Oil compositions with engineered lipid mass spectrometry and methods of producing same

Abstract

Provided herein are engineered microorganisms comprising one or more genes involved in fatty acid metabolism. For example, there is provided an engineered microorganism comprising a first nucleic acid sequence encoding an elongase and a second nucleic acid sequence encoding a desaturase wherein the first and second nucleic acid sequences are operably linked to a promoter. Methods of making and using engineered microorganisms are also provided. Also provided are microbial oils comprising fatty acids, wherein the fatty acids comprise C20: 3 (n-6) (di-homo-gamma-linoleic acid) and C20: 5 (n-3) eicosapentaenoic acid (EPA). In addition, provided herein are methods for promoting the conversion of saturated fatty acids to unsaturated fatty acids by transforming a microorganism with a nucleic acid encoding a polypeptide involved in the fatty acid synthesis pathway, resulting in increased conversion of saturated fatty acids to unsaturated fatty acids.

Description

[0001] Cross - reference to related applications

[0002] This application claims the priority of U.S. Provisional Patent Application No. 63 / 429,852, filed on December 2, 2022, which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which is submitted electronically in.xml format and incorporated herein by reference in its entirety. The.xml copy was created on November 29, 2023, titled "MAR - 025US - WO - 095523 - 1416607 - 1412622.xml", and is 36 Kb in size. It is hereby stated that the information recorded in computer - readable form is the same as the written sequence listing and does not include content beyond what is disclosed in the international application being filed. Background Art

[0005] Certain microorganisms produce oil via two parallel fatty acid synthesis pathways: the classical fatty acid synthesis (FAS) pathway and the polyunsaturated fatty acid (PUFA) synthase pathway. Medium - chain fatty acids such as myristic acid (C14:0) and palmitic acid (C16:0) are typically produced by the FAS pathway, and long - chain polyunsaturated fatty acids (LC - PUFA) such as docosahexaenoic acid (DHA, C22:6 n - 3) and docosapentaenoic acid (DPA, C22:5 n - 6) are typically produced by the PUFA synthase pathway. However, the resulting fatty acid profiles vary widely among different microorganisms, depending on the relative activities of these parallel pathways. Summary of the Invention

[0006] Provided herein are engineered microorganisms comprising one or more heterologous nucleic acids encoding polypeptides involved in fatty acid metabolism. For example, provided is an engineered microorganism comprising a first nucleic acid sequence encoding an elongase and a second nucleic acid sequence encoding a desaturase, wherein the first and second nucleic acid sequences are operably linked to a promoter. Also provided are methods of preparing and using the engineered microorganisms. Also provided is a microbial oil comprising fatty acids, wherein the fatty acids include C20:3(n - 6) (di - homo - γ - linolenic acid) and C20:5(n - 3) eicosapentaenoic acid (EPA). In addition, provided herein is a method of promoting the conversion of saturated fatty acids to unsaturated fatty acids by transforming a microorganism with one or more nucleic acids encoding polypeptides involved in the fatty acid synthesis pathway, thereby generating an increased conversion of saturated fatty acids to unsaturated fatty acids. Brief Description of the Drawings

[0007] Figure 1 is a schematic diagram showing the fatty acid modification pathway of C16:0 in the FAS pathway.

[0008] Figure 2 are a series of schematic diagrams showing constructs transformed into WT T18 or derivative strains for the production of different fatty acids. The Δ9 desaturase, α-tubulin, and PUFA synthase subunit B promoters, terminators (1 kb upstream and downstream of the native genes respectively), and internal coding regions were used as homologous arms for homologous recombination.

[0009] Figure 3A is a schematic diagram of WT T18 and its homologous recombination constructs (95 and 116), and shows the Southern blotting strategy for confirming homologous recombinants at the Δ9 desaturase in WT T18 and 95 series and 116 series transformants. Figure 3B is a Southern blotting image indicating that all transformants underwent homologous recombination at the Δ9 locus with a heterozygous transformant: 116-2. The probe was located in the region upstream of the Δ9 desaturase promoter. The blot indicates that all transformants are homologous recombinants at the Δ9 desaturase locus.

[0010] Figure 4 is a Southern blotting image of WT T18 and 12 transformants from the 95 series (as Figure 2 and Figure 3A shown). Genomic DNA (gDNA) from each transformant was digested with PstI. The blot was probed with the neomycin sequence to detect the neomycin resistance gene in the transformants. All transformants showed the presence of the neomycin resistance (neo-R) gene. The neo-R gene was not present in WT T18.

[0011] Figure 5 is a graph showing fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18 and selected 95 series transformants. Also see the fatty acid legend in Figure 1 . The strains were grown in flasks containing 25 mL of WDL medium until glucose depletion, approximately 7 days. The pellet was harvested and freeze-dried. Values are expressed as mg of total fatty acids present per g of dried biomass.

[0012] Figure 6 is a graph showing FAME analysis of the same 95 series transformants as Figure 5 , but expressed as a percentage of the total fatty acid profile. Also see the fatty acid legend in Figure 1 .

[0013] Figure 7 is a graph showing FAME analysis of freeze-dried biomass of strain 95-1 grown in conventional WDL medium or WDL containing low nitrogen. Values are expressed as mg of total fatty acids present per g of dried biomass. Also see the fatty acid legend in Figure 1 .

[0014] Figure 8 It is a graph showing the FAME analysis of samples collected during the fermentation of transformant 95-1. Also see Figure 1 for the legend of fatty acids.

[0015] Figure 9 It is a Southern blot of luciferase transformants targeting the native Δ9 desaturase locus.

[0016] Figure 10 It is a table showing selected FAME data for luciferase transformants, showing the complete absence of C16:1 n-7, C18:1 n-9, and C18:1 n-7 in transformant Δ12 luciferase 4.

[0017] Figure 11 It is a graph of FAME data showing the fatty acid content (in mg / g dry biomass) of 57 series transformants compared to WT T18. Also see Figure 1 for the legend of fatty acids.

[0018] Figure 12 It is a table showing selected FAME data for 57 series transformants, showing an increase in C16:1 n-7 and C18:1 n-7 compared to WT T18.

[0019] Figure 13 It is a graph of FAME data showing the fatty acid content (in mg / g dry biomass) of 84 series transformants compared to WT T18. Also see Figure 1 for the legend of fatty acids.

[0020] Figure 14 It is a table showing selected FAME data for 84 series transformants, showing an increase in C16:1 n-7 and C18:1 n-7 compared to WT T18.

[0021] Figure 15 It is a graph of the fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18 and selected 116 series transformants. Also see Figure 1 for the legend of fatty acids. The transformants were grown in flasks containing 25 mL of medium until glucose depletion, approximately 7 days. The precipitate was harvested and freeze-dried. Values are expressed as mg of total fatty acids present per g of dry biomass.

[0022] Figure 16A A schematic diagram of the constructs of WT T18 and its homologous recombinants with pHR47 at the α-tubulin locus is provided. Figure 16BShows a Southern blot comparing recombinants in the WT, 95-1, and 110 series. The probe was used for the region downstream of the α-tubulin terminator. Based on the larger fragment sizes shown in the Southern blot, 110-1, 3, 4, 9, and 10 can detect the α-tubulin double knockout.

[0023] Figure 17 Is a graph showing fatty acid methyl ester (FAME) analysis of lyophilized biomass of WT T18, 95-1 parental, and 110 series transformants. Also see Figure 1 the fatty acid legend. The transformants were grown in flasks containing 25 mL of medium until glucose depletion, approximately 7 days. The pellet was harvested and lyophilized. Values are expressed as mg of total fatty acids present per g of dry biomass.

[0024] Figure 18 Is a graph showing fatty acid methyl ester (FAME) analysis of lyophilized biomass of WT T18 and 67-1 from cultures fed with different free fatty acid substances. Values are total fatty acids present per g of dry biomass. The conversion of ALA to EPA and GLA to ARA is visible in 67-1. Also see Figure 1 the fatty acid legend.

[0025] Figure 19A Provides a schematic diagram of the constructs of WT T18 and its homologous recombinants at the subB locus with pHR47 in the 113 series. Figure 19B Is a Southern blot comparing homologous recombination of the construct in pHR52 at the subB locus in WT T18 and 113 series transformants. The probe was used for the region upstream of the subB promoter. 113-4 is a double knockout at subB.

[0026] Figure 20 Is a graph showing fatty acid methyl ester (FAME) analysis of lyophilized biomass of WT T18 and 113 series transformants. Values are expressed as mg of total fatty acids present per g of dry biomass. Also see Figure 1 the fatty acid legend.

[0027] Figure 21A Provides a schematic diagram of the constructs of WT T18 and homologous recombinants where pHR58 is located at the subB locus in the 121 series. Figure 21B Is a Southern blot showing WT-T18 and transformants with homologous recombination. The probe was used for the region downstream of the subB promoter. 121-1 is a double knockout at the subB locus.

[0028] Figure 22Chart of fatty acid methyl ester (FAME) analysis of lyophilized biomass of 121-1 from cultures fed with different free fatty acid (FFA) species (0.5 mM FFA in each culture). Values are expressed as mg of total fatty acids present per g of dry biomass. The conversion of linoleic acid (LA) to α-linolenic acid (ALA) can be seen in each culture. See also Figure 1 for the fatty acid legend.

[0029] Figure 23 is Figure 22 a chart of the FAME results of 121-1 shown in Figure 1 expressed as percentage of total fatty acids (TFA%). See also

[0030] Figure 24 a chart showing an increase in the substrate conversion rate of the enzyme when the Δ12 desaturase (at the α-tubulin locus or the Δ9 desaturase locus, as shown in the above chart) is expressed in the same open reading frame as the C16 elongase and the Δ9 desaturase rather than at discrete loci.

[0031] Figure 25A is a schematic diagram showing WT T18 and the homologous recombinants in which subB is replaced by pHR64 or pHR62. Figure 25B is a Southern blot comparing WT T18 and the transformants in which subB is replaced by pHR64 or pHR62. The probe is specific for the region downstream of subB TR. 127-3 and 129-1 seem to have a recombination event at sub and may be subB double knockouts, but they lack the expected fragment size for the double knockout. 129-2 seems to be a double knockout at subB with the expected fragment size.

[0032] Figure 26 is a chart of fatty acid methyl ester (FAME) analysis of lyophilized biomass of the 116-5 parent and the 127 series transformants. Values are expressed as mg of total fatty acids present per g of dry biomass. See also Figure 1 for the fatty acid legend.

[0033] Figure 27 is a chart of fatty acid methyl ester (FAME) analysis of lyophilized biomass of the 116-5 parent and the 129 series transformants. Values are expressed as mg of total fatty acids present per g of dry biomass. See also Figure 1 for the fatty acid legend.

[0034] Figure 28Chart of fatty acid methyl ester (FAME) analysis of the freeze-dried biomass of the 121-1 subcultured axenic strains 121-1-S and 121-1-F. Values are expressed as mg of total fatty acids present per g of dry biomass. Also see Figure 1 for the fatty acid legend.

[0035] Figure 29 Chart of fatty acid methyl ester (FAME) analysis of the freeze-dried biomass of the 127-3 and 129-2 subcultured axenic transformants 127-3-T, 127-3-W, 127-3-R, and 127-3-P (127-3-T, W, R + P) and 129-2-T, 129-2-W, 129-2-R, and 129-2-P (129-2-T, W, R + P). Values are expressed as mg of total fatty acids present per g of dry biomass. Also see Figure 1 for the fatty acid legend.

[0036] Figure 30 Is as Figure 28 Chart of the same FAME results of the 127-3 and 129-2 subcultured axenic transformants as shown, expressed as % TFA. Also see Figure 1 for the fatty acid legend.

[0037] Figure 31 Chart of fatty acid methyl ester (FAME) analysis of the freeze-dried biomass of the WT T18 and 164 series transformants. Also see Figure 1 for the fatty acid legend. The transformants were grown in flasks containing 25 mL of medium until glucose depletion, approximately 5 days. The pellet was harvested and freeze-dried. Values are expressed as mg of total fatty acids present per g of dry biomass.

[0038] Figure 32 Chart of fatty acid methyl ester (FAME) analysis of the freeze-dried biomass of the 167 series transformants. Also see Figure 1 for the fatty acid legend. The transformants were grown in flasks containing 25 mL of medium until glucose depletion, approximately 5 days. The pellet was harvested and freeze-dried. Values are expressed as mg of total fatty acids present per g of dry biomass.

[0039] Figure 33 Chart of fatty acid methyl ester (FAME) analysis of the freeze-dried biomass of the 165 series transformants. Also see Figure 1 for the fatty acid legend. The transformants were grown in flasks containing 25 mL of medium until glucose depletion, approximately 9 days. The pellet was harvested and freeze-dried. Values are expressed as mg of total fatty acids present per g of dry biomass.

[0040] Figure 34 IsFigure 33 Graph of the results shown in, and expressed as % TFA. Also see Figure 1 fatty acid legend of

[0041] Figure 35 is a graph of the fatty acid methyl ester (FAME) analysis of the lyophilized biomass of and 173 series transformants. Also see Figure 1 fatty acid legend of. Transformants 173-1 and 173-2 (173-1+2) were grown in 25 mL of 10% N WDL in a flask until glucose consumption stalled at approximately 13 g / L glucose after 7 days. Transformant 173-3 was grown in a flask containing 25 mL of 10% NWDL until glucose was depleted after 4 days. The precipitate was harvested and lyophilized. Values are expressed as mg of total fatty acids present per g of dry biomass.

[0042] Figure 36 is a graph of the fatty acid methyl ester (FAME) analysis of the lyophilized biomass of the 173-1 and 173-2 subcultured axenic transformants 173-1-T, 173-1-W, 173-1-R and 173-1-P (173-1-T, W, R+P) and 173-2-W, 173-2-R and 173-2-P (173-2-W, R+P). Values are expressed as mg of total fatty acids present per g of dry biomass. Also see Figure 1 fatty acid legend of

[0043] Figure 37 is Figure 33 graph of the 173-1 and 173-2 subcultured axenic transformants shown in, and expressed as % TFA. Also see Figure 1 fatty acid legend of

[0044] Figure 38 is a graph of the RT-qPCR results of the differential expression of five elongases in WT T18 versus 173-1-R and 173-2-R.

[0045] Figure 39 is a graph of the fatty acid methyl ester (FAME) analysis of the lyophilized biomass of 173-1-R ALE 2-3 C1-8. Values are expressed as mg of total fatty acids present per g of dry biomass. Also see Figure 1 fatty acid legend of

[0046] Figure 40 is Figure 39 graph of the FAME results of 173-1-R ALE 2-3 C1-8 shown in, and expressed as % TFA. Also see Figure 1 fatty acid legend of

[0047] Figure 41 It is a chart of fatty acid methyl ester (FAME) analysis of the freeze-dried biomass of 173-1-R and 173-1-R MUT1. Values are expressed as mg of total fatty acids present per g of dry biomass. Also see Figure 1 the fatty acid legend.

[0048] Figure 42 It is Figure 41 a chart of the FAME results of 173-1-R and 173-1-R MUT1 shown in Figure 1 and expressed as TFA%. Also see

[0049] Figure 43 It is a chart of fatty acid methyl ester (FAME) analysis of the freeze-dried biomass of 173-1-R and 173-1-R MUT5. Values are expressed as mg of total fatty acids present per g of dry biomass. Also see Figure 1 the fatty acid legend.

[0050] Figure 44 It is Figure 43 a chart of the FAME results of 173-1-R and 173-1-R MUT5 shown in Figure 1 and expressed as TFA%. Also see

[0051] Figure 45 It is a chart comparing the 116 series (which has C16 elongase (Obl) 3' to Δ9 PR) with the 136 series and 137 series conversions (which have Δ6 desaturase (Bty) and Ω3 desaturase (Obl) 3' to Δ9 PR) respectively. The oleic acid production of the 136 and 137 series transformants is reduced by approximately 10-fold compared to the 116 series transformants. The activity of C16 elongase (Obl) on C16:0 in the 136 and 137 series is reduced, resulting in an accumulation of C16:0 that is 2.5 times more than that in the 116 series. Also see Figure 1 the fatty acid legend.

[0052] Figure 46 It is a chart showing the FAME analysis of strains 180-1 and 180-2 (in mg / g).

[0053] Figure 47 It is a chart showing the FAME analysis of strains 183-3, 183-5, 183-6, 183-7 and 183-8 (in mg / g).

[0054] Figure 48 It is a chart showing the FAME analysis of strains 183-8-T, 183-8-W, 183-8-R and 183-8-P (in mg / g).

[0055] Figure 49 Chart showing the FAME analysis of strains 190-1, 190-2, 190-3, 190-4, 190-5, 190-6 (in mg / g). Detailed implementation mode

[0056] Certain microorganisms, including Thraustochytrids, produce oils containing various lipids, including fatty acids in various forms and amounts. As used herein, the term lipid includes phospholipids, free fatty acids, fatty acid esters, triacylglycerols, sterols and sterol esters, carotenoids, lutein (such as oxidized carotenoids), hydrocarbons, and other lipids. Fatty acids are hydrocarbon chains terminated by a carboxyl group, and are called unsaturated if they contain at least one carbon-carbon double bond, and polyunsaturated if they contain multiple carbon-carbon double bonds. For example, microorganisms can produce (i) short-chain fatty acids (SCFAs), which are fatty acids with an aliphatic tail of less than six carbons (e.g., butyric acid); (ii) medium-chain fatty acids (MCFAs), which are fatty acids with an aliphatic tail of 6-12 carbons; (iii) long-chain fatty acids (LCFAs), which are fatty acids with an aliphatic tail of more than 13 carbons. The types and amounts of these fatty acids produced by different microorganisms vary. Microorganisms and methods are provided herein for converting the production of these fatty acids from medium-chain fatty acids produced via the FAS pathway to long-chain fatty acids produced via the PUFA synthase pathway. Fatty acid synthesis (FAS) is defined as the production of fatty acids from acetyl-CoA and NADPH through the action of an enzyme called fatty acid synthase. The PUFA synthase pathway is capable of de novo synthesis of polyunsaturated fatty acids from malonyl-CoA by large multi-domain, multi-subunit enzymes. The main end product of the FAS pathway is palmitate, while the main end products of the PUFA synthase are PUFAs, such as DHA and DPA.

[0057] Microorganisms can be used for commercial production of lipids for use in nutritional supplements, animal feed, or biofuels. Increasing the content of monounsaturated or polyunsaturated fatty acids (MUFA and PUFA) at the expense of saturated fatty acids results in increased oil fluidity, making downstream processing easier. Biofuel applications may require shorter carbon chains or MUFAs. Nutritional applications may require high Ω-3 or Ω-6 content. In addition to targeting specific oil profiles, it is also crucial to continuously produce the same profile in an industrial environment using the same method. Genetically modified strains are provided herein that are capable of producing a consistent oil profile in fermentation.

[0058] Eukaryotic microorganisms used to produce the provided microbial oils and biomass include, but are not limited to, those selected from the genus Oblongichytrium ( Oblongichytrium , Obl), Aurantiochytrium ( Aurantiochytrium ), Thraustochytrium ( Thraustochytrium), Schizochytrium ( Schizochytrium ) and Oukenbergia ( Ulkenia ) or any mixture thereof. Optionally, the eukaryotic microorganism is identical to the microorganism deposited on October 6, 2004 at the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassass VA, 20110-2209, with the accession number PTA-6245 designated by the ATCC. The deposit is exemplary and is only made for the convenience of those skilled in the art, and does not imply recognition that a deposit is required to obtain patent rights. As used throughout, the terms T18 and WT T18 are used interchangeably and refer to the same microorganism, ATCC accession number PTA-6245.

[0059] Provided herein are engineered microorganisms comprising one or more heterologous nucleic acids encoding polypeptides involved in fatty acid metabolism. Heterologous nucleic acids refer to nucleic acid sequences that are not normally present in a given cell in nature. Heterologous nucleic acids may be foreign to their host cells, naturally occurring but present in a non-natural amount in the cell (e.g., more or less than the amount naturally present in the cell), or naturally present in the host cell but outside its natural locus. For example, an engineered microorganism is provided, comprising a first heterologous nucleic acid sequence encoding an elongase and a second heterologous nucleic acid sequence encoding a desaturase, wherein the first and second nucleic acid sequences are operably linked to a promoter. The promoter may be a Δ9 desaturase, a Δ5 desaturase, a subB or an α-tubulin promoter. The promoter may be used in its natural genomic location, or outside its original natural genomic location. Thus, a promoter (e.g., a Δ9 desaturase promoter) may be located at its natural location in the microbial genome. Optionally, a promoter (e.g., a Δ9 desaturase promoter) and a nucleic acid encoding a fatty acid metabolism polypeptide are located on a heterologous construct. (See, e.g., Figure 2 The desaturase may be a Δ9 desaturase, which may be a Thraustochytrium sp. ( Thraustochytrium sp.) or some species of the genus Ukenkiychytrium ( Ulkenia sp.) Δ9 desaturase. The elongase may be, for example, a Δ5 elongase or a C16:0 elongase, which may be Oblongichytrium Optionally, the first and second nucleic acids disrupt an endogenous Δ9 desaturase sequence of the microorganism.

[0060] Optionally, the provided microorganism contains several nucleic acids encoding polypeptides involved in fatty acid metabolism. Thus, the provided microorganism may also contain an Ω3 desaturase, which may be an Ω3 desaturase of the genus Oblongichytrium. The engineered microorganism may contain a heterologous nucleic acid encoding a Δ12 desaturase, which may be a desaturase of the genus Thraustochytrium. The engineered microorganism may contain a Δ6 desaturase, which may be a Δ6 desaturase of the genus Botryochytrium ([ Botryochytrium sp.) Δ6 desaturase. The engineered microorganism may also contain a Δ5 desaturase, which may be a Δ5 desaturase of the genus Thraustochytrium.

[0061] The engineered microorganism can be engineered to include many nucleic acids using constructs that include additional sequences such as promoters, selectable markers or resistance genes, terminators, linker sequences, etc. In some cases, the construct includes a resistance gene for phleomycin, bleomycin, neomycin, hygromycin, or G418. Optionally, the engineered microorganism contains a zeocin resistance gene. Optionally, the engineered microorganism contains one or more 2A sequences. The engineered microorganism may contain a reporter gene. Optionally, the reporter gene is luciferase. As discussed, the engineered microorganism may contain nucleic acids having one or more tubulin promoters, one or more tubulin terminators, or both one or more tubulin promoters and one or more tubulin terminators. Optionally, the nucleic acid contains one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or both one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators.

[0062] The engineered microorganism can be modified to contain nucleic acid sequences or constructs containing different nucleic acids, such as one or more promoters, nucleic acids encoding polypeptides involved in fatty acid synthesis, terminators, linker sequences, etc. For example, the engineered microorganism may contain any combination or sequence of nucleic acids as described herein. Examples of constructs are shown in Figure 2Therefore, the engineered microorganism can contain a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a neomycin resistance gene, and a Δ9 desaturase terminator. The engineered microorganism can contain a Δ9 desaturase promoter, a bleomycin resistance gene, a 2A sequence, a luciferase gene, and a Δ9 desaturase terminator. The engineered microorganism can contain an α-tubulin promoter, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, and an α-tubulin terminator. The engineered microorganism can contain an elongase promoter, a subB promoter, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, and an elongase terminator. The engineered microorganism can contain a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism can contain an α-tubulin promoter, a bleomycin resistance gene, a 2A sequence, a Δ12 desaturase, and an α-tubulin terminator. The engineered microorganism can contain a subB promoter, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a PfaC domain, and an internal subB sequence. The engineered microorganism can contain a subB promoter, a hygromycin resistance gene, a 2A sequence, a nucleic acid encoding an Ω-3 desaturase, and a subB terminator. The engineered microorganism can contain a subB promoter, a nucleic acid encoding an Ω-3 desaturase, a 2A sequence, a neomycin resistance gene, and a subB terminator. The engineered microorganism can contain an α-tubulin promoter, a hygromycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ5 desaturase, and an α-tubulin terminator. The engineered microorganism can contain an α-tubulin promoter, a nucleic acid encoding a Δ5 desaturase, a 2A sequence, a neomycin resistance gene, and an α-tubulin terminator. The engineered microorganism can contain a subB promoter, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a neomycin resistance gene, and a subB terminator. The engineered microorganism can contain a subB promoter, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a nucleic acid encoding an Ω-3 desaturase, a 2A sequence, a neomycin resistance gene, and a subB terminator. The engineered microorganism can contain a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator.The engineered microorganism can comprise a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding an Ω-3 desaturase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism can comprise a Δ9 desaturase promoter, a nucleic acid sequence encoding a Δ6 desaturase, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism can comprise a Δ9 desaturase promoter, a nucleic acid sequence encoding an Ω-3 desaturase, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism can comprise a Δ9 desaturase promoter, a nucleic acid encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid sequence encoding a Δ6 desaturase, a 2A sequence, a nucleic acid sequence encoding a Δ5 elongase, a nucleic acid sequence encoding an Ω-3 desaturase, a 2A sequence, a Δ5 desaturase, a 2A sequence, a nucleic acid sequence encoding an Ω-3 desaturase, a 2A sequence, a nucleic acid sequence encoding a Δ12 desaturase, and a Δ9 desaturase terminator.

[0063] As used herein, the term transformation refers to the process of introducing a heterologous nucleic acid molecule (such as a vector or recombinant nucleic acid molecule) into a recipient cell or microorganism. The heterologous nucleic acid molecule may or may not integrate (i.e., covalently link to) the chromosomal DNA that makes up the genome of the host cell or microorganism. For example, the heterologous polynucleotide can be maintained on an episomal element (such as a plasmid). Alternatively or additionally, the heterologous polynucleotide can integrate into the chromosome such that it is inherited by daughter cells through chromosomal replication. Methods for transformation include, but are not limited to, calcium phosphate precipitation; Ca 2+ treatment; fusion of recipient cells with bacterial protoplasts containing recombinant nucleic acid; treatment of recipient cells with liposomes containing recombinant nucleic acid; DEAE-dextran; fusion using polyethylene glycol (PEG); electroporation; magnetoporation; biolistic delivery; retroviral infection; lipofection; and direct microinjection of DNA into cells.

[0064] As used in reference to a cell, the term transformed refers to a cell that has undergone transformation as described herein such that the cell carries heterologous genetic material (such as recombinant nucleic acid). The term transformed can also or alternatively be used to refer to a microorganism, microbial strain, tissue, organism, etc. that contains heterologous genetic material.

[0065] As used herein, the term introduction, when referring to introducing a nucleic acid into a cell or an organism, is intended to have its broadest meaning and encompasses introduction by, for example, transformation methods such as calcium chloride-mediated transformation, electroporation, particle bombardment, and also by other methods including transduction, conjugation, and mating. Optionally, a nucleic acid is introduced into a cell or an organism using a construct. As used herein, the term transformant refers to a cell, microorganism, microbial strain, tissue, organism, etc. that contains a nucleic acid that has been introduced or transformed into the cell, microorganism, microbial strain, tissue, organism, etc.

[0066] As used herein, nucleic acid refers to deoxyribonucleotides or ribonucleotides and their polymers and complements. The term includes deoxyribonucleotides or ribonucleotides in single-stranded or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and which have binding properties similar to those of a reference nucleic acid and are metabolized in a manner similar to that of the reference nucleotides. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoroamidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide-nucleic acids (PNA). Unless otherwise indicated, conservatively modified variants of a nucleic acid sequence (e.g., degenerate codon substitutions) and complementary sequences can be used to substitute for a specific nucleic acid sequence cited herein. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid can be used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.

[0067] Nucleic acids are operably linked when placed in a functional relationship with another nucleic acid sequence. For example, if DNA encoding a presequence or secretory leader sequence is expressed as a preprotein that participates in polypeptide secretion, then the DNA is operably linked to the DNA encoding the polypeptide; if a promoter or enhancer affects the transcription of a sequence, then the promoter or enhancer is operably linked to the coding sequence; or, if a ribosome binding site is placed to facilitate translation, then the ribosome binding site is operably linked to the coding sequence. Generally, operably linked means that the DNA sequences being linked are close to each other, and in the case of a secretory leader sequence, are contiguous and in reading phase. However, an enhancer need not be contiguous. For example, a nucleic acid sequence operably linked to a second nucleic acid sequence is covalently linked to such second sequence directly or indirectly, although any effective three-dimensional association is acceptable. A single nucleic acid sequence can be operably linked to multiple other sequences. For example, a single promoter can direct the transcription of multiple RNA species. Ligation can be accomplished by ligating at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide linkers or adaptors are used according to conventional practice.

[0068] As used herein, the terms promoter, promoter element, and regulatory sequence refer to polynucleotides that regulate the expression of a selected polynucleotide sequence operably linked to the promoter and affect the expression of the selected polynucleotide sequence in a cell. As used herein, the term Thraustochytrium promoter refers to a promoter that is naturally present in Thraustochytrium cells. In some embodiments, the promoter element is or comprises an untranslated region (UTR) located at the 5' position of the coding sequence. The 5’ UTR forms part of the mRNA transcript and is thus an essential part of protein expression in eukaryotes. After transcription, the 5’UTR can regulate protein expression at the transcriptional and translational levels.

[0069] As used herein, the term terminator refers to a polynucleotide that abrogates the expression of a selected polynucleotide sequence operably linked to the terminator, targets the maturation of a selected polynucleotide sequence operably linked to the terminator (e.g., addition of a polyA tail), or confers mRNA stability to a selected polynucleotide sequence operably linked to the terminator. The terminator sequence can be located downstream of the stop codon in the nucleic acid. The term Thraustochytrium terminator, as used herein, refers to a terminator that is naturally present in Thraustochytrium cells. Also provided herein are nucleic acid constructs that include nucleic acid sequences encoding xylose isomerase, xylulokinase, and xylose transporter, as well as promoters, terminators, selectable markers, 2A peptides, or any combination thereof.

[0070] The term selectable marker, as used herein, refers to a nucleotide sequence (such as a gene) that encodes a product (polypeptide) whose selection is permitted, or to the nucleotide sequence product (such as a polypeptide) itself. The term selectable marker is used herein as is commonly understood in the art and refers to a marker whose presence in a cell or organism confers on the cell or organism a significant growth or survival advantage or disadvantage under certain defined culture conditions (selection conditions). For example, the conditions can be the presence or absence of a specific compound or a specific environmental condition, such as an elevated temperature, increased radiation, the presence of a toxic compound in the absence of the marker, etc. The presence or absence of such one or more compounds or one or more environmental conditions is referred to as one or more selection conditions. Growth advantage means increased viability (e.g., cells or organisms having a growth advantage have an increased average lifespan relative to otherwise identical cells lacking the characteristic or condition conferring the growth advantage), increased proliferation rate (also referred to herein as growth rate), or both, relative to otherwise identical cells or organisms. Generally, a population of cells having a growth advantage will exhibit fewer dead or non-viable cells and / or a higher cell proliferation rate than an otherwise identical population of cells lacking the growth advantage. Although typically, selectable markers will confer a growth advantage on cells, certain selectable markers confer a growth disadvantage on cells, e.g., they render the cells more susceptible to the deleterious effects of certain compounds or environmental conditions than otherwise identical cells that do not express the marker. Antibiotic resistance markers are a non-limiting example of a class of selectable markers that can be used to select cells that express the marker. In the presence of an appropriate concentration of antibiotic (selection condition), such markers confer a growth advantage on the cells that express the marker. Thus, cells that express an antibiotic resistance marker are able to survive and / or proliferate in the presence of the antibiotic, while cells that do not express the antibiotic resistance marker are unable to survive and / or unable to proliferate in the presence of the antibiotic.

[0071] Examples of selectable markers include common bacterial antibiotics such as, but not limited to, ampicillin, kanamycin, and chloramphenicol, as well as selectable compounds known to function in microalgae; examples include rrnS and AadA (aminoglycoside 3'-adenyltransferase), which can be isolated from the Escherichia coli plasmid R538-1 and confer resistance to spectinomycin and streptomycin in Escherichia coli and some microalgae, respectively (Hollingshead and Vapnek, Plasmid 13:17-30, 1985; Meslet-Cladière and Vallon, Eukaryot Cell. 10(12):1670-8 2011). Another example is the 23S RNA protein rrnL, which confers resistance to erythromycin (Newman, Boynton et al., Genetics, 126:875–888 1990; Roffey, Golbeck et al., Proc. Natl Acad. Sci. USA, 88:9122–9126 1991). Another example is Ble, a GC-rich gene isolated from Streptoalloteichus hindustanus ( Streptoalloteichus hindustanus ) that confers resistance to hygromycin (Stevens, Purton et al., Mol. Gen. Genet., 251:23-30 1996). Aph7 is yet another example, which is an aminoglycoside phosphotransferase gene from Streptomyces hygroscopicus ( Streptomyces hygroscopicus ) that confers resistance to hygromycin B (Berthold, Schmitt et al., Protist 153(4):401-412 2002). Additional examples include AphVIII, a type VIII aminoglycoside 3′-phosphotransferase from Streptomyces that confers resistance to paromomycin in Escherichia coli and some microalgae (Sizova, Lapina et al., Gene 181(1-2):13-18 1996; Sizova, Fuhrmann et al., Gene 277(1-2):221-229 2001); Nat & Sat-1, which encodes from Streptomyces noursei (Streptomyces rimosus) and confers resistance to nourseothricin in Escherichia coli and some microalgae ( (Streptomyces noursei)Nourseothricin acetyltransferase from Streptomyces noursei and streptothricin acetyltransferase from Escherichia coli, which confer resistance to nourseothricin (Zaslavskaia, Lippmeier et al., Journal of Phycology 36(2):379-386, 2000); Neo, an aminoglycoside 3'-phosphotransferase, which confers resistance to aminoglycosides; kanamycin, neomycin and the analogue G418 (Hasnain, Manavathu et al., Molecular and Cellular Biology 5(12):3647-3650, 1985); and Cry1, a ribosomal protein S14, which confers resistance to emetine (Nelson, Savereide et al., Molecular and Cellular Biology 14(6):4011-4019, 1994).

[0072] Other selectable markers include nutritional markers, also known as autotrophic markers or auxotrophic markers. These include photoautotrophic markers, which are selected based on the restoration of photosynthetic activity within photosynthetic organisms. Photoautotrophic markers include, but are not limited to, AtpB, TscA, PetB, NifH, psaA, and psaB (Boynton, Gillham et al., Science 240(4858):1534-1538 1988; Goldschmidt-Clermont, Nucleic Acids Research 19(15):4083-4089, 1991; Kindle, Richards et al., PNAS, 88(5):1721-1725, 1991; Redding, MacMillan et al., EMBO J 17(1):50-60, 1998; Cheng, Day et al., Biochemical and Biophysical Research Communications 329(3):966-975, 2005). Alternative or additional nutritional markers include ARG7, which encodes argininosuccinate lyase, a key step in arginine biosynthesis (Debuchy, Purton et al., EMBO J 8(10):2803-2809, 1989); NIT1, which encodes nitrate reductase essential for nitrogen metabolism (Fernández, Schnell et al., PNAS, 86(17):6449-6453, 1989); THI10, which is essential for thiamine biosynthesis (Ferris, Genetics 141(2):543-549, 1995); and NIC1, which catalyzes an important step in nicotinamide biosynthesis (Ferris, Genetics 141(2):543-549, 1995). Such markers are typically enzymes that function in biosynthetic pathways to produce compounds required for cell growth or survival. Typically, under non-selective conditions, the required compounds are present in the environment or are produced by alternative pathways in the cell. Under selective conditions, the function of the biosynthetic pathway in which the marker participates is required to produce the compound.

[0073] As used herein, the phrase selection agent refers to an agent that introduces a selection pressure on a cell or population of cells that favors or disfavors the cell or population of cells carrying a selectable marker. For example, the selection agent is an antibiotic, and the selectable marker is an antibiotic resistance gene. Optionally, geneticin is used as the selection agent.

[0074] In the context of two or more nucleic acid or polypeptide sequences, the term identical or percent identity refers to two or more sequences or subsequences that are identical or have a specified percentage of identical amino acid residues or nucleotides (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or specified region), as measured using the BLAST or BLAST 2.0 sequence comparison algorithms with the default parameters described below or by manual alignment and visual inspection (see, e.g., the NCBI website). Such sequences are said to be substantially identical. This definition also refers to or may apply to the complementary sequences of the test sequences. The definition also includes sequences with deletions and / or additions, as well as those with substitutions. As described below, preferred algorithms can account for gaps, etc. Preferably, the identity exists over a region of at least about 25 amino acids or nucleotides, or more preferably, over a region of 50 - 100 amino acids or nucleotides in length.

[0075] For sequence comparison, typically one sequence acts as a reference sequence to which the test sequence is compared. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, subsequence coordinates are designated (if necessary), and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated as appropriate. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the program parameters.

[0076] As used herein, a comparison window refers to a segment of any one of a selected number of consecutive positions from a group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150, where after two sequences are optimally aligned, the sequences can be compared to a reference sequence having the same number of consecutive positions. Sequence alignment methods for comparison are well known in the art. Optimal sequence alignment for comparison can be conducted by, for example, the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981); the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970); the similarity method search of Pearson & Lipman, Proc. Nat’l. Acad. Sci. USA 85:2444 (1988); computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI); or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 Suppl.)).

[0077] Preferred examples of algorithms suitable for determining percent sequence identity and percent sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. The percent sequence identity of a nucleic acid or protein is determined using BLAST and BLAST 2.0 with the parameters described herein. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information, as is known in the art. The algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of a selected length (W) in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with words of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al.). These initial neighborhood word hits act as seeds for initiating a search to find longer HSPs that contain them. The word hits extend in both directions along each sequence until the cumulative alignment score can no longer increase. For nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatched residues; always <0) are used to calculate the cumulative score. For amino acid sequences, a scoring matrix is used to calculate the cumulative score. The extension of the word hits in each direction stops when: the cumulative alignment score drops from its maximum achieved value by an amount X; the cumulative score becomes zero or less due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The Expect value (E) represents the number of different alignments with scores equal to or better than those expected to occur by chance in a database search. The BLASTN program (for nucleotide sequences) uses a word length (W) of 11, an Expect value (E) of 10, M = 5, N = -4, and comparison of both strands as defaults. For amino acid sequences, the BLASTP program uses a word length of 3, an Expect value (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)), an alignment value (B) of 50, an Expect value (E) of 10, M = 5, N = -4, and comparison of both strands as defaults.

[0078] The present invention also provides a method for promoting the conversion of saturated fatty acids to unsaturated fatty acids. The method includes transforming an oil-producing microorganism with a construct comprising a first nucleic acid encoding an elongase and a second nucleic acid encoding a desaturase, wherein the construct is inserted into a position in the genome of the oil-producing microorganism, in which the expression of the encoded elongase and desaturase is controlled by a native promoter of the oil-producing microorganism; and culturing the transformed microorganism under certain conditions to produce fatty acids, wherein the transformed microorganism converts saturated fatty acids to unsaturated fatty acids more than the control untransformed microorganism. Optionally, the native promoter is a Δ9 desaturase promoter. Optionally, the desaturase is a Δ9 desaturase. The Δ9 desaturase can be a Δ9 desaturase of a species of Thraustochytrium or a species of Aurantiochytrium. The elongase of these methods can be a Δ5 elongase or a C16:0 elongase, which can be a C16:0 elongase of a species of Oblongichytrium. Optionally, the construct further comprises a third nucleic acid encoding a Δ12 desaturase, which can be a Δ12 desaturase of a species of Thraustochytrium. Optionally, the construct further comprises a fourth nucleic acid encoding a Δ6 desaturase, which can be a Δ6 desaturase of a species of Botryochytrium.

[0079] The construct in these methods can further include additional nucleic acids, such as a nucleic acid encoding an Ω-3 desaturase, a nucleic acid encoding a Δ5 desaturase, or both. Optionally, the Ω-3 desaturase is an Ω-3 desaturase of a species of Oblongichytrium. Optionally, the Δ5 desaturase is Thraustochytrium a Δ5 desaturase.

[0080] In the provided method, the first and second nucleic acids can replace the sequence encoding the endogenous Δ9 desaturase in the microorganism.

[0081] As described throughout the text, the construct can include a number of nucleic acids encoding polypeptides incorporated into fatty acid synthesis, which is carried out using a construct comprising additional sequences (such as promoters, selectable markers or resistance genes, terminators, linker sequences, etc.). For example, the construct can include a geneticin resistance gene; one or more 2A sequences; a reporter gene, such as luciferase; one or more tubulin promoters, one or more tubulin terminators, or one or more tubulin promoters and one or more tubulin terminators; one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators; and combinations thereof.

[0082] This method can cause the conversion of saturated fatty acids to unsaturated fatty acids C16:0 and C18:0. The unsaturated fatty acids can be C18:1 (oleic acid), C18:2 (n-6) (linoleic acid), C18:3 (n-3) (α-linolenic acid), C18:3 (n-6) (γ-linolenic acid), or any combination thereof. This method can also produce transformed microorganisms that produce increased amounts of C20:3 (n-6) (di-homo-γ-linolenic acid), C20:4 (n-3) (eicosatetraenoic acid), C20:5 (n-3) (EPA), and C22:5 (n-3) (DPA-3) compared to control untransformed microorganisms.

[0083] Also provided is a microbial oil produced by the engineered microorganisms described herein. The microbial oil can be produced by microorganisms selected from the group consisting of the genera Schizochytrium, Oblongichytrium, Aurantiochytrium, and Thraustochytrium. Accordingly, provided herein are microbial oils and methods for preparing and using the microbial oils. The oil includes fatty acids in the form of monoglycerides, diglycerides, and triglycerides, as well as free fatty acids and phospholipids. Optionally, the microbial oil contains at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) triglycerides. Optionally, the microbial oil contains at least 95% triglycerides.

[0084] The oil also contains at least 85 wt% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) total fatty acids (TFA). Optionally, the oil contains 85 wt% to 99 wt% total fatty acids. Optionally, the microbial oil contains 85 wt% to 95 wt% total fatty acids. Optionally, the microbial oil contains at least 90 wt% total fatty acids.

[0085] Percentages related to the oil or total fatty acids are always expressed as weight percentages. For example, when the microbial oil includes at least 90% total fatty acids, the oil contains at least 90 wt% total fatty acids based on the weight of the oil. In addition, the total fatty acids contain specific fatty acids, and the percentage of a specific fatty acid is always expressed as wt% of the total fatty acids. For example, when the total fatty acids in the oil contain DHA, the amount of DHA is expressed as wt% of the total fatty acids. For example, the total fatty acids contain at least 50 wt% DHA.

[0086] As described, the total fatty acids of the provided oil contain DHA. Optionally, the total fatty acids contain at least 35%, at least 40%, or at least 45% DHA. Optionally, the total fatty acids contain at least 50% DHA. Optionally, the total fatty acids contain at least 60% DHA. Optionally, the total fatty acids contain 50% to 70% DHA. Optionally, the total fatty acids contain 60% to 70% DHA.

[0087] The present invention provides an oil comprising C20:3(n-6) (dihomo-γ-linolenic acid) and C20:5(n-3) eicosapentaenoic acid (EPA). Accordingly, there is provided a microbial oil comprising fatty acids, wherein the fatty acids comprise C20:3(n-6) (dihomo-γ-linolenic acid) and C20:5(n-3) eicosapentaenoic acid (EPA). The fatty acids may comprise from 0.01% to 16% of C20:3(n-6) (dihomo-γ-linolenic acid) (DLGA) or any percentage or range within 0.01% to 16% of DLGA. The fatty acids may comprise 1-17% EPA or 5-17% EPA or any percentage or range within 1 to 17%.

[0088] The fatty acids in the oil may further comprise C14:0 (myristic acid) or C16:0 (palmitic acid). Optionally, the fatty acids comprise 5-10% C14:0 (myristic acid) or any percentage or range within 5-10%. Optionally, the fatty acids comprise 13-22% of C16:0 (palmitic acid) or any percentage or range within 13-22%.

[0089] The fatty acids in the oil may comprise C18 unsaturated fatty acids. Optionally, the fatty acids comprise 10-60% of C18 unsaturated fatty acids. The fatty acids may comprise 10-45% C18:1 oleic acid. Optionally, the C18 unsaturated fatty acids comprise C18:2(n-6) linoleic acid. For example, the fatty acids may comprise from 0.01% to 40% linoleic acid, or any percentage or range within 0.01% to 40%.

[0090] Optionally, the fatty acids in the oil further comprise C18:3(n-3) (α-linolenic acid), C18:3(n-6) (γ-linolenic acid), C20:4(n-3) (eicosatetraenoic acid), C20:5(n-3) (EPA) and C22:5(n-3) (docosapentaenoic acid (n-3) (DPA-3).

[0091] Optionally, the total fatty acids in the oil comprise less than 45%, 40%, 35%, 30%, or 25% saturated fatty acids (SFA). Saturated fatty acids in the oil produced by the methods described herein include, but are not limited to, C12:0 (lauric acid), C14:0 (myristic acid), C15:0 (pentadecanoic acid), C16:0 (palmitic acid), C17:0 (margaric acid), and C18:0 (stearic acid). Optionally, the total fatty acids comprise from 0.001% to 45% saturated fatty acids. Optionally, the total fatty acids in the oil comprise from 10% and 45% saturated fatty acids (such as 10% and 40%, 10% and 30%, 10% and 20%, 15% and 30%, 15% and 20%, 20% and 30%, or 20% and 25% saturated fatty acids). Thus, the microbial oil can comprise less than 35% saturated fatty acids. The microbial oil can comprise less than 30% saturated fatty acids. Optionally, the microbial oil comprises from 0.001% to 35% saturated fatty acids.

[0092] Also provided are methods for producing polyunsaturated fatty acids, which comprise providing an engineered microorganism as described herein and culturing the engineered microorganism under conditions sufficient to produce polyunsaturated fatty acids.

[0093] The culture medium used in the methods as described supplies the microorganism with various nutrient components, including a carbon source and a nitrogen source. The culture medium for culturing can comprise any one of a variety of carbon sources. Examples of carbon sources include fatty acids, lipids, glycerol, triglycerides, hydrocarbons, polyols, amino sugars, and any kind of biomass or waste stream. Fatty acids include, for example, oleic acid. Hydrocarbons include, but are not limited to, glucose, cellulose, hemicellulose, fructose, dextrose, xylose, lactulose, galactose, maltotriose, maltose, lactose, glycogen, gelatin, starch (corn or wheat), acetate, meso-inositol (such as, derived from corn steep liquor), galacturonic acid (such as, derived from pectin), L-fucose (such as, derived from galactose), gentiobiose, glucosamine, α-D-glucose-1-phosphate (such as, derived from glucose), cellobiose, dextrin, α-cyclodextrin (such as, derived from starch), and sucrose (such as, from molasses). Polyols include, but are not limited to, maltitol, erythritol, and adonitol. Amino sugars include, but are not limited to, N-acetyl-D-galactosamine, N-acetyl-D-glucosamine, and N-acetyl-β-D-mannosamine. The carbon source can be present in the heterotrophic medium at a concentration of 200 g / L, 175 g / L, 150 g / L, 100 g / L, 60 g / L, or lower, such as at a concentration of 1 to 200 g / L, 5 to 200 g / L, 10 to 200 g / L, 50 to 200 g / L, or 100 to 200 g / L.

[0094] Microorganisms can be cultured in a medium having a chloride concentration of from about 0.5 g / L to about 50.0 g / L (e.g., a chloride concentration of from about 0.5 g / L to about 35 g / L, from about 18 g / L to about 35 g / L, or from about 2 g / L to about 35 g / L). The microorganisms described herein can grow under low-chloride conditions, such as from about 0.5 g / L to about 20 g / L, or from about 0.5 g / L to about 15 g / L.

[0095] The culture medium optionally contains NaCl. The medium can contain a sodium salt without chloride ions as a sodium source. Examples of non-sodium chloride salts suitable for use in accordance with the present method include, but are not limited to, soda ash (a mixture of sodium carbonate and sodium oxide), sodium carbonate, sodium bicarbonate, sodium sulfate, and mixtures thereof. See, e.g., U.S. Patent Nos. 5,340,742 and 6,607,900, the entire contents of each of which are incorporated herein by reference. Optionally, when 20 g / L of carbon, 20 g / L of soy peptone, and 5 g / L of yeast extract are used, the medium contains 9 g / L of chloride. When the medium contains 10 g / L of carbon, 5 g / L of soy peptone, 5 g / L of yeast extract, and 10 g / L of agar, the medium can contain 35 g / L of chloride. When the medium contains 20 - 40 g / L of carbon, 1 g / L of yeast extract, 1 - 20 g / L of monosodium glutamate (MSG), 0.3 - 2.0 g / L of phosphate, 4 g / L of magnesium sulfate, 5 - 10 g / L of ammonium sulfate, 1.5 mL / L of a trace element solution, 1 mL / L of a vitamin B solution, and 0.1 g / L of CaCl2, the medium can contain 2 g / L of chloride.

[0096] The medium for culturing microorganisms can contain any of a variety of nitrogen sources. Exemplary nitrogen sources include ammonium solutions (e.g., NH4 in H2O), ammonium salts or amine salts (e.g., (NH4)2SO4, (NH4)3PO4, NH4NO3, NH4OOCH2CH3 (NH4Ac)), peptone, soy peptone, tryptone, yeast extract, malt extract, fish meal, sodium glutamate, soy extract, casein amino acids, and distillers' grains. The nitrogen source concentration range in a suitable medium is typically between and including: about 1 g / L to about 25 g / L (e.g., about 5 to 20 g / L, about 10 to 15 g / L, or about 20 g / L). Optionally, when yeast extract is the complex nitrogen source in the medium, the nitrogen concentration is about 10 to 15 g / L. Optionally, when soy peptone is present in the medium together with L-monosodium glutamate hydrate (MSG) or ammonium sulfate, the nitrogen concentration is about 1 to 5 g / L.

[0097] The medium optionally contains phosphates, such as potassium phosphate or sodium phosphate (e.g., potassium dihydrogen phosphate).

[0098] The inorganic salts and trace nutrients in the culture medium can include ammonium sulfate, sodium bicarbonate, sodium orthovanadate, potassium chromate, sodium molybdate, selenious acid, nickel sulfate, copper sulfate, zinc sulfate, cobalt chloride, iron chloride, manganese chloride, calcium chloride and EDTA. Optionally, the culture medium contains at least 1.5 ml / L of a trace element solution. Optionally, the trace element solution contains 2 mg / mL of copper(II) pentahydrate sulfate, 2 mg / mL of zinc sulfate heptahydrate, 1 mg / mL of cobalt(II) hexahydrate chloride, 1 mg / mL of manganese(II) tetrahydrate chloride, 1 mg / mL of sodium molybdate dihydrate and 1 mg / mL of nickel(II) sulfate.

[0099] The culture medium can contain magnesium sulfate, optionally with a trace element solution and / or potassium dihydrogen phosphate.

[0100] The culture medium can contain vitamins such as pyridoxine hydrochloride, thiamine hydrochloride, calcium pantothenate, p-aminobenzoic acid, riboflavin, niacin, biotin, folic acid and vitamin B12.

[0101] The pH of the culture medium can be adjusted to 3.0 to 10.0, including 3.0 and 10.0, using an acid or a base (when appropriate) and / or using a nitrogen source. Optionally, the culture medium is sterilized.

[0102] Generally, the culture medium for culturing microorganisms is a liquid medium. However, the culture medium for culturing microorganisms can be a solid medium. In addition to the carbon and nitrogen sources discussed herein, the solid medium can also contain one or more components (such as agar and / or agarose) that provide structural support and / or allow the medium to be in solid form.

[0103] The cultivation of microorganisms can be carried out under known conditions, such as those described in International Patent Publications No. WO 2007 / 069078 and No. WO 2008 / 129358. For example, the cultivation can be carried out for 1 to 30 days (such as, 1 to 21 days, 1 to 15 days, 1 to 12 days, 1 to 9 days or 3 to 5 days). The cultivation can be carried out at a temperature of 4 to 30 °C. Optionally, the cultivation is carried out by aerated shaking culture, shaking culture, static culture, batch culture, fed-batch culture, continuous culture, rolling batch culture, wave culture, etc. Optionally, the cultivation is carried out when the dissolved oxygen content in the culture medium is 1 to 20%, 1 to 10% or 1 to 5%.

[0104] The biomass as described herein can be incorporated into the final product (such as, food or feed supplement, biofuel, etc.). Therefore, a method of using protein-rich biomass is provided. The method optionally includes incorporating the protein-rich biomass into food (such as, pet food, livestock feed or aquaculture feed).

[0105] Oils or lipids can be isolated from the microbial culture and used in a variety of food and feed supplements. Suitable food or feed supplements into which the oil can be incorporated include beverages such as milk, water, sports drinks, energy drinks, tea, and fruit juices; confections such as candies, jellies, and cookies; fatty foods and beverages such as dairy products; processed foods such as soft rice (or porridge); infant formula; breakfast cereals; and the like. Optionally, one or more of the produced lipids can be incorporated into dietary supplements such as, for example, vitamins or multivitamins. Optionally, the oil produced according to the methods described herein can be included in dietary supplements and optionally can be directly incorporated into the components of food or feed (e.g., food supplements).

[0106] Examples of feed materials into which the oil or lipid produced by the methods described herein can be incorporated include pet foods such as cat food; dog food; feeds for ornamental fish, farmed fish, or crustaceans, etc.; or feeds for farm-raised animals (including livestock and fish or crustaceans raised in aquaculture). The food or feed material into which the oil or lipid produced according to the methods described herein is incorporated is preferably palatable to the organism that is the intended recipient. The food or feed material can have any physical properties currently known for food materials (e.g., solid, liquid, soft).

[0107] Optionally, one or more of the produced compounds (e.g., PUFA) can be incorporated into nutritional or pharmaceutical products. Examples of such nutritional or pharmaceutical forms include various types of tablets, capsules, drinkable formulations, etc. Optionally, the nutritional or pharmaceutical product is suitable for topical application (e.g., in the form of a lotion). The dosage form can include, for example, capsules, oils, tablets, etc.

[0108] The oil or lipid produced according to the methods described herein can be incorporated into a product in combination with any of a variety of other agents. For example, such compounds can be combined with one or more binders or fillers, chelating agents, pigments, salts, surfactants, humectants, viscosity improvers, thickeners, emollients, fragrances, preservatives, etc. or any combination thereof.

[0109] As described herein, a control or standard control refers to a sample, measurement, or value that is used as a reference (usually a known reference) for comparison with a test sample, measurement, or value. For example, a test microorganism (e.g., a microorganism transformed with a nucleic acid sequence encoding a xylose-metabolizing gene) can be compared to a known normal (wild-type) microorganism (e.g., a standard control microorganism). A standard control can also represent an average measurement or value collected from a population of microorganisms (e.g., a standard control microorganism) that do not grow or grow poorly in the presence of xylose as the sole carbon source, or that do not have or have a minimal level of xylose isomerase activity, xylulokinase activity, and / or xylose transport activity. Those skilled in the art will recognize that standard controls can be designed to evaluate any number of parameters (e.g., RNA levels, polypeptide levels, specific cell types, etc.).

[0110] Materials, compositions, and components are disclosed that can be used in the disclosed methods and compositions, can be used in combination with the disclosed methods and compositions, can be used to prepare the disclosed methods and compositions, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it should be understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed, each individual and collective combination and permutation of these compounds is specifically contemplated and described herein, even though specific references to these various combinations and permutations may not be explicitly disclosed. For example, if a method is disclosed and discussed, and various modifications that can be made to a variety of molecules including that method are discussed, each and every combination and permutation of that method and possible modifications are specifically contemplated, unless otherwise explicitly indicated to the contrary. Similarly, any subset or combination of these is specifically contemplated and disclosed. This concept applies to all aspects of the present disclosure, including but not limited to the steps in methods of using the disclosed compositions. Thus, if there are multiple additional steps that can be performed, it should be understood that each of these additional steps can be performed with any specific method step or combination of method steps in the disclosed method, and each such combination or subset of combinations is specifically contemplated and should be considered disclosed.

[0111] Publications cited herein, and the materials by which they are cited, are hereby expressly incorporated by reference in their entirety.

[0112] The following examples are intended to further illustrate certain aspects of the methods and compositions described herein and are not intended to limit the scope of the claims.

[0113] Examples

[0114] Example 1. Engineered Microorganisms Containing an Elongase and a Desaturase.

[0115] The C16:0 elongase from Oblongichytrium (Obl) and the Δ9 desaturase from Ulkenia (Ulk) were codon-optimized for ONC-T18 (ATCC accession number PTA-6245, also referred to as T18 throughout the text) and placed under the control of the native Δ9 desaturase promoter by cloning the genes upstream of neomycin resistance (neo-R), resulting in plasmid pHR37 (see Figure 2 ). A 2A and GSG linker was included between each gene to efficiently cleave the expressed proteins. Biolistic transformation of T18 generated G418-resistant transformants, referred to herein as the 95 series.

[0116] As shown in Figure 3 and Figure 4 , homologous recombination at the Δ9 desaturase locus was confirmed by Southern blotting using a probe against the Δ9 desaturase promoter and the region upstream of neomycin. Fatty acid profiles of the 95 series transformants and T18 WT were determined by growing the strains in 25 mL of WDL culture for 7 days until glucose depletion (residual glucose < 1 g / L). The harvested biomass was freeze-dried and subjected to FAME analysis to obtain the oil profiles, as Figure 5 and Figure 6 shown. T18 WT produced 7.23 mg of C18:0 / g of dry biomass (mg / g) and 1.82 mg of C18:1 oleic acid / g of dry biomass (mg / g) ( Figure 5 ). The 95 series transformants produced up to 115.15 mg of C18:0 / g of dry biomass (transformant 95-29) and 95.80 mg of C18:1 oleic acid / g of dry biomass (transformant 95-3). These C18:0 / dry biomass and C18:1 / dry biomass ratios represent increases of 1493% and 5164%, respectively, compared to those present in the wild-type (WT) T18. One 95 series transformant, 95-1, was grown in 25 milliliters (mL) of WDL and 25 mL of 10% N WDL to compare the oil profiles under normal growth and nitrogen stress, respectively. The cultures were grown at 25 °C for 8 days until glucose depletion (residual glucose < 1 g / L). The harvested biomass was freeze-dried and subjected to FAME analysis to obtain the oil profiles, as Figure 7 shown. C18:1 oleic acid increased from 66.05 mg / g of dry biomass to 244.60 mg / g of dry biomass under low nitrogen, representing a 270.3% increase in oleic acid content under low nitrogen conditions. The total fatty acids (TFA) in low nitrogen also increased from 434.46 mg / g of dry biomass to 695.49 mg / g of dry biomass, representing an increase of 60.1%.

[0117] Transformant 95-1 was also grown in a 5-liter (L) fermenter under standard conditions. Briefly, a 500 mL Windust Light (containing 5 g / L yeast extract) seed culture of transformant 95-1 was grown at 25 °C for 72 hours. Three hundred (300) mL of the culture was used to inoculate into 2.7 L of Windust medium in the fermenter (300 g glucose, 6 g yeast extract, 9.24 g MgSO4·7H2O, 4.95 g NaCl, 11.7 mg FeCl3·6H2O, 24.57 mg citric acid, 7.2 mg CuSO4·5H2O, 7.2 mg ZnSO4·7H2O, 3.6 mg Na2MoO4·2H2O, 3.6 mg CoCl2·6H2O, 3.6 mg MnCl2·4H2O, 3.6 mg NiSO4·6H2O, 46.26 g (NH4)2SO4, 5.1 g KH2PO4, 5.55 g K2HPO4, 0.3 g CaCl2·2H2O, 0.09 mg vitamin B12, 0.09 mg biotin, 18 mg thiamine hydrochloride, and 5 drops of Biospumex 153K). A 750 w / v glucose solution was fed regularly to maintain the glucose concentration in the vessel at 40 - 90 g / L. The glucose concentration was measured by a YSI analyzer (YSI Incorporated, Yellow Springs, Ohio). The consumption rate was maintained at 2.5 g glucose / L-h or less by adjusting the agitation. Fermentation was considered complete when 1650 g of total glucose had been consumed. Fermentation was carried out at 20 °C, and the pH was maintained at 5.75 by adding 5 M NaOH. The vessel was agitated at 450 - 650 rpm at 20 °C. Fermentation lasted for 264 hours. Samples were taken throughout the fermentation process to compare the oil profiles at different time points, as Figure 8 shown.

[0118] Example 2. Engineered microorganisms containing a desaturase promoter.

[0119] As Figure 2 shown, the reporter gene Gaussia luciferase (Gluc) was cloned into the 3’ of the hygromycin resistance gene (ble R ) separated by the 2A sequence under the control of the native Δ9 desaturase promoter of the expression construct in plasmid pJB12. T18 was biolistically transformed with pJB12 to generate hygromycin-resistant transformants referred to herein as the luciferase series. DNA blot analysis using a probe against the Δ9 desaturase confirmed a homozygous homologous recombination at the Δ9 locus in one transformant, as Figure 9As shown, the luciferase transformants were grown in 50 mL of WDL for 5 days. The biomass harvested from these cultures was freeze-dried and subjected to FAME analysis. Figure 10 The FAME data in Figure 10 showed that homozygous knockout of the native Δ9 desaturase in T18 led to the absence of C16:1 n-7, C18:1 n-9, and C18:1 n-7, which is consistent with the suspected function of this gene.

[0120] Example 3. Engineered microorganisms containing desaturase.

[0121] The native T18 Δ9 desaturase was cloned into an expression construct under the control of the native T18 α-tubulin promoter, generating plasmid pJB76, as Figure 2 shown. T18 was biolistically transformed to generate G418-resistant transformants, referred to herein as the 57 series. PCR was used to confirm that the construct containing G418 was integrated in the transformant strains. The 57 series transformants were grown in 56 mL of WDL for 5 - 7 days until glucose was depleted to <4 g / L. The harvested biomass was freeze-dried and subjected to FAME analysis, and the resulting FAME data are as Figure 11 shown. The FAME data showed that C16:1 n-7 and C18:1 n-7 in all transformants were increased compared to WT, as Figure 12 shown. The most significant increase was in transformant 57-6: transformant 57-6 had 11.57 mg C16:1 n-7 / g biomass and 11.40 mg C18:1 n-7 / g biomass, compared to 2.15 mg / g and 0.89 mg / g in WT, representing increases of 438% and 1180% respectively compared to WT.

[0122] Example 4. Engineered microorganisms containing desaturase under the control of a native promoter.

[0123] The native T18 Δ9 desaturase was cloned into an expression construct under the control of the PUFA synthase subunit B promoter (subB) native to T18, and the native fatty acid elongase was knocked out by homologous arms, resulting in plasmid pJB87, as Figure 2 shown. Polymerase chain reaction (PCR) analysis was used to confirm that the construct containing G418 was integrated in the transformant strains. The 84 series transformants were grown in 50 mL of WDL for 5 - 6 days. The harvested biomass was freeze-dried and subjected to FAME analysis, as Figure 13 shown. The FAME data showed that both C16:1 n-7 and C18:1 n-7 in most transformants were increased compared to T18 WT, as Figure 14As shown. The most significant increase in Ω-7 was in transformant 84-7, which had 10.9 mg C16:1 n-7 / g biomass and 4.58 mg C18:1 n-7 / g biomass, compared to 2.58 mg / g and 1.94 mg / g in the WT, representing increases of 322% and 136% respectively compared to the WT.

[0124] Example 5. Engineered microorganisms containing a Δ12 desaturase.

[0125] The Δ12 desaturase from Thraustochytrium (Thr) was codon-optimized for T18. This gene was cloned downstream of the native T18 Δ9 desaturase promoter and separated by a 2A sequence from the C16:0 elongase (Obl), Δ9 desaturase (Ulk), and the geneticin resistance gene (ble R ), generating plasmid pHR51, as Figure 2 shown. T18 was biolistically transformed with pHR51, generating geneticin-resistant transformants, designated the 116 series. Southern blot analysis using a probe for the region upstream of the Δ9 desaturase promoter confirmed whether the homologous recombination at the Δ9 desaturase locus in the transformants was homozygous or heterozygous, as shown in Figure 3. Eleven out of twelve transformants were double knockouts, and the 116-2 transformant was heterozygous for homologous recombination at the Δ9 locus. As Figure 15 shown, the fatty acid profiles of the 116 series transformants and T18B WT grown in 10% N WDL and harvested at glucose depletion were determined by FAME analysis. T18 WT did not contain C18:2 linoleic acid, while the 116 series transformants produced up to 67.1 mg / g of dried biomass, representing 9.7% of the total fatty acid weight. The weight percentage was determined by the ratio of mg / g of a specific fatty acid to mg / g of total fatty acids.

[0126] Example 6. Engineered microorganisms containing a Δ12 desaturase under the control of a tubulin promoter.

[0127] As Figure 2 shown, the Δ12 desaturase (Thr) was cloned under the control of the native α-tubulin promoter of T18, resulting in plasmid pHR47. T18 transformant 95-1 was transformed with pHR47 ( Figure 5The oleic acid producer shown) was subjected to biolistic transformation to generate kirromycin-resistant transformants, referred to herein as the 110 series transformants. Southern blot indicated possible α-tubulin knockout: transformants 110-1, 3, 4, 9, and 10, as shown in Figure 16. The 110 series transformants were grown in 25 mL of 10% N WDL for 6 days until glucose was depleted to <10 g / L remaining. The harvested biomass was freeze-dried and subjected to FAME analysis to obtain the oil profile, as Figure 17 shown. T18 Wt did not contain 18:2 linoleic acid, the parental 95-1 contained 0.51 mg of linoleic acid / g of dry biomass, while the 110-3 transformant produced 31.91 mg of linoleic acid / g of dry biomass, accounting for 4.8% of the total fatty acid weight percentage and a 6257% increase compared to the 95-1 parental.

[0128] Example 7. Engineered microorganisms containing PUFA synthase subunits.

[0129] Two protein domains from Shewanella PfaC (PUFA synthase subunit) were codon-optimized for T18 and cloned under the control of the subB promoter in plasmid pHR26. As Figure 2 described, T18 was subjected to biolistic transformation with plasmid pHR26. Since the use of homologous arms from the native T18 PUFA synthase subunit B might lead to homologous recombination at subB and knockout of subB, the transformants were recovered on medium supplemented with 0.5 millimolar (mM) DHA. One kirromycin-resistant transformant was obtained, referred to herein as the 67-1 transformant. The 67-1 transformant might not grow when streaked onto plates lacking PUFA supplementation, indicating that this transformant 67-1 was auxotrophic. WT T18 and the transformant 67-1 were grown in 50 mL WDL cultures, which were supplemented with 0.5 mM of different free fatty acid PUFAs in each culture: DHA, EPA, ARA, ALA, and GLA. The cultures were grown for 14 days, at which time the T18 culture had completely depleted glucose (<1 g / L remaining), while the 67-1 cultures had 20.6 g / L glucose (DHA culture), 28.1 g / L glucose (EPA culture), 37.9 g / L glucose (ARA culture), 54.9 g / L glucose (ALA culture), and 54.6 g / L glucose (GLA culture) remaining. The harvested biomass was freeze-dried and subjected to FAME analysis to obtain the oil profile, as Figure 18As shown. For these cultures grown in the presence of different free fatty acid PUFAs, the average 18:1 n-7 content in WT T18 was 0.346 mg / g of dry biomass. The average 18:1 n-7 content in the 67-1 transformants of these cultures grown in the presence of different free fatty acid PUFAs was 33.54 mg / g of dry biomass, representing a 9694% increase compared to WT T18. Transformation of some cultures fed with PUFAs indicated the presence of limited fatty acid elongase and desaturase in WT T18. Notably, the 67-1 cultures fed with ALA accumulated EPA (3.88 mg / g or 8.8% of the total fatty acid weight), and the 67-1 cultures fed with GLA accumulated ARA (3.63 mg / g or 8.5% of the total fatty acid weight).

[0130] Example 8. Engineered microorganisms containing ω-3 desaturase.

[0131] The ω-3 desaturase from Oblongata (Obl) was codon-optimized for T18 and cloned into an expression construct under the control of the PUFA synthase subunit B promoter (subB) native to T18 in plasmid pHR52, as Figure 2 shown. The T18 transformant 110-3 ( Figure 17 the linoleic acid producer shown) was biolistically transformed with pHR52 to obtain hygromycin-resistant transformants, herein referred to as the 113 series transformants. Knocking out the subunit B of the PUFA synthase rendered the PUFA synthase non-functional and produced auxotrophs that required PUFA supplementation (as described for transformant 67-1). For this reason, the transformants were restored on a medium supplemented with 0.5 mM DHA. One auxotrophic transformant was recovered, herein referred to as the 113-4 transformant. It was confirmed by Southern blotting that 113-4 was a homozygous knockout at the subunit B of the PUFA synthase, as shown in Figure 19. The 113 series transformants were grown in 25 mL of 10% N WDL in flasks (the culture for 113-4 also contained 0.5 mM DHA) for 7 days until the glucose was depleted to < 1 g / L. The transformants 113-4 and 113-14 still had a considerable amount of glucose on day 7 and were allowed to grow for two more days, at which time the 113-4 culture had 14.2 g / L of glucose and the 113-14 culture had 11.8 g / L of glucose. The biomass of all cultures was harvested, freeze-dried, and subjected to FAME analysis to obtain the oil profile, as Figure 20 shown.

[0132] Example 9. Engineered microorganisms containing ω-3 desaturase under the control of an initial promoter.

[0133] The Ω-3 desaturase (Obl) under the control of the native subB promoter of T18 was cloned 5' of the neomycin resistance marker in pHR58, as Figure 2 shown, and transformed into strain 116-5 by biolistic transformation. A G418-resistant transformant was recovered on medium supplemented with 0.5 mM DHA, and this transformant is referred to herein as 121-1. It was confirmed by Southern blotting that 121-1 was a homozygous knockout at the subunit B of the PUFA synthase, as shown in Figure 21. The transformant 121-1 was grown in 25 mL of 0.5 mM DHA 10% N WDL, and also in 25 mL of WDL cultures containing 0.5 mM GLA or 0.5 mM ALA. The DHA-supplemented culture was depleted of glucose within 7 days. The cultures supplemented with GLA and ALA were grown for 8 days until the 121-1 transformant in GLA had 16.4 g / L of glucose remaining and the 121-1 transformant in ALA had 21.6 g / L of glucose remaining. The biomass of all cultures was harvested, freeze-dried and subjected to FAME analysis to obtain the oil profiles, as Figure 22 and 23 shown.

[0134] An unexpected aspect of the present invention is that it has been found that expressing a gene in tandem with other genes at the native Δ9 desaturase locus results in more efficient substrate conversion than if the gene were expressed at a discrete locus. Transformation series 110 expressed the Δ12 desaturase (Thr) in the parent, and both the C16:0 elongase (Obl) and the D9 desaturase (Ulk) were expressed at the native T18 Δ9 desaturase locus. The transformant 110-3 produced 31.91 mg of 18:2-6 / g biomass. When the PUFA synthase subB in strain 110-3 was knocked out, the resulting strain produced up to 81.78 mg of 18:2-6 / g biomass. Transformation series 116 expressed the Δ12 desaturase (Thr) together on the same open reading frame as the C16 elongase and the Δ9 desaturase at the native T18Δ9 desaturase locus. The transformant 116-5 produced 67.11 mg of 18:2-6 / g biomass. When the PUFA synthase subB in strain 116-5 was knocked out, the resulting strain produced up to 269.92 mg of 18:2-6 / g biomass. This represents a 330% increase in 18:2-6, which is the product of the Δ12 desaturase. These results are shown in Figure 24 .

[0135] Example 10. Engineered microorganisms containing a Δ6 desaturase.

[0136] The Δ6 desaturase from Botryococcus sp. (Bty) was codon-optimized for T18 and cloned into an expression construct under the control of the subB promoter in pHR64, as Figure 2 shown. Transformant 116-5, which produces linoleic acid (LA, C18:2 n-6), was biolistically transformed with pHR64. Disruption of subunit B of the PUFA synthase generally produces auxotrophic strains, so the transformants were restored on medium supplemented with 0.5 mM DHA. Four G418-resistant transformants were restored. By Southern blotting, it was confirmed that 127-3 was a homozygous knockout at subunit B of the PUFA synthase, as Figure 24 shown. The transformants of the 127 series were grown in 25 mL of 10% N WDL (0.5 mM DHA was added to the 127-3 culture) for 6-7 days until glucose was depleted (remaining glucose < 1 g / L). The biomass of all cultures was harvested, freeze-dried and subjected to FAME analysis to obtain the oil profile, as Figure 26 shown.

[0137] Example 11. Engineered microorganisms containing a Δ6 desaturase and an Ω-3 desaturase.

[0138] The Δ6 desaturase (Bty) and the Ω-3 desaturase from Pavlova pinguis (Pav) were codon-optimized for T18 and cloned into an expression vector under the control of the subB promoter in pHR62, as Figure 2 shown. Strain 116-5, which produces linoleic acid (LA), was biolistically transformed with pHR62. The transformants were restored on medium supplemented with 0.5 mM DHA. Three G418-resistant transformants were restored. By Southern blotting, it was confirmed that 129-1 and 129-2 were homozygous knockouts at subunit B of the PUFA synthase, as shown in Figure 25. The transformants of the 129 series were grown in 25 mL of 10% N WDL (0.5 mM DHA was added to the 129-1 and 129-2 cultures) for 6-7 days until glucose was depleted (remaining glucose < 1 g / L). The biomass of all cultures was harvested, freeze-dried and subjected to FAME analysis to obtain the oil profile, as Figure 27 shown.

[0139] Example 12. Engineered microorganisms containing a SubB knockout.

[0140] The PUFA auxotrophic strain generated by knocking out subB in transformant 116-5 was restored to PUFA prototrophy. The reversal of auxotrophy was achieved by passaging cells from various modified strains in decreasing concentrations of DHA, starting from 0.5 mM DHA, passaging into 0.25 mM DHA, then 0.05 mM DHA, and finally into WDL medium without PUFA supplementation.

[0141] After passaging, axenic strains that could grow without PUFA supplementation were isolated. Transformant 121-1 expressing the Ω-3 desaturase (Obl) from the subB locus was inoculated into 10 mL of WDL + 0.5 mM DHA and grown for 7 days. A 100-µL sample of the 0.5 mM DHA culture was used to inoculate a 10-mL WDL + 0.25 mM DHA culture and grown for 7 days. A 100-µL sample of the 0.25 mM DHA culture was used to inoculate a 10-mL WDL + 0.05 mM DHA culture and grown for 7 days. A 100-µL sample of the 0.05 mM DHA culture was plated on a Windust plate and grown for 6 days. Some of the colonies that grew after 6 days were re-streaked onto a second Windust plate and grown for an additional 12 days. The mixed population was re-streaked onto a third Windust plate and grown for three more days. Two 10-mL WDL cultures were inoculated with single colonies from the third WD plate and grown for an additional 4 days or 7 days, referred to herein as 121-1-S and 121-1-F, respectively. A 100-µL sample of the 4-day or 7-day 121-1-S and 121-1-F cultures was used to inoculate 10-mL WDL cultures, which were then grown for 3 days. These 3-day WDL cultures inoculated with 121-1-S and 121-1-F, respectively, were used to prepare frozen stocks, and 100-µL samples of each stock were used to inoculate 25-mL WDL and 10% N WDL FAME cultures of both 121-1-S and 121-1-F. These WDL FAME cultures were grown for 8 days until 121-1-S had 2.57 g / L glucose and 121-1-F was grown for 11 days until 121-1-S had 12.9 g / L glucose and 121-1-F had 12.9 g / L glucose.

[0142] The biomass of the cultures was harvested, freeze-dried, and subjected to FAME analysis to obtain the oil profile, as Figure 28As shown. The transformants 127-3 and 129-2 expressing both Δ6 desaturase (Bty) (127-3) and Ω3 desaturase (Pav) (129-2) from the subB locus were initially also auxotrophic and reverted to prototrophic. A 10 milliliter (10 mL) WDL + 0.5 mM DHA sample was inoculated with 127-3 or 129-2 from the plate and allowed to grow for 3 days. A 10 mL WDL + 0.25 mM DHA culture was inoculated with 50 μL of the 0.5 mM DHA culture sample. After 3 days, the 0.25 mM DHA culture was transferred from 25 °C to 20 °C. After the 0.25 mM DHA culture had grown for a total of 6 days, a 10 mL WDL + 0.05 mM DHA culture was inoculated with 100 μL of the DHA culture sample and those cultures were allowed to grow for 7 days.

[0143] A second culture (10 mL WDL + 0.05 mM DHA) was inoculated with 100 μL of the 0.05 mM DHA culture sample of transformant 129-2 (the first culture) and allowed to grow for 7 days. A third 10 mL WDL culture was inoculated with 100 μL of the second transformant 129-2 0.05 mM DHA culture sample. The third 10 mL WDL (unsupplemented) 129-2 culture was allowed to grow for 6 days, at which time a fourth 10 mL WDL culture was inoculated with 100 μL of the sample. The fourth 129-2 WDL culture was allowed to grow for 8 days.

[0144] A 10 mL WDL (unsupplemented) was inoculated with 100 μL of the 0.05 mM DHA culture sample of transformant 127-3 that had grown for 7 days and allowed to grow for 13 days. A second 10 mL WDL culture was inoculated with 100 μL of the 127-3 WDL culture sample and allowed to grow for 8 days.

[0145] After growing the 129-2 WDL(2P) and 127-3 WDL(2P) cultures at 25 °C for 8 days, 100 µL samples of each culture were used to inoculate 10 mL of WDL(3P) for 129-2 and 127-3. The 129-2 WDL(3P) and 127-3 WDL(3P) cultures were grown for 3 days and then made into their respective frozen stocks. The mixed populations of prototrophic 129-2 and 127-3 were recovered from the glycerol stocks on Windust plates and streaked on separate Windust plates to obtain single colonies. The colonies of 127-3 grew for 6 days, and four colonies were picked from them and named 127-3-T, W, R+P. The colonies of 129-2 grew for 10 days, and then four of these colonies were picked and named 129-2-T, W, R+P. 100 µL of a 3-day-old 10 mL WDL sterile strain sample was used to prepare the frozen stock and inoculate 25 mL of 10% N WDL culture. The 127-3-T, W, R+P cultures grew for 8 days until all glucose was depleted. The 129-2-T, W, R+P cultures grew for 18 days. The remaining glucose concentrations in the 129-2-T, 129-2-W, 129-2-R, and 129-2-P cultures were 8.44, 9.61, 22.2, or 10.5 g / L glucose, respectively.

[0146] The biomass of the cultures was harvested, freeze-dried, and subjected to FAME analysis to obtain the oil profile, as Figure 29 and 30 shown. The 127-3 axenic transformants produced up to 49.32 mg C20:3(n-6) (DGLA) / g of dry biomass, accounting for 7.3% of the FAME profile, higher than 0.68 mg / g DGLA in 116-5, or 0.1% of the FAME profile.

[0147] Example 13. Engineered microorganisms containing multiple desaturases.

[0148] The Δ6 desaturase (Bty) was cloned into the 3' of the C16:0 elongase (Obl), Δ9 desaturase (Ulk), and hygromycin resistance gene (ble R ) and the 5' of the Δ12 desaturase (Thr) (under the control of the native T18 Δ9 desaturase promoter and separated by a 2A sequence), generating plasmid pHR84, as Figure 2 shown. T18 was biolistically transformed with pHR84 to generate hygromycin-resistant transformants, herein referred to as the 164 series. As Figure 31As shown, the fatty acid profiles of the 164 series transformants and T18B WT grown in 10% N WDL and harvested at glucose exhaustion were determined by FAME analysis. T18 WT contained 1.13 mg C18:3-6 (γ-linolenic acid) / g of dry biomass, while the 164 series transformants produced up to 23.2 mg / g, accounting for 3.4% of the total fatty acid weight percentage.

[0149] Example 14. Engineered microorganisms containing multiple desaturases under the control of a native promoter.

[0150] The Ω-3 desaturase (Pav) was cloned into the 3’ of the C16:0 elongase (Obl), the Δ9 desaturase (Ulk), the geneticin resistance gene (ble R ), the Δ6 desaturase (Bty), and the 5’ of the Δ12 desaturase (Thr) (under the control of the native T18 Δ9 desaturase promoter and separated by a 2A sequence), generating plasmid pHR86, as Figure 2 shown. T18 was biolistically transformed with pHR86, generating geneticin-resistant transformants, designated as the 167 series. As Figure 32 shown, the fatty acid profiles of the 167 series strains grown in 10% N WDL and harvested at glucose exhaustion were determined by FAME analysis. The 167 series transformants produced up to 36.6 mg GLA / g of dry biomass, accounting for 5.3% of the total fatty acid weight percentage.

[0151] Example 15. Engineered microorganisms containing a desaturase under the control of a tubulin promoter.

[0152] The Δ5 desaturase (Thr) was codon-optimized for T18 and cloned into the 3' of the hygromycin resistance gene (Hygro) in an expression vector containing the native α-tubulin promoter of T18, and this plasmid was designated as pHR83, as Figure 2 shown. The strain 127-3-W that produces DGLA was biolistically transformed with pHR83. Six hygromycin-resistant transformants were recovered. As Figure 33 and 34 shown, the fatty acid profiles of the 165 series transformants (with 7.04, 2.21, and 8.06 g / L glucose remaining in 165-3, 165-5, and 165-6, respectively) grown in 10% N WDL together with the parental 127-3-W and harvested at glucose exhaustion or near exhaustion were determined by FAME analysis. The 165 series transformants produced up to 83.07 mg / g of dry biomass, accounting for 15.4% of the total fatty acid weight percentage.

[0153] Example 16. Engineered microorganisms containing a Δ5 desaturase.

[0154] As Figure 2 shown, the Δ5 desaturase (Thr) was cloned into the 5' of the G418 resistance gene (neo) in an expression vector under the control of the subB promoter in pHR95. The GLA-producing strain 167-1 was biolistically transformed with pHR95. The transformants were recovered on medium supplemented with 0.75 mM DHA. Three G418-resistant transformants were recovered. Transformants 173-1 and 173-2 were also DHA auxotrophs. 173-1 and 173-2 were grown in 25 mL of 10% N WDL + 0.5 mM DHA for 7 days until glucose consumption ceased (residual glucose ~13 g / L). Transformant 173-3 was grown in 10% N WDL for 4 days until glucose was depleted (residual glucose < 1 g / L). The biomass of all cultures was harvested, freeze-dried and subjected to FAME analysis to obtain the oil profile, as Figure 35 shown.

[0155] Example 17. PUFA auxotrophic engineered microorganisms restored to PUFA prototrophy.

[0156] The PUFA auxotrophic strain generated by knocking out subB in strain 167-1 was restored to PUFA prototrophy. The reversal of auxotrophy was achieved by passaging cells from 173-1 and 173-2 in decreasing concentrations of DHA, starting from 0.5 mM DHA and passing through 0.25 mM DHA, 0.125 mM DHA, 0.05 mM DHA, and finally to WDL medium without added PUFA. The mixed population of prototrophic 173-1 and 173-2 was plated on a Windust plate and streaked on separate Windust plates to obtain single colonies. Colonies of 173-1 grew within 6 days, and four were picked and named 173-1-T, 173-1-W, 173-1-R, and 173-1-P. Colonies of 173-2 grew within 7 days, and four were picked and named 173-2-T, 173-2-W, 173-2-R, and 173-2-P. Frozen stocks were prepared using 100 µL of 3-day-old 10 mL WDL sterile cultures and inoculated into 25 mL of 10% N WDL cultures. Cultures of 173-1-T, 171-1-W, 171-1-R, and 171-1-P were grown for 7 - 10 days until glucose consumption ceased. Cultures of 173-2-W, 173-2-R, and 173-2-P were grown for 7 days. One strain, 173-2-T, grew poorly in the culture. The remaining glucose concentrations in 173-1-T, 173-1-W, 173-1-R, 173-1-P, 173-2-W, 173-2-R, and 173-2-P were 24.8, 26.8, 21.4, 24.5, 23.7, 32.1, and 25.6 g / L glucose, respectively. The biomass of the cultures was harvested, freeze-dried, and subjected to FAME analysis to obtain an oil profile, as Figure 36 and 37 shown.

[0157] Interestingly, different PUFA products accumulated in the 173 transformation series. In one restored auxotroph, 173-1, EPA accumulated to ~5.0% within the sterile culture in the flask. As Figure 35 shown, in another auxotroph, 173-2, recovered from the same transformation, DPA-3 accumulated to ~4.0% within the sterile culture in the flask. Without being bound by any theory, the elongase acting on EPA to convert it to DPA n-3 in WTT18 seems to be inactivated in 173-1.

[0158] To identify the elongase, RT-qPCR experiments were performed using five potential elongases selected from annotated sequencing data. These elongases were designated "fatty acid elongase", "polyunsaturated fatty acid Δ5 elongase", "C18-Δ9 specific elongase", "very long chain fatty acid elongase 1", and "very long chain fatty acid elongase 2". The results did not indicate a completely inactivated elongase in 173-1-R, but one candidate appeared to undergo a much higher upregulation in 173-2-R: very long chain fatty acid elongase 2. Among the restored auxotrophs, the best candidate native elongase for upregulating the conversion of γ-linolenic acid to DGLA was polyunsaturated fatty acid Δ5 elongase ( Figure 38 ).

[0159] Example 18. Engineered Microorganisms Subjected to Adaptive Evolution.

[0160] Transformant 173-1-R was subjected to adaptive laboratory evolution. In this method, the transformant was passaged 30 times in 10 mL WDL + 30 g / L NaCl. Each passaged culture was grown at 25 °C for 24 hours and then at 4 °C for 48 hours, after which the culture was used to inoculate 10 mL of fresh 10 mL WDL + 30 g / L NaCl and the same temperature cycle was carried out. After 30 rounds of passage, single colonies were obtained from the resulting mixed population. The axenic transformant was grown in 60 mL of UF60 medium at 20 °C for 10 - 14 days (until glucose depletion). Figure 39 and 40 shows the FAME profiles of seven axenic transformants isolated from the 173-1-R ALE mixed population.

[0161] Example 19. Engineered Microorganisms Subjected to Mutagenesis.

[0162] Transformant 173-1-R was mutagenized in 10 mL of WDL containing 0.3 M ethyl methanesulfonate (EMS). By working in the dark, the culture was incubated at 28 °C and 200 rpm for 1 hour. The culture was pelleted at 1000 g for 3 minutes, washed with phosphate-buffered solution (PBS), resuspended in 10 mL of WDL, and allowed to recover in the dark at 25 °C and 200 rpm for 3 days. 100 µL of the recovered culture was used to inoculate 10 mL of WDL and allowed to grow at 25 °C and 200 rpm in the dark for 4 days. The culture was pelleted at 1000 g for 3 minutes and resuspended in 8 mL of PBS. 4 mL of the resuspended cells were treated with 4,4-difluoro-4-bora-3a,4a-diaza- s-Stain with BODIPY (add 1 µL of BODIPY and 397 µL of 50% glycerol) and incubate for 20 minutes in the dark at room temperature. Pellet the cells at 1000g for 3 minutes, wash with 4 mL of PBS, then pellet again and resuspend in 4 mL of PBS. Add 1 milliliter (1 mL) of the resuspended cells to 3 mL of PBS and sort single cells into a 96-well plate containing WDL medium by FACS using a Bio-Rad S3e cell sorter. After sorting, incubate the plate with shaking in a BioTek Synergy H1 multimode reader at 25 °C for 72 hours. One well showed significant growth and the strain was designated 173-1-R MUT1. Grow 173-1-R MUT1 in 60 mL of WDL in three replicate baffled flasks at 25 °C and 200 rpm for 6 - 7 days (until glucose depletion). The FAME profiles of these transformants are as Figure 41 and 42 shown.

[0163] Example 20. Engineered Microorganisms Undergoing Mutagenesis.

[0164] The transformant 173-1-R was mutagenized in 10 mL of WDL containing 0.35 M ethyl methanesulfonate (EMS). By working in the dark, the culture was incubated at 28 °C and 200 rpm for 1 hour. The culture was pelleted at 1000 g for 3 minutes, washed with PBS, resuspended in 10 mL of WDL, and allowed to recover in the dark at 25 °C and 200 rpm for 7 days. 100 µL of the recovered culture was used to inoculate 10 mL of WDL + 1.5 mM isoniazid + 12.5 µM cerulenin and allowed to grow at 25 °C and 200 rpm for 3 days. 3 mL of the culture was pelleted at 1000 g for 3 minutes and resuspended in 3 mL of PBS. The resuspended cells were stained with BODIPY (1.5 µL of BODIPY and 6.5 µL of DMSO were added) and incubated in the dark at room temperature for 20 minutes. The cells were pelleted at 1000 g for 3 minutes, washed with 3 mL of PBS, then pelleted again and resuspended in 3 mL of PBS. Single cells were sorted into 96-well plates containing WDL medium by FACS using a Bio-Rad S3e cell sorter. After sorting, the plates were incubated with shaking at 25 °C in a BioTek Synergy H1 multimode reader for 14 days. The transformant isolated from the growth within one of the wells was named 173-1-R MUT5. The 173-1-R and 173-1-R MUT5 strains were grown in 60 mL of UF60 in three replicate baffled flasks at 20 °C and 200 rpm for 13 days (until glucose depletion). The FAME profiles are as Figure 43 and 44 shown.

[0165] During the above oil profiling engineering attempts, it became evident that the juxtaposition of the native Δ9 desaturase promoter and the C16 elongase ORF (linked by a short linker sequence) conferred unique transcriptional activity. This transcriptional activity was greatly reduced when the Δ6 desaturase (Bty) or the Ω-3 desaturase (Obl) was placed 3' of the Δ9 desaturase promoter. This effect can be seen in Figure 45 by comparing series 116 (C16 elo 3' to Δ9 PR), series 136 (Δ6 des Bty 3' to Δ9PR), and series 137 (Ω-3 desaturase Obl 3' to Δ9 PR). The oleic acid production was reduced by approximately 10-fold in series 136 and 137 compared to the series 116 transformants. The reduced activity of the C16 elongase (Obl) on C16:0 in series 136 and 137 led to an accumulation of C16:0 that was 2.5-fold higher than that in series 116.

[0166] An unexpected and unanticipated effect of engineering the classical pathway in T18 was an increase in carotenoid production and the generation of novel carotenoid species not normally seen in T18. When oils extracted from the fermentation of 173-1-R (a restored auxotroph and EPA producer) were analyzed by HPLC and compared to oil samples from WT T18, the β-carotene content increased by 93% and the canthaxanthin content increased by 203%.

[0167] Example 21. Engineered microorganisms containing the T18 wild-type polyunsaturated fatty acid Δ5 elongase (5ELO).

[0168] Based on qPCR results, the D5 elongase from WT T18 (designated 5ELO) was cloned into the 3’ of the C16:0 elongase (Obl), Δ9 desaturase (Ulk), zeocin resistance gene (bleR), Δ6 desaturase (Bty), and to the 5’ of the Ω-3 desaturase (Pav) (2 copies), Δ5 desaturase (Thr), and Δ12 desaturase (Thr) (under the control of the native T18 Δ9 desaturase promoter and separated by a 2A sequence) in an expression vector, generating pHR101, as Figure 2 shown. Biolistic transformation of T18WT with pHR101 generated zeocin-resistant transformants, herein designated the 180 series of transformants. As Figure 46 shown, the fatty acid profiles of 180 series transformants 180-1 and 180-2 grown to glucose exhaustion in 10% N WDL were determined by FAME analysis. It has been shown that T18 WT produces very little EPA and no C18:2 linoleic acid, while 180-1 produces 23.3 mg / g of EPA and 25.4 mg / g of linoleic acid, representing 3.4% and 3.7% of the total fatty acid weight percentage. The weight percentage is determined by the ratio of mg / g of a specific fatty acid to mg / g of total fatty acids. The EPA level produced by strain 180-1 was comparable to that of 173-1-R: 23.3 mg / g vs. 24.6 mg / g, respectively.

[0169] Biolistic transformation of strain 180-1 with pHR64 was performed with the aim of knocking out subunit B of the PUFA synthase. G418-resistant transformants were obtained, herein designated the 183 series of transformants. As Figure 47As shown, the fatty acid profiles of the 183-3 and 183-(5-8) transformants grown in 10% N WDL + 0.6 mM DHA until the remaining glucose was 18.7, 22.2, 14.2, or 29.3 g / L, respectively, were determined by FAME analysis (183-8 had no glucose reading due to a YSI instrument error). Strain 183-8 was restored to prototrophy using the method described previously, yielding axenic strains 183-8-T, 183-8-W, 183-8-R, and 183-8-P. As Figure 48 shown, the fatty acid profiles of 183-8-T, W, R, and -P grown in 10% N WDL until the remaining glucose was 3.63, 3.33, 3.86, and 5.81 g / L, respectively, were determined by FAME analysis. The 183-8 prototroph reached 47 mg / g DPA n-3.

[0170] Strain 180-1 was biolistically transformed with pHR106 with the aim of knocking out very long-chain fatty acid elongase 2 (referred to as VLCELO2). Hygromycin-resistant transformants were obtained and are referred to herein as the 185 series transformants. 185-6 was biolistically transformed with pHR95 with the aim of knocking out subunit B of the PUFA synthase. G418-resistant transformants were obtained and are referred to herein as the 190 series transformants. As Figure 49 shown, the fatty acid profiles of the 190-(1-6) transformants (except 190-6 grown in 10% N WDL) grown in 10% N WDL + 0.6 mM DHA until the remaining glucose was 18.5, 28.6, 32.3, 29.0, 17.0, or 0 g / L, respectively, were determined by FAME analysis. Strain 190-6 produced 49.56 mg / g EPA, more than twice the proportion in 180-1, despite the presence of a functional PUFA synthase.

[0171] Sequence Listing

[0172] Promoter of D9 desaturase (ONC-T18) (SEQ ID NO:1)

[0173] AGGATCAAAGTCATACTATGCGTACACGCCGCGTTCGGAAACCCTAGCTGGTTCAACCAGTTCCCTCTTCTGATTCCCTCGCTGGGTTCTGCGGGCCACGCTCAAGCCGTCCGGGACGTCATGGACGTCGCGCTGCCCTGCGTCGTTCTTCTACGCGTACGCACAAGAAGGCGTCACCGCCGCGCCCGCGCCGAAGACCTCCCTCCCGATCGAAGGTCCTGGTTCTCGGGAGGCGCTGTGCGTGGTATGTCGACGCGCTCGGCTCTGCGCTGGAGAGCGCAAGGCGGCTTTTTGACCAGGTTGCCTGCCTCCTACCACGTGCCCGTAGGGAGGGGGAATGTACCGCAGTGCGGTGGTCCGCCAAGCAAGAAACCCCGCAGAGAAGGCGTAAAGTGGAAGAAAAACAGCGTCGTATGCCGCCGTCGTCGCAGGTGCTCGTCGTCGCCTCGTCGATGGGACCCATCATGCGCTGAGAGTCTGCTGCAAAAGAGGTAGGGACTCGGGAAGGACCTGGTTCGCGCTGGCTGGGGAATCAGTAATCGCATTTCGGACATGGATGCGGAGACGCTCCCCGATGACGATGCTCCAGGAATCGCGCGGCACGTTTTACGGCGGCGAGAGAGAAAGTCTCAGCTTCTTTTCGAGGGTATACTCCGTGGCGGGTTATCATCATGTGAGAGATGTATCGACGCGATGGAGAAGCATCGGGTCTTCGTCGAACATCCGGGGTCGCCGGTTCGTCACGAAGCCAGCTCATGCCTCCACATGTCTCACAAGACCACCGAAAAACTGTCGAACTTGATTCTTTAGGTCTCTCGGACGCAAATAAAAAGCATCGGCGCGCTCGCGTTCACCAGCAAGCAGACAAAACCAATATCAGCCTATTGGCCGACCAAAACCAAGCAGCAGTTCCTCAACTCGGCTCTGCTCAACTCAGCAAACTGCCAACGCGTACTAGCAGACAAGGATTCACCCCAGCTTCGGTTGAAACTACAAGATC。

[0174] C16 elongase, Thraustochytrium sp. (SEQ ID NO:2)

[0175]

[0176] D9 desaturase, certain species of Pythium (SEQ ID NO: 3)

[0177]

[0178] Thraustochytrium sp. ONC-T18 D9 desaturase (SEQ ID NO:4)

[0179]

[0180] Thraustochytrium sp. D12 desaturase (SEQ ID NO:5)

[0181]

[0182] Shewanella PfaC (subunit of PUFA synthase) (SEQ ID NO: 6)

[0183]

[0184] Ω3 desaturase of a certain species of Oblongomyces (SEQ ID NO: 7)

[0185]

[0186] D6 desaturase, Botryosphaeria sp. (SEQ ID NO:8)

[0187]

[0188] Ω3 desaturase from Pavlova lutheri (SEQ ID NO:9)

[0189]

[0190] Δ5 desaturase of Thraustochytrium sp. (SEQ ID NO: 10)

[0191]

[0192] Δ9 promoter and C16 elongase (Obl) ORF (SEQ ID NO:11)

[0193] Lowercase letters indicate the end of the promoter sequence and the connection between the promoter and the C16 elongase.

[0194]

[0195] Linkage between the Δ9 promoter and the C16 elongase (Obl) ORF (SEQ ID NO: 12)

[0196] ggtacctcgcgaatgcatctaga

[0197] Δ9 promoter and the Δ6 desaturase (Bty) ORF (SEQ ID NO: 13)

[0198] Lowercase letters indicate the end of the promoter sequence and the linkage between the promoter and the Δ6 desaturase (Bty) ORF.

[0199]

[0200] Linkage between the Δ9 promoter and the Δ6 desaturase (Bty) ORF (SEQ ID NO:14)

[0201] ggtacctcgcgaatgcatctaga

[0202] Δ9 promoter and the Ω3 desaturase (Obl) ORF (SEQ ID NO:15)

[0203] Lowercase letters indicate the end of the promoter sequence and the linkage between the promoter and the Ω3 desaturase (Obl) ORF.

[0204]

[0205] Linkage between the Δ9 promoter and the Ω3 desaturase (Obl) ORF (SEQ ID NO:16)

[0206] ggtacctcgcgaatgcatctaga

[0207] Δ5 elongase from a species of Thraustochytrium (SEQ ID NO:17)

[0208] ATGGAGGTCGCCGGGCAGCAATGGCGCCGGTTCGTGGACGCCGTAGACAACCGGATCGTGGAATTCATGGAGCACGAAAAGCCCAACAAGCTGAACGAGGGCAAGCTCTTTATCTCGACCGAGGAGATGATGGCGCTCATCGTCGGCTACCTGGCGTTCGTGGTTCTCGGGTCTGCCTTCATGACGGCCTTTGTGAGTAAGCCTTTCGAGCTCAAGTTCCTGAAGCTCGTGCACAACATCTTTCTCACCGGTCTGTCCCTGTACATGGCTAGCGAGTGCGCGCGCCAGGCCTACCTCGGCGGCTACAAGCTCTTTGGCAACCCGATGGAGAAGGGTGCCGAGTCTCACGCCCTGGGCATGGCTAGCATTATCTACGTTTTTTACGTGAGCAAGTTCCTCGAGTTTCTTGACACGGTCTTCATGATCCTCGGCAAGAAGTGGAAGCAGCTCAGCTTTCTTCACGTCTACCACCACGCGAGCATCAGCTTCATCTGGGGCATTATCGCCCGTTTTGCGCCCGGTGGCGACGCGTACTTTTCCACCATCCTCAACAGCAGCGTGCATGTCGTGCTCTACGGCTACTACGCCTCGACCACGCTCGGCTACACCTTCATGCGCCCGCTGCGCCCGTACATTACTACCATCCAGCTCACGCAGTTCATGGCCATGGTCGTCCAGTCCGTCTATGACTACTACAACCCTTGCGACTACCCGCAGCCCCTCGTCAAGCTACTCTTCTGGTACATGCTCACCATGCTCGGCCTTTTCGGCAACTTCTTCGTGCAGCAGTACCTCAAGCCCAAGGCGCCTAAGAAGCAAAAGACCATC

Claims

1. A microbial oil containing fatty acids, wherein the fatty acids include C20:3(n-6) (dihomo-γ-linolenic acid) and C20:5(n-3) eicosapentaenoic acid (EPA).

2. The microbial oil according to claim 1, wherein the fatty acids include 0.01% to 16% of C20:3(n-6) (dihomo-γ-linolenic acid).

3. The microbial oil according to claim 1 or 2, wherein the fatty acids include 1-17% EPA.

4. The microbial oil according to claim 3, wherein the fatty acids include 5-17% EPA.

5. The microbial oil according to any one of claims 1-4, wherein the fatty acids include 5-10% C14:0 (myristic acid).

6. The microbial oil according to any one of claims 1-5, wherein the fatty acids include 13-22% of C16:0 (palmitic acid).

7. The microbial oil according to any one of claims 1-6, wherein the fatty acids include C18 unsaturated fatty acids.

8. The microbial oil according to claim 7, wherein the fatty acids include 10-60% C18 unsaturated fatty acids.

9. The microbial oil according to claim 7 or 8, wherein the fatty acids include 10-45% C18:1 oleic acid.

10. The microbial oil according to any one of claims 7-9, wherein the fatty acids include C18:2(n-6) linoleic acid.

11. The microbial oil according to claim 10, wherein the fatty acids include 0.01% to 40% of linoleic acid.

12. The microbial oil according to any one of claims 1-11, wherein the oil further includes C18:3(n-3) (α-linolenic acid), C18:3(n-6) (γ-linolenic acid), C20:4(n-3) (eicosatetraenoic acid), C20:5(n-3) (EPA), and C22:5(n-3) (docosapentaenoic acid (n-3) (DPA-3)).

13. The microbial oil according to any one of claims 1-12, wherein the microbial oil contains 85 wt% to 95 wt% of total fatty acids.

14. The microbial oil according to claim 13, wherein the microbial oil contains at least 90 wt% of total fatty acids.

15. The microbial oil according to any one of claims 1-14, wherein the microbial oil contains less than 35% saturated fatty acids.

16. The microbial oil according to any one of claims 1-14, wherein the microbial oil contains less than 30% saturated fatty acids.

17. The microbial oil according to any one of claims 1-14, wherein the microbial oil contains 0.001% to 35% saturated fatty acids.

18. The microbial oil according to any one of claims 1-17, wherein the microbial oil is produced by a microorganism selected from the group consisting of the genera Schizochytrium, Oblongichytrium, Aurantiochytrium, and Thraustochytrium.

19. The microbial oil according to any one of claims 1-18, wherein the microbial oil is produced by an engineered microorganism.

20. An engineered microorganism comprising a first nucleic acid sequence encoding an elongase and a second nucleic acid sequence encoding a desaturase, wherein the first and second nucleic acid sequences are operably linked to a Δ9 desaturase promoter.

21. The engineered microorganism according to claim 20, wherein the desaturase is a Δ9 desaturase.

22. The engineered microorganism according to claim 21, wherein the Δ9 desaturase is a Δ9 desaturase of Thraustochytrium sp. or Aurantiochytrium sp.

23. The engineered microorganism according to any one of claims 20-22, wherein the elongase is a C16:0 elongase or a Δ5 elongase.

24. The engineered microorganism according to claim 23, wherein the C16:0 elongase is an elongase of Oblongichytrium sp.

25. The engineered microorganism according to any one of claims 20-24, further comprising a third nucleic acid encoding a Δ12 desaturase.

26. The engineered microorganism according to claim 25, wherein the Δ12 desaturase is a desaturase of Thraustochytrium sp.

27. The engineered microorganism according to any one of claims 20-26, further comprising a fourth nucleic acid encoding a Δ6 desaturase.

28. The engineered microorganism according to claim 27, wherein the Δ6 desaturase is a Δ6 desaturase of Botryochytrium sp.

29. The engineered microorganism according to any one of claims 20-28, further comprising a fifth nucleic acid encoding an Ω3 desaturase.

30. The engineered microorganism according to claim 29, wherein the Ω3 desaturase is an Ω3 desaturase of Oblongichytrium sp.

31. The engineered microorganism according to any one of claims 20-30, further comprising a sixth nucleic acid encoding a Δ5 desaturase.

32. The engineered microorganism according to claim 31, wherein the Δ5 desaturase is a Δ5 desaturase of Thraustochytrium sp.

33. The engineered microorganism according to any one of claims 20-32, wherein the Δ9 desaturase promoter is at its natural position in the genome of the microorganism.

34. The engineered microorganism according to any one of claims 20-32, wherein the Δ9 desaturase promoter and the first and second nucleic acids are on a heterologous construct.

35. The engineered microorganism according to any one of claims 20-34, wherein the first and second nucleic acids disrupt the endogenous Δ9 desaturase sequence of the microorganism.

36. The engineered microorganism according to any one of claims 20-35, further comprising a G418 resistance gene.

37. The engineered microorganism according to any one of claims 20-36, further comprising one or more 2A sequences.

38. The engineered microorganism according to any one of claims 20-37, further comprising a reporter gene.

39. The engineered microorganism according to claim 38, wherein the reporter gene is luciferase.

40. The engineered microorganism according to any one of claims 20 - 39, further comprising one or more tubulin promoters, one or more tubulin terminators, or both one or more tubulin promoters and one or more tubulin terminators.

41. The engineered microorganism according to any one of claims 20 - 39, wherein the nucleic acid comprises one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or both one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators.

42. A microbial oil produced by the engineered microorganism according to any one of claims 20 - 41.

43. A method for producing polyunsaturated fatty acids, comprising (a) providing the engineered microorganism according to any one of claims 20 - 41, and (b) culturing the engineered microorganism under conditions sufficient to produce the polyunsaturated fatty acids.

44. A method for promoting the conversion of saturated fatty acids to unsaturated fatty acids, comprising the steps of (a) transforming an oil - producing microorganism with a construct comprising a first nucleic acid encoding an elongase and a second nucleic acid encoding a desaturase, wherein the construct is inserted at a position in the genome of the oil - producing microorganism, and the expression of the encoded elongase and desaturase is controlled by the native promoter of the oil - producing microorganism; and (iii) culturing the transformed microorganism under conditions for producing fatty acids, wherein the transformed microorganism converts saturated fatty acids to unsaturated fatty acids more than the control untransformed microorganism.

45. The method according to claim 44, wherein the native promoter is a Δ9 desaturase promoter.

46. The method according to claim 44 or 45, wherein the desaturase is a Δ9 desaturase.

47. The method according to claim 46, wherein the Δ9 desaturase is a Δ9 desaturase from Thraustochytrium sp. or Aurantiochytrium sp.

48. The method according to any one of claims 44 - 47, wherein the elongase is a C16:0 elongase or a Δ5 elongase.

49. The method according to claim 48, wherein the C16:0 elongase is a C16:0 elongase from Oblongichytrium sp.

50. The method according to any one of claims 44 - 49, wherein the construct further comprises a third nucleic acid encoding a Δ12 desaturase.

51. The method according to claim 50, wherein the Δ12 desaturase is a Δ12 desaturase from Thraustochytrium sp.

52. The method according to any one of claims 44 - 51, wherein the construct further comprises a fourth nucleic acid encoding a Δ6 desaturase.

53. The method according to claim 52, wherein the Δ6 desaturase is a Δ6 desaturase from Botryochytrium sp.

54. The method according to any one of claims 44 - 53, wherein the construct further comprises a fifth nucleic acid encoding an Ω3 desaturase.

55. The method according to claim 54, wherein the Ω3 desaturase is an Ω3 desaturase of Thraustochytrium oblongatum.

56. The method according to any one of claims 44-55, wherein the construct further comprises a sixth nucleic acid encoding a Δ5 desaturase.

57. The method according to claim 56, wherein the Δ5 desaturase is a Δ5 desaturase of Thraustochytrium.

58. The method according to any one of claims 44-57, wherein the first and second nucleic acids replace the endogenous Δ9 desaturase encoding sequence of the microorganism.

59. The method according to any one of claims 44-58, wherein the construct further comprises a G418 resistance gene.

60. The method according to any one of claims 44-49, wherein the construct further comprises one or more 2A sequences.

61. The method according to any one of claims 44-60, wherein the construct further comprises a reporter gene.

62. The method according to claim 61, wherein the reporter gene is luciferase.

63. The method according to any one of claims 44-62, wherein the construct further comprises one or more tubulin promoters, one or more tubulin terminators, or both one or more tubulin promoters and one or more tubulin terminators.

64. The method according to any one of claims 44-62, wherein the construct comprises one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or both one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators.

65. The method according to any one of claims 44-64, wherein the saturated fatty acids converted into unsaturated fatty acids are C16:0 and C18:

0.

66. The method according to any one of claims 44-65, wherein the unsaturated fatty acids are selected from the group consisting of C18:1 (oleic acid), C18:2 (n-6) (linoleic acid), C18:3 (n-3) (α-linolenic acid), and C18:3 (n-6) (γ-linolenic acid).

67. The method according to any one of claims 44-66, wherein the transformed microorganism produces increased amounts of C20:3 (n-6) (dihomo-γ-linolenic acid), C20:4 (n-3) (eicosatetraenoic acid), C20:5 (n-3) (EPA), and C22:5 (n-3) (DPA-3) compared to a control untransformed microorganism.

Images