A dsrna for killing termites and a method for controlling termites by combining the dsrna with metarhizium

By using the dsGr14 double-stranded RNA sequence to inhibit the expression of the termite Gr14 gene, and combining it with Metarhizium anisopliae, the environmental pollution problem caused by chemical termite control was solved, and a highly efficient termite control effect was achieved.

CN120290574BActive Publication Date: 2026-06-30INST OF ZOOLOGY GUANGDONG ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF ZOOLOGY GUANGDONG ACAD OF SCI
Filing Date
2025-04-16
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing chemical methods for termite control cause environmental pollution and harm beneficial organisms, making them difficult to effectively control termites.

Method used

The expression of the Gr14 gene in termites was suppressed by using the dsGr14 double-stranded RNA sequence, and combined with Metarhizium anisopliae, and controlled through feeding and spraying.

Benefits of technology

It significantly increased the termite mortality rate, especially when used in combination with dsGr14 and Metarhizium anisopliae, where the termite mortality rate could reach 75%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290574B_ABST
    Figure CN120290574B_ABST
Patent Text Reader

Abstract

This invention discloses a termite-killing dsRNA and its combination with Metarhizium anisopliae for termite control. The nucleotide sequence of the termite dsRNA is shown in SEQ ID NO.2. Inhibiting the expression of the termite taste receptor 14 gene (Gr14 gene) using RNAi significantly increases termite mortality. Spraying termites after inhibiting Gr14 gene expression using RNAi achieves a termite mortality rate of approximately 75%, thus it can be considered an effective method for termite control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of termite control, specifically relating to a termite-killing agent dsGr14 and its method for controlling termites in combination with Metarhizium anisopliae. Background Technology

[0002] Termites are one of the world's five major pests, affecting most parts of the globe. Currently, chemical control methods are mainly used to control termites, but this not only easily leads to environmental pollution but also harms other beneficial organisms.

[0003] Taste receptors (Gr) are receptor proteins located on the surface of taste receptor cells. When these receptor proteins bind to corresponding taste molecules, they generate excitatory impulses, allowing organisms to perceive different tastes. Taste receptor 14 (Gr14) is one of the taste receptor genes in termites. Metarhizium anisopliae is a type of fungus widely found in nature that can infect insects and is pathogenic to them. Summary of the Invention

[0004] The first objective of this invention is to provide dsGr14, which kills termites.

[0005] The termite-killing dsGr14 is a double-stranded RNA sequence that targets the termite Gr14 gene and inhibits its expression. The termite Gr14 gene is shown as bases 289 to 1716 of SEQ ID NO.1.

[0006] The nucleotide sequence of the termite-killing dsGr14 is: AAAACCGCATCAGAGATGTACGTAGTATAAACCACAAGAAAGAAGATAAAAATTCTCTGCGCAGAGTGATGAGTTTCTTTATGTTAATAGCACAGTGCTTCGGCCTGTGCCCGGTGGGAGGAATCACTGGCCTGACCGCTCAGCATTTGAGGTTCAGCTGGTGTTCTTGGCGGGTTGGTTA CTGCGTTGTCATGATGACCGGAATGATGGCCGGGTTTGGGTTTACCATTGCCTTTTACATGAAAGGCTTCTTTAGTTTTGAAACGTCTTCGACTGTCATGCTTTATAGTCTTGGCTTTTCATGTTGCGCCTGCTTCATGAACCTGGCTCGACACTGGCCTCGTCTTGAGGAGCTGTGGCAAAGAACTGAACACGAACAAGT.

[0007] A second objective of this invention is to provide the application of the aforementioned termite-killing dsGr14 in termite control.

[0008] Preferably, the application of the termite-killing dsGr14 combined with Metarhizium anisopliae in termite control is preferred.

[0009] A third objective of this invention is to provide a termite control agent containing the aforementioned termite-killing dsGr14 as an active ingredient.

[0010] It is a preferred ingredient and also contains Metarhizium anisopliae.

[0011] Further preferred, the *Metarhizium anisopliae* is *Metarhizium anisopliae*.

[0012] The fourth objective of this invention is to provide a method for controlling termites, which involves feeding termites the aforementioned termite-killing dsGr14 to them so that they can consume it and thus control the termites.

[0013] Preferably, it can be added to termite food or attractants.

[0014] Preferably, the termite-killing agent dsGr14 is fed to the termites so that they will eat it, and then the termites are sprayed with Metarhizium anisopliae to control the termites.

[0015] This invention utilizes RNAi feeding technology to feed termites a double-stranded RNA sequence of the Gr14 gene (dsGr14) to inhibit Gr14 gene expression, and then observes the termite survival rate. Furthermore, after feeding termites dsGr14, they are sprayed with Metarhizium anisopliae, and the termite survival rate is observed again. These two methods demonstrate that the combined use of dsGr14 and Metarhizium anisopliae is an effective method for termite control.

[0016] This invention can effectively increase the mortality rate of termites by feeding them dsGr14 and by spraying them with Metarhizium anisopliae after feeding them dsGr14. The latter method results in a higher mortality rate and can be used as a method for termite control.

[0017] Inhibiting the expression of the termite taste receptor 14 gene (Gr14 gene) using RNAi significantly increases termite mortality. Spraying termites after inhibiting Gr14 gene expression using RNAi achieves a termite mortality rate of approximately 75%, thus it can be considered an effective method for termite control. Attached Figure Description

[0018] Figure 1 shows the effect of feeding termites with dsGr14 on the survival rate of termites;

[0019] Figure 2 shows the effect of feeding termites with dsGr14 and Gram-negative bacteria simultaneously on the survival rate of termites. Detailed Implementation

[0020] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0021] Example 1:

[0022] 1. Implementation method:

[0023] The nucleotide sequence of the termite taste receptor gene (Gr14 gene) is shown as bases 289 to 1716 of SEQ ID NO.1 (underlined portion).

[0024] SEQ ID NO.1

[0025] AATGGTAGTCCATAATTTATAATTGAATTGAAATAGAAGTAGTAAACTATTTTCAAAGTATTTAGAGACATGTATGGTTTAATAGACCTCATTATGTAGCAAACTGCGCTCAGTTTCGGACTAATATGTTCAACATGGCATTTC CAGTTTATTGTATCATTGATGTATATTCCAAGAAACTTAATATTGGATATGGTTGTGATTTGTTTTATTGTCATAAGCAATCTTGATATTAGTTACTGGTTTGTTTTTAGTTGTATACTGGATAAAATGTGTTTTATTAAAATTG ATGGAAAGTAAG TTTCCTACTTATGAGCATCTTCACCGCTCACAAATTTTTACTTTTTCTTGGAAATCCCACTGAAGGAGCTGTTGAAGA GTCTGAACGGATGTCTGTGGTTTCTCTGAAAATATCTTACTCCGACTCCCACAGTAAAGGCAAATGTCATAAAGCTGT ACACCAAAAACCGCATCAGAGATGTACGTAGTATAAACCACAAGAAAGAAGATAAAAATTCTCTGCGCAGAGGTGATG AGTTTCTTATGTTAATAGCACAGTGCTTCGGCCTGTGCCCGGTGGGAGGAATCACTGGCCTGACCGCTCAGCATTT GAGGTTCAGCTGGTGTTCTTGGCGGGTTGGTTACTGCGTTGTCATGATGACCGGAATGATGGCCGGGTTTGGGTTTA CCATTGCCTTTTACATGAAAGGCTTCTTTAGTTTTGAAACGTCTTCGACTGTCATGCTTTATAGTCTTGGCTTTTCA TGTTGCGCCTGCTTCATGAACCTGGCTCGACACTGGCCTCGTCTTGAGGAGCTGTGGCAAAGAACTGAACACGAACA AGTGAAATACGGATATCCAAAGAAACTTCACCTCAACATTAAAATTATATCTGCTGTAACGCTAGCAATAGCACTGG GAGAACATTTACTAAAGAAGTACACACATTTGTCTGTGGCTGCTCTGTGTGCAGAGAACAAGGTAGAACTCTTGAAG CTGTACTACCTCATGCATTACCGCTACGTATTTGAGTTCGTCAAATTTTCACCGCCTGTAGCGTGTTTTTGTGAAAT TGTGAATTTCTTTGCTGCATTCTATTGGAACTTCGTGGACCTGTTTGTAATCGTCCTTAGCATGGCAATGGCAAGCC GTTTTCGGCTGCTAAACAGCCATCTGAAACTGGAAAGAGGGAAGTTTAAGCCGGAAGAATTCTGGAGAGAGACTCGA GTGAATTACAACAGCCTCTCGTCTCTGACGAAGTTCCTCGACTCCTGTATTTCAAGCATTGTCCTCATATCATTCGC TACGAACATGTTCTACATCTGTCAACAACTCTATAATATCCTCAGAAAATCCGTCGCCACTGTGAAAGTGGTTTACT TCTTCGTCTCGTTTAGCTACTTGCTGTTCAGAACAATTGCTGTATCCCTGTGTGGAGCGAGCATACACGACGAAAGC CGAGCTACAAAGAATTTCTTGTACGCTGTGCCTACACAGAGCTACAAAATCGAAGTACACCGATTCATTGTTCAGCT TTCTACAGATTCGGTTGCCCTTACCGGATTTAATTTCTTCACCGTTAACAGGACATTGCTACTTACGCTGGGTGGGA CGGTTGTAACATACGTGGTGGTGATGGTGCAATTCAGCAACCCTTCAGCAAGTCAATCAAGCAATGACACGCAATTG TGCCTGAATATTTCTCAGATGTTACAATAA AACTGGTACGTTAGTGGTATTAACTTACAGCAGAAACAAAGGAAAGATGGTAATGTTAGAAAAGATGTTCAATTCCACACTATTTTGACTTTCCTTTTACACTCAATACATGAACTACATTATTTTGTAAACTATATGGAAGTTCATTATTAATTTAAAATATGCCCAACAGACGAAACAAAAAAAAAA

[0026] Based on the obtained Gr14 gene sequence information, specific double-stranded RNA primers (Gr14-dsRNA-F, Gr14-dsRNA-R, T7-Gr14-dsRNA-F and T7-Gr14-dsRNA-R, see Table 1) were designed and synthesized according to the instructions of the kit (T7RiboMAX™ Express RNAi System, Promega, catalog number P1700) to obtain Gr14 double-stranded RNA (dsGr14).

[0027] The nucleotide sequence of the double-stranded RNA (dsGr14) is shown in SEQ ID NO.2:

[0028] SEQ ID NO.2

[0029] AAAACCGCATCAGAGATGTACGTAGTATAAACCACAAGAAAGAAGATAAAAATTCTCTGCGCAGAGTGATGAGTTTCTTTATGTTAATAGCACAGTGCTTCGGCCTGTGCCCGGTGGGAGGAATCACTGGCCTGACCGCTCAGCATTTGAGGTTCAGCTGGTGTTCTTGGCGGGTTGGTTACTGCGTTGTC ATGATGACCGGAATGATGGCCGGGTTTGGGTTTACCATTGCCTTTTACATGAAAGGCTTCTTTAGTTTTGAAACGTCTTCGACTGTCATGCTTTATAGTCTTGGCTTTTCATGTTGCGCCTGCTTCATGAACCTGGCTCGACACTGGCCTCGTCTTGAGGAGCTGTGGCAAAGAACTGAACACGAACAAGT.

[0030] Forty worker Formosan subterranean termites of uniform size were placed in a 3 cm diameter petri dish, along with a 1 cm square filter paper for the termites to feed on. 40 μL of dsGr14 was added to the filter paper as the experimental group (dsGr14 dosage was 2 μg / cm²). 2 The mortality rate of termites was then observed over ten days. The control group received an equal volume of water. Three replicates were designed for both the experimental and control groups.

[0031] In addition, 2 μg / cm was added to the filter paper. 2Two days after the dsGr14 treatment, 100 µL of Metarhizium anisopliae (3.0 × 10⁷ CFU / mL, Guangdong Provincial Microbial Culture Collection Center (GDMCC), accession number GDMCC No. 3.528) was sprayed onto the surface of the termites, and the mortality rate of the termites was observed over ten days. The control group was prepared by adding ddH₂O to filter paper and then spraying 100 µL of Tween solution or Metarhizium anisopliae solution (3.0 × 10⁷ CFU / mL) onto the surface of the termites. Three replicates were designed for both the experimental and control groups.

[0032]

[0033] Implementation results:

[0034] Statistical analysis of termite mortality data after feeding on dsGr14 revealed that within the ten-day observation period, no worker termites died in the control group (fed water), while 22.5% of worker termites died in the treatment group (fed dsGr14). This indicates that feeding termites dsGr14 significantly impacts their survival rate and substantially increases their mortality rate (e.g., Figure 1 The specific impacts are as follows:

[0035] In the control group where termites were fed water, no termites died; the feeding concentration was 2 μg / cm³. 2 Within ten days of the dsGr14 treatment, nine termites died, with a mortality rate of 22.5%, which was significantly higher than the mortality rate of the control group.

[0036] Statistical analysis of mortality data from termites fed with dsGr14 and sprayed with Metarhizium anisopliae revealed that, over the ten-day observation period, only a few worker termites died in the control group fed water and sprayed with Tween, approximately one-third of the worker termites in the control group fed water and sprayed with Metarhizium anisopliae died, while in the treatment groups (fed dsGr14 and sprayed with Metarhizium anisopliae), more than half of the worker termites died. This indicates that feeding termites dsGr14 followed by spraying with Metarhizium anisopliae has a very significant impact on termite survival (e.g., ...). Figure 2 This can significantly increase the mortality rate of termites. The specific effects are as follows:

[0037] In the control group that fed termites water and sprayed them with Tween, only one termite died within ten days, with a mortality rate of approximately 2.5%. In the control group that fed termites water and sprayed them with Metarhizium anisopliae, only 13 termites died within ten days, with a mortality rate of approximately 32.5%. After feeding termites dsGr14 and spraying them with Metarhizium anisopliae for ten days, 30 termites died, with a mortality rate of 75%, significantly higher than the two control groups (Figure 2).

[0038] in conclusion:

[0039] The above results indicate that RNAi feeding to suppress termite Gr14 gene expression significantly increases termite mortality, while simultaneous feeding of termites with dsGr14 and spraying them with Metarhizium anisopliae results in even higher mortality. Therefore, this method of combined use of dsGr14 and Metarhizium anisopliae can be used to control termites.

Claims

1. A termite-killing agent, dsGr14, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

2.

2. The application of dsGr14, the termite killer according to claim 1, in termite control.

3. The application according to claim 2, characterized in that, This describes the application of dsGr14, a termite killer, in combination with Metarhizium anisopliae in termite control. Metarhizium anisopliae is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No. 3.

528.

4. A termite control agent, characterized in that, It contains dsGr14, the termite killer as described in claim 1, as an active ingredient.

5. The termite control agent according to claim 4, characterized in that, It also contains Metarhizium anisopliae, which is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No. 3.

528.

6. A method for controlling termites, characterized in that, The termite-killing agent dsGr14 described in claim 1 is fed to termites to control them.

7. The method according to claim 6, characterized in that, This involves adding dsGr14, a termite killer, to termite food or attractants.

8. The method according to claim 6, characterized in that, The method involves feeding termites with dsGr14, a termite killer, and then spraying them with Metarhizium anisopliae to control the termites. Metarhizium anisopliae is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No. 3.528.

Citation Information

Patent Citations

  • IDH gene dsRNA capable of improving termite control effect of metarhizium anisopliae

    CN111849984A

  • Reticulitermes chinensis Snyder SeBP gene and application of combination of dsRNA of Reticulitermes chinensis Snyder SeBP gene and metarhizium anisopliae in termite control

    CN113122546A