cabinet. Add an appropriate amount of sterile water according to the feces quality (add 800 - 1000 uL of sterile water per 100 mg) for full dissolution, take an appropriate amount of the sample and spread it on an MRS culture plate, and culture it at 37°C in an anaerobic workstation. After 48 h, pick a single colony and inoculate it onto a new MRS culture plate, and culture it in the anaerobic workstation for 24 hours. Refer to the "Bergey's Manual of Determinative Bacteriology" (8th edition) and the "Manual of Fungal Classification and Identification" to observe the colony growth status. Name the purified and isolated strain, numbered BM01. The growth state of this strain is that the colony is round, with a smooth surface, neat edges, and is milky white and opaque.

[0032] The isolated BM01 strain was cultured on a large scale. After molecular identification of the isolated BM01 strain using 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT), 16S sequencing was performed by Genewiz Biotechnology Co., Ltd. The obtained 16S rDNA sequence (SEQ ID No: 1) was subjected to BLAST alignment in the Genome database of NCBI. The results showed that the homology of the BM01 strain with the 16S rDNA sequence of the known Limosilactobacillus fermentum was > 99%, and a phylogenetic tree was constructed with homologous strains for evolutionary analysis ( Figure 1 ), confirming that the BM01 strain is a different strain of the same species of Limosilactobacillus fermentum.

[0033] Finally, the BM01 strain was preserved, and the preservation information is as follows: Preservation time: September 29, 2024; Name of the preservation unit: China Center for Type Culture Collection (CCTCC); Preservation number: CCTCC NO: M 20242113; Address of the preservation unit: Wuhan University, Wuhan, China; Taxonomic name: Limosilactobacillus fermentum.

[0034] Limosilactobacillus fermentum BM01 16S rDNA sequence (1455bp, SEQ ID No: 1):

[0035]

[0036] Zebrafish have a digestive system similar to that of humans, such as the liver, intestine, etc. The digestion, absorption, and transportation of nutrients are highly similar to those of humans. The intestine of zebrafish has peristaltic function, which can promote the transportation of food and feces. In addition, there are also microbial communities in the zebrafish intestine, which play an important regulatory role in the normal physiological functions of the intestine. Therefore, in this test, a zebrafish constipation model (functional constipation) was constructed with loperamide hydrochloride to verify the laxative effect of strain BM01.

[0037] 1. Test materials

[0038] 1.1 Test system

[0039] The zebrafish used in this test were AB strain zebrafish, purchased from Nanjing Yishulihua Biotechnology Co., Ltd.

[0040] 1.2 Reagents

[0041] Table 1 Reagents and materials

[0042]

[0043] 1.3 Main equipment

[0044] Table 2 Instruments and equipment

[0045]

[0046] 1.4 Test article information

[0047] In this test, there was a total of 1 test article, and the details are shown in Table 3.

[0048] Table 3 Test article information

[0049]

[0050] 3. Experimental methods

[0051] 3.1 Intestinal colonization of Lactobacillus mucosae BM01

[0052] (1) Experimental grouping: normal group, 1×10 4 CFU / mL, 1×10 5 CFU / mL, 1×10 6 CFU / mL Lactobacillus mucosae BM01 group; 10 tails in each group.

[0053] (2) Intervention: Select wild-type AB strain zebrafish at 3 dpf and place them in a cell culture plate. The normal group was added with E3 culture water, and the Lactobacillus mucosae BM01 group was added with the corresponding concentration of FITC-stained bacterial solution and intervened in an incubator at 28.5°C for 3 days.

[0054] (3) Intestinal fluorescence intensity: After the intervention, the zebrafish were placed under a fluorescence microscope for photographing and observation of the intestinal fluorescence intensity, and the Image J software was used to calculate the fluorescence intensity.

[0055] (4) Data analysis: The experimental data were all expressed as mean ± SEM, and one-way ANOVA was used. Compared with the normal group: * P < 0.05, ** P < 0.01, *** P < 0.001.

[0056] 3.2 Effects of Lactobacillus mucosae BM01 on intestinal peristalsis of zebrafish

[0057] (1) Experimental grouping: normal group, model group, 1×10 4 CFU / mL, 1×10 5 CFU / mL, 1×10 6 CFU / mL Lactobacillus mucosae BM01 group.

[0058] (2) Model construction and intervention: Healthy wild-type AB strain zebrafish larvae at 5 dpf were selected and placed in a 6-well cell culture plate. A 10 ng / mL nile red solution was added to each group, and they were incubated in the dark at 28.5 °C for 16 h in an incubator. After incubation, the normal group was added with E3 culture water, the model group was added with a 25 μg / mL loperamide hydrochloride solution, and the Lactobacillus mucosae BM01 group was added with the corresponding concentration of bacterial solution (containing 25 μg / mL loperamide hydrochloride), and they were incubated in the dark at 28.5 °C for 24 h in an incubator.

[0059] (4) Relative level of intestinal peristalsis: After the intervention, the zebrafish were placed under a fluorescence microscope for photographing and observation of the intestinal nile red fluorescence intensity, and the Image J software was used to calculate the fluorescence intensity. The relative intestinal peristalsis level of zebrafish was calculated according to the following formula:

[0060]

[0061] (5) Determination of serotonin (5-HT) content in zebrafish: After the intervention, the zebrafish were washed twice, transferred to a centrifuge tube, added with PBS for homogenization, and centrifuged to take the supernatant. The 5-HT content was detected by targeted metabolomics (LC-MS).

[0062] (6) Determination of dipeptidyl peptidase-4 enzyme activity in zebrafish: After the intervention, the zebrafish were washed twice, transferred to a centrifuge tube, added with PBS for homogenization, and centrifuged to take the supernatant. The dipeptidyl peptidase-4 enzyme activity and total protein were detected by a zebrafish dipeptidyl peptidase-4 enzyme ELISA kit and a BCA protein quantification detection kit.

[0063] (7) Data analysis: All experimental data were expressed as mean ± SEM and analyzed by t-test. Compared with the normal group: ### P < 0.001; analyzed by one-way ANOVA, compared with the model group: * P < 0.05, ** P < 0.01, *** P < 0.001.

[0064] 4. Experimental results

[0065] 4.1. Intestinal colonization of Lactobacillus mucosae BM01

[0066] Based on the above test method, the results of intestinal colonization of Lactobacillus mucosae BM01 are as Figure 2 shown in and Table 4:

[0067] As Figure 2 shown in and Table 4, compared with the normal group, the intestinal fluorescence intensity of zebrafish in the 1×10 4 CFU / mL and 1×10 5 CFU / mL Lactobacillus mucosae BM01 groups increased but without statistical significance (P > 0.05), and the intestinal fluorescence intensity of zebrafish in the 1×10 6 CFU / mL Lactobacillus mucosae BM01 group increased extremely significantly (P < 0.001).

[0068] Table 4 Statistical table of intestinal colonization of Lactobacillus mucosae BM01 in zebrafish (n = 6)

[0069]

[0070] 4.2. Effect of Lactobacillus mucosae BM01 on intestinal peristalsis of zebrafish

[0071] Based on the above test method, the effect of Lactobacillus mucosae BM01 on intestinal peristalsis of zebrafish is as Figure 3 shown in and Table 5:

[0072] As Figure 3 shown in and Table 5, compared with the normal group, the intestinal peristalsis level of zebrafish in the model group decreased extremely significantly (P < 0.001), indicating that the constipation model was successfully constructed in this test. Compared with the model group, the intestinal peristalsis level of zebrafish in the 1×10 4 CFU / mL Lactobacillus mucosae BM01 group increased and had statistical significance (P < 0.05), and the intestinal peristalsis levels of zebrafish in the 1×10 5 CFU / mL and 1×10 6 CFU / mL Lactobacillus mucosae BM01 groups increased extremely significantly (P < 0.001).

[0073] Table 5 Statistical table of the effect of fermented Lactobacillus mucosae BM01 on the intestinal peristalsis of zebrafish (n = 6)

[0074]

[0075]

[0076] 4.3 Effect of fermented Lactobacillus mucosae BM01 on serotonin (5-HT) in zebrafish

[0077] Based on the above test method, the effect of fermented Lactobacillus mucosae BM01 on the 5-HT content in zebrafish is shown in Figure 4 and Table 6

[0078] From Figure 4 and Table 6, it can be seen that compared with the normal group, the 5-HT content in the zebrafish of the model group was extremely significantly decreased (P < 0.001). Compared with the model group, the 5-HT content in the zebrafish of the 1×10 4 CFU / mL, 1×10 5 CFU / mL and 1×10 6 CFU / mL fermented Lactobacillus mucosae BM01 groups were all extremely significantly increased (P < 0.001).

[0079] Table 6 Statistical table of the effect of fermented Lactobacillus mucosae BM01 on the 5-HT content in zebrafish (n = 3)

[0080]

[0081] 4.4 Effect of fermented Lactobacillus mucosae BM01 on the activity of dipeptidyl peptidase-4 in zebrafish

[0082] Based on the above test method, the effect of fermented Lactobacillus mucosae BM01 on the activity of dipeptidyl peptidase-4 in zebrafish is shown in Figure 5 and Table 7

[0083] From Figure 5 and Table 7, it can be seen that compared with the normal group, the activity of dipeptidyl peptidase-4 in the zebrafish of the model group was extremely significantly increased (P < 0.001), indicating that the constipation model was successfully constructed in this test. Compared with the model group, the activity of dipeptidyl peptidase-4 in the zebrafish of the 1×10 4 CFU / mL fermented Lactobacillus mucosae BM01 group was decreased and had statistical significance (P < 0.05), and the activities of dipeptidyl peptidase-4 in the zebrafish of the 1×10 5 CFU / mL and 1×10 6 CFU / mL fermented Lactobacillus mucosae BM01 groups were all extremely significantly decreased (P < 0.001).

[0084] Table 7 Statistical table of the effect of Lactobacillus mucosae BM01 on dipeptidyl peptidase-4 enzyme activity in zebrafish (n = 3)

[0085]

[0086]

[0087] In summary, Lactobacillus mucosae BM01 at concentrations of 1×10 4 CFU / mL, 1×10 5 CFU / mL and 1×10 6 CFU / mL can significantly promote intestinal peristalsis in zebrafish, increase the serotonin content in zebrafish, and inhibit the activity of dipeptidyl peptidase-4. The above test results indicate that Lactobacillus mucosae BM01 has the effect of moistening the intestines and relieving constipation.

[0088] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.

Claims

1. A strain of Limosilactobacillus fermentum BM01, characterized in that, The Limosilactobacillus fermentum BM01 strain was isolated from the feces of a healthy infant in Guangzhou City, Guangdong Province, and its deposition number is CCTCC NO: M 20242113.

2. A Limosilactobacillus fermentum BM01 strain according to claim 1, characterized in that, The 16S rDNA of the Limosilactobacillus fermentum BM01 strain is as shown in SEQ ID No:

1.

3. Use of the Limosilactobacillus fermentum BM01 strain according to claim 1 or 2 in the preparation of a product for promoting bowel movement and relieving constipation.

4. The application according to claim 3, characterized in that, The product for promoting bowel movement and relieving constipation is suitable for improving functional constipation.

5. The application according to claim 3, wherein The promotion of bowel movement and relieving constipation means promoting intestinal peristalsis, and / or increasing the content of serotonin in the body, and / or inhibiting the activity of dipeptidyl peptidase-4.

6. The application according to claim 3, characterized in that, The product includes drugs, feeds, or health products.

7. A probiotic agent, characterized in that, The bacterial agent uses the Limosilactobacillus fermentum BM01 strain according to claim 1 or 2 as the main active ingredient.

8. A probiotic agent according to claim 7, characterized in that, In the said microbial agent, the number of BM01 strain is not less than 1×10 4 CFU / mL.

9. A probiotic agent according to claim 7, characterized in that, The bacterial agent also includes excipients acceptable in the fields of pharmacy, feed, or health products.

Images