Application of EPY1 gene or overexpression vector of EPY1 in improvement of photosynthesis and yield of rape

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses application of an EPY1 gene or an overexpression vector of EPY1 in improvement of photosynthesis and yield of rape. The nucleotide sequence of the EPU1 gene is as shown in SEQ ID NO. 1. Research results prove that the EPD1 gene plays a key role in regulation and control of photosynthesis and yield-related traits of rape. The transgenic result of the EPY1 gene in oilseed rape proves that the overexpression of the gene not only greatly improves the photosynthesis capacity of the transgenic oilseed rape, but also greatly improves the yield-related traits of oilseed rape families, such as the number of branches, the total pod number of a single plant, the biomass and the yield of the single plant. Therefore, the EPD1 gene has a good application prospect in photosynthetic improvement and high-yield breeding of oilseed rape and other crops.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a key gene for controlling photosynthesis and yield traits of rapeseed EPY1 or EPY1 The application of the overexpression vector in the genetic improvement of rapeseed. By overexpressing EPY1 gene, the photosynthesis level and yield-related indexes of transgenic rapeseed can be significantly improved, which proves the important function and application value of this gene Background Art

[0002] With the deterioration of the environment and the increasing scarcity of resources, modern agriculture urgently needs to provide higher crop yields to feed the growing large population. However, traditional agriculture has reached a bottleneck in increasing yields by relying on the application of large amounts of pesticides and fertilizers. Improving crop yields through the improvement of photosynthesis traits plays an important role in the green and sustainable development of modern agriculture. Research shows that enhancing the photosynthetic efficiency of crops can theoretically increase their yield potential by 50%. However, C3 crops such as rapeseed have low light energy utilization efficiency. Therefore, studying and analyzing the genetic regulation basis of photosynthesis, exploring excellent photosynthetic gene resources and carrying out high photosynthetic efficiency improvement will fundamentally greatly increase the yield of rapeseed, which is of great significance for promoting the high and stable yield of rapeseed and the sustainable development of rapeseed production

[0003] Previous studies on rapeseed photosynthesis mainly focused on the photosynthetic physiological process, while the research on the regulation and molecular mechanism of rapeseed photosynthesis was relatively weak. In recent years, research results have found that some genes are involved in the internal regulation process of rapeseed photosynthesis. Overexpression of rapeseed gene BnGRF2 in Arabidopsis can significantly increase the chlorophyll content and net photosynthetic rate of plants, and ultimately increase the seed grain weight and oil yield of transgenic families. Expression profile analysis shows that the expression levels of some photosynthesis-related genes are enhanced in BnGRF2 overexpression plants. The AP2 family transcription factor BnWRI1 can directly bind to the promoter element of the photosystem gene LHB1B2 as a transcriptional activator to coordinate the fatty acid synthesis and photosynthetic synthesis pathways in developing rapeseed seeds. Overexpression of BnWRI1 significantly increases the chlorophyll content in transgenic rapeseed seeds. Recent research has found that the carbon metabolism-related transporter gene BnPPT1 plays a key role in the membrane lipid synthesis and chloroplast development processes in rapeseed leaves and thus affects photosynthesis output. Overexpression of this gene significantly increases the transpiration capacity and net photosynthetic rate of transgenic plant leaves BnaFtsH1 The gene plays an important role in the repair process of photosystem II. Increasing the copy number of the BnaFtsH1 gene may be beneficial to the biomass accumulation of rapeseed plants. Rapeseed SGIGenes can enhance the net photosynthetic capacity of transgenic plants and maintain their stability under drought stress by mediating the homeostasis of reactive oxygen species. Further research is needed to deeply analyze the molecular network of photosynthetic regulation in rapeseed, explore the main pathways and key regulatory genes, and provide important theoretical reserves and technical support for the improvement of high photosynthetic efficiency in rapeseed. Summary of the Invention

[0004] Based on the above technical problems, the present invention provides a photosynthetic regulatory gene EPY1 for use in enhancing the photosynthetic capacity of rapeseed and increasing its yield. The present invention isolates and applies a DNA fragment containing EPY1 the gene, which confers an improvement in the photosynthesis level and yield-related traits of rapeseed.

[0005] In the first aspect of the present invention, there is provided an application of a EPY1 gene or EPY1 its overexpression vector in improving the photosynthesis and yield of rapeseed. EPY1 The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the encoded protein sequence is shown as SEQ ID NO.2.

[0006] As a preferred embodiment of the present invention, the EPY1 gene or EPY1 its overexpression vector is used to increase the plant height of rapeseed, and improve the number of branches and the total number of siliques on the branches of rapeseed.

[0007] As a preferred embodiment of the present invention, the EPY1 overexpression vector is obtained by ligating the EPY1 sequence to the vector pENTR / SD / D-TOPO.

[0008] As a preferred embodiment of the present invention, the EPY1 overexpression vector is constructed according to the following steps: Using the cDNA of rapeseed as a template, primers are designed for PCR amplification; The amplification product is ligated to the linearized vector pENTR / SD / D-TOPO, and the resulting recombinant product is transferred into the host cell to obtain the EPY1 overexpression vector.

[0009] As a preferred embodiment of the present invention, the primer sequences for PCR amplification are as follows: EPY1F: 5'- CTTAACGATGGAGTTTGGTG -3'; EPY1R: 5'- CACATTATTCGTCGTCTTGTTA -3'.

[0010] As a preferred embodiment of the present invention, the conditions for PCR amplification are: pre-denaturation at 95 °C for 2 min; 95 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, for 32 cycles; extension at 72 °C for 15 min.

[0011] In a second aspect of the present invention, a method for cultivating high-yield rapeseed is provided, including introducing an overexpression vector of the gene EPY1 or EPY1 into rapeseed plants.

[0012] As a preferred embodiment of the present invention, it includes the following steps: Transfer the overexpression vector of the EPY1 into competent cells, culture to obtain an infection solution; Use the infection solution to infect the hypocotyls of sterile rapeseed seedlings, culture to obtain high-yield rapeseed plants.

[0013] In a third aspect of the present invention, a method for improving the photosynthesis of rapeseed is provided, including introducing an overexpression vector of the gene EPY1 or EPY1 into rapeseed plants.

[0014] As a preferred embodiment of the present invention, it includes the following steps: Transfer the overexpression vector of the EPY1 into competent cells, culture to obtain an infection solution; Use the infection solution to infect the hypocotyls of sterile rapeseed seedlings, culture to obtain rapeseed plants with improved photosynthesis.

[0015] As a preferred embodiment of the present invention, rapeseed plants are obtained through callus screening culture, callus subculture and differentiation, and rooting culture in sequence.

[0016] As a preferred embodiment of the present invention, the competent cells are Escherichia coli DH5α.

[0017] The present invention isolates the gene EPY1 from rapeseed, and for the first time discovers that this gene simultaneously controls photosynthesis and yield traits, and identifies its key function in improving rapeseed photosynthesis and yield, specifically manifested as: EPY1 The photosynthetic level at the seedling stage of gene overexpression is significantly improved, and the number of branches, the total number of siliques on branches, the total number of siliques per plant, and the fresh weight biomass per plant of rapeseed are all significantly higher than those of normal seedlings. This discovery will be of great significance for deepening the understanding of the photosynthetic regulation mechanism of rapeseed and the photosynthetic improvement and high-yield breeding of other crops such as rapeseed.

[0018] Carrying the present invention EPY1The expression vector of the gene can be introduced into plant cells by using conventional biotechnology methods such as Ti plasmids, plant virus vectors, direct DNA transformation, and microinjection.

[0019] The EPY1 expression vector of the gene of the present invention can be used to transform various plants including rapeseed to cultivate plant varieties with improved photosynthetic capacity and yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a plasmid map and construction process diagram of the overexpression vector pEarleyGate101- EPY1 modified with the pEarleyGate101 vector as the backbone.

[0021] Figure 2 It is EPY1 the expression of the EPY1 gene in the overexpressing plants. In the figure: A is EPY1 the transcriptional level analysis of the EPY1 gene in the overexpressing plants. B is EPY1 the analysis of the expression level of the EPY1 protein in the overexpressing plants. EPY1-1, EPY1-4, and EPY1-103 are respectively EPY1 the overexpressing plant families.

[0022] Figure 3 It is EPY1 the analysis of photosynthetic electron transfer and chlorophyll fluorescence indexes of the overexpressing plants at the seedling stage. In the figure: ETR is Phase Relative electron transfer rate . Y(Ⅱ) is the photosynthetic photoelectron yield. NPQ is the non-photochemical quenching. PAR is the photosynthetically active radiation. 3 replicates. * indicates t the P value of the test is less than 0.05, with significant difference; ** indicates t the P value of the test is less than 0.01, with extremely significant difference.

[0023] Figure 4 It is EPY1 the analysis of photosynthesis indexes of the overexpressing plants at the seedling stage of field growth. NPR is the net photosynthetic rate. Tmml is the transpiration rate. Cond is the stomatal conductance. Ci is the intercellular carbon dioxide concentration. 5 replicates. EPY1-1, EPY1-4, and EPY1-103 are respectively EPY1 the overexpressing plant families. * indicates t the P value of the test is less than 0.05, with significant difference; ** indicates t the P value of the test is less than 0.01, with extremely significant difference.

[0024] Figure 5 Yes EPY1 Phenotype photos of overexpressing plants during the field growth and maturity period. In the figure: WT is the wild-type control; EPY1-1, EPY1-4, and EPY1-103 are respectively EPY1 Overexpressing plant families.

[0025] Figure 6 Yes EPY1 Identification of phenotypes and yield-related traits of overexpressing plants during the field growth and adult stage. A is EPY1 Analysis of phenotypes and yield-related traits of overexpressing plants during the field maturity period. B is EPY1 Analysis of yield-related traits of overexpressing plants at the field harvest stage. 10 replicates. EPY1-1, EPY1-4, and EPY1-103 are respectively EPY1 Overexpressing plant families. * indicates t The P value of the test is less than 0.05, with significant differences; ** indicates t The P value of the test is less than 0.01, with extremely significant differences. Detailed implementation methods

[0026] The following examples define the present invention and describe the methods for cloning a DNA fragment containing the complete coding region of a EPY1 gene and verifying the EPY1 function of the gene. Based on the following description and these examples, those skilled in the art can determine the basic features of the present invention and, without departing from the spirit and scope of the present invention, can make various changes and modifications to adapt it to different uses and conditions.

[0027] The rapeseed ZS11 and "Zhongshuang No. 6 (ZS6)" involved in the present invention were both cultivated by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences. For information, please refer to the website of the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences: https: / / ocri.caas.cn / sycgzh / zdpz / nyncbzdpz / fc3fb8a6196f45108696e171d3fbd93a.htm.

[0028] I. EPY1 Construction of the gene overexpression vector and genetic transformation To analyze the EPY1 function of the gene, the present invention overexpresses it in wild-type rapeseed and studies the function of the gene from the phenotypes of transgenic plants.

[0029] The method for constructing the overexpression vector is as follows: First, by searching the genomic annotation website NCBI (https: / / www.ncbi.nlm.nih.gov / )EPY1 Gene annotation number: BnaA07g33090D, and primers were designed based on this. Using the leaf cDNA of ZS11 obtained by reverse transcription as a template, with primers EPY1F (5'- CTTAACGATGGAGTTTGGTG -3', a sequence-specific primer plus a TOPO cloning adapter, SEQ ID NO.3) and EPY1R (5'- CACATTATTCGTCGTCTTGTTA -3', a sequence-specific primer plus a TOPO cloning adapter, SEQ ID NO.4), a cDNA fragment containing EPY1 the complete coding region of the gene was amplified, and the amplified product was the nucleotide sequence shown in SEQ ID NO.1 (152 - 1846bp).

[0030] The length of the SEQ ID NO.1 sequence is 1965bp; the coding region is 152 - 1846bp, with a length of 1695bp.

[0031] SEQ ID NO.1: TCTCTCTCTCTGTACCATTCTTTTCCCTTTCTTCTATGAATTTTAATTTTTTCCTTTTTTAATTTTAATTTTTTTCATTTCTGTAACTTCTCGTCAAAGACAGAGAGGGGGAAAATACAAAAGAAGTGAATAAATTAAAAAAAACTTAACG ATGGAGTTTGGTGGTGGTACTACTACAACCACATCCGCACCCGCAGAGGCGCCGCGACCGCCACAATCC AACGATGCGGCCGCCGCCACAGAAGCTGCGGCAGCTGCAGCAACGGTTGGAGCGTTCGAGGTGTCGGAGGAGATGA ACGACCGTGGTGGATTCGGAGCAAACCGGTGGCCGCGGCAGGAAACGGTTGCGCTGCTCAAAATACGATCTGACAT GGGAATAGCGTTTCGAGACGCTAGCGCTAAAGGTCCCTTGTGGGAAGAGGTTTCCAGGAAAATGGGGGAACTTGGT TACATAAGAAACGCAAAGAAATGCAAAGAGAAATTCGAAAACGTTTACAAATACCACAAACGAACCAAAGAAGGTC GTACCGGCAAATCCGAAGGCAAAACTTATCGCTTCTTTGATCAGTTAGAAGCTCTCGAGACTCATCACCAACCGCA AACGCAACCGCCGCCTCTACGACCTCACAACAACAACAGCTCCATGTTCTCCACTCCTCCTCCGGTAACAACAACT ATTATCCCCCCGACAACTACACCTTCGTTTCCAAACATCTCCGGAGACTTTATGTCGGATAATTCGACTTCTTCTT CGTCTTCTTACTCCACTTCCTCTGACGTGGACATCGGTGGCGGAGGAGGGAGGAACAAGAAGAAGAGGAAGAGGAA GTGGAAGGAGTTTTTCGAGAGGCTGATGAAACAGGTTGTTGACAAGCAAGAGGAGCTTCAGCGTCAGTTCTTGGAA GCTGTTGAGAAGCGCGAGCGCGAGAGAATGGCTAGAGAAGAGTCTTGGAGAGCTCAAGAGATCGCTAGGATCAACC GCGAACGCGAGATCTTGGCTCAAGAACGCTCCATGTCTGCGGCTAAAGACGCCGCGGTCATGGCCTTTCTCCAGAA GTTTTCGGAGAAACCAAACCCTCAAGGTCAATCAATCCCGCAGTTACAACCGCAGCCGCAACCGCAAACGCAGGTT AATAACAACAACAATCAGCAGCAAACGTCCCAAACGCCTCAAACGCCCCAACCACCACCACCACCTCCGCTTCCGC AGCCAACCTTAGACACTGCAAAAACAGACAATGGCGATCAGATCATGACAACTCCGGCGTCTGCTTCCTCCTCGCG GTGGCCGAAAGTGGAGATAGAGGCGTTGATAAAGCTGAGGACGAATCTCGATTCAAAGTATCTAGAGAACGGACCA AAAGGACCATTGTGGGAAGAGATATCAGCGGGGATGAGGAGGCTAGGATTCAACAGGAACTCAAAGAGATGCAAAG AGAAGTGGGAGAACATAAACAAATACTTCAAGAAAGTGAAGGAGAGCAACAAGAAGCGCCCTCAAGACTCCAAGAC TTGTCCTTACTTCCACCAGCTTGATGCTTTATATAGAGAGAGGAACAAGTTCCAAACCACCACCACCAACAACAAT GTAGCTTCTTCTTCCTCAACTAAACCGGATAATTCGGTTCCCTTGATGGTCCAACCGGAGCAGCAGTGGCCTCCTG CTGCAACGGTGTCTCAACCTGATCATCATCCTGCTCAGCCGTTGGATCAGAGCTTTGATGATGAAGAAGGCACAGA TGAAGAAGACTATGATGATGAGGAAGAGGACGAAGAGAATGAAGAAGAAGAAGGTGAGTTTGAGCTAGTGCCGAGC AATGATAACAAGACGACGAATAATGTGTGA CGAGGATAATGGTTCAGGGTTCGAACAGGATTGGTGGTGAAAGATTTAGTAATCTTTATTTTAAGTTTTGATACAGAAGATGAGAATTTAAATATTGGATGGGGGTGCTTTTTTTATTA, and the underlined part is the coding region.

[0032] The sequence listing SEQ ID NO:2 is EPY1 the protein sequence encoded by the gene, encoding a total of 564 amino acids.

[0033] SEQ ID NO:2 is as follows: MEFGGGTTTTTSAPAEAPRPPQSNDAAAATEAAAAAATVGAFEVSEEMNDRGGFGANRWPRQETVALLKIRSDMGIAFRDASAKGPLWEEVSRKMGELGYIRNAKKCKEKFENVYKYHKRTKEGRTGKSEGKTYRFFDQLEALETHHQPQTQPPPLRPHNNNSSMFSTPPPVTTTIIPPTTTPSFPNISGDFMSDNSTSSSSSYSTSSDVDIGGGGGRNKKKRKRKWKEFFERLMKQVVDKQEELQRQFLEAVEKRERERMAREESWRAQEIARINREREILAQERSMSAAKDAAVMAFLQKFSEKPNPQGQSIPQLQPQPQPQTQVNNNNNQQQTSQTPQTPQPPPPPPLPQPTLDTAKTDNGDQIMTTPASASSSRWPKVEIEALIKLRTNLDSKYLENGPKGPLWEEISAGMRRLGFNRNSKRCKEKWENINKYFKKVKESNKKRPQDSKTCPYFHQLDALYRERNKFQTTTTNNNVASSSSTKPDNSVPLMVQPEQQWPPAATVSQPDHHPAQPLDQSFDDEEGTDEEDYDDEEEDEENEEEEGEFELVPSNDNKTTNNV The PCR reaction conditions were: pre-denaturation at 95 °C for 2 min; 95 °C for 30 sec, 58 °C for 30 sec, 72 °C for 2 min, for 32 cycles; extension at 72 °C for 15 min.

[0034] The amplified PCR product was ligated into the intermediate vector pENTR / SD / D-TOPO by TOPO cloning method (see Figure 1 ), and the obtained vector plasmid was ligated into the final expression vector pEarleyGate101 by LR recombination reaction after positive identification (see Figure 1 ), driven by the constitutive 35S promoter, and the EPY1 terminus was fused with the EYFP and HA tag reading frames. Then it was transformed into Escherichia coli and positive clones were screened. The finally obtained overexpression plasmid vector was named pEarleyGate101- EPY1 .

[0035] The above-modified pEarleyGate101-overexpression vector was transferred into the rapeseed variety "Zhongshuang 6 (ZS6)" by an Agrobacterium-mediated rapeseed genetic transformation method. After infection, co-culture, screening for Basta-resistant calli, differentiation, rooting, acclimatization, and transplantation, transgenic plants were obtained. EPY1 The specific rapeseed genetic transformation steps are as follows:

[0036] Specifically, the rapeseed genetic transformation steps are as follows: 1. Seed sterilization: Soak the rapeseed ZS6 seeds in 75% alcohol for 1 min, rinse once with sterile water, then soak in 84 disinfectant for 15 min, and rinse the seeds 5 times with sterile water, 1 min each time.

[0037] 2. Sterile seedling culture: Sow the sterilized seeds into M0 medium (2.2 g / L MS, 7.5 g / L Agar, pH 6.0), about 40 seeds per bottle, and culture in the dark at 24°C for 5 days.

[0038] 3. Inoculation culture: One day before infection and transformation, inoculate the Agrobacterium strain to be transferred into 20 mL of LB liquid medium and culture at 28°C and 200 rpm.

[0039] 4. Rapeseed infection and transformation: (1) Cut the hypocotyls of the cultured rapeseed sterile seedlings to about 7 - 10 mm in length; (2) Centrifuge the prepared 20 mL of Agrobacterium liquid (OD 600 = about 0.6) to remove the supernatant, add an equal volume of suspension medium (4.4 g / L MS, 30 g / L sucrose, pH 6.0) to resuspend, and immerse the cut hypocotyls in it for 20 min.

[0040] 5. Co-culture: Use sterile filter paper to absorb the excess residual bacterial liquid outside the hypocotyls, and place the infected hypocotyls on M1 medium (4.4 g / L MS, 30 g / L sucrose, 18 g / L mannitol, 1 mg / L 2,4-D, 0.3 mg / L KT, 100 μM AS, 7.5 g / L Agar, pH 6.0), and culture in the dark at 24°C for 2 days; 6. Callus screening culture: Transfer the hypocotyls to M2 medium (4.4 g / L MS, 30 g / L sucrose, 18 g / L mannitol, 1 mg / L 2,4-D, 0.3 mg / L KT, 150 μL / L STS (0.1 M Na2SO3:0.1 M AgNO3 = 4:1), 300 mg / L TMT, Basta, 7.5 g / L Agar, pH 6.0), and culture under light for three weeks (24 °C, 16 h light / 8 h dark); 7. Callus subculture and differentiation: Then transfer the hypocotyls to M3 medium (4.4 g / L MS, 10 g / L glucose, 0.25 g / L xylose, 0.6 g / L MES, 2 mg / L ZT, 0.1 mg / L IAA, 300 mg / L TMT, Basta, 7.5 g / L Agar, pH 6.0), and culture under light (24 °C, 16 h light / 8 h dark), changing the fresh medium every two weeks; 8. Rooting culture: When the differentiated buds grow to about 2 cm, cut the buds and transfer them to M4 medium (3.21 g / L B5, 30 g / L sucrose, 7.5 g / L Agar, pH 6.0). When relatively developed roots grow in the M4 medium, they can be transplanted into the soil for growth.

[0041] II. EPY1 In the EPY1 gene transgenic families For rapeseed plants grown in the greenhouse to the six-leaf stage EPY1 in the

[0042] gene transgenic families and the control ZS6, take leaf samples. After extracting total RNA, use reverse transcriptase SSIII (purchased from Invitrogen) to reverse transcribe it into cDNA (operate according to the instruction manual of the Invitrogen reverse transcriptase reagent), and the reaction conditions are: 65 °C for 5 min, 50 °C for 120 min, 70 °C for 10 min. EPY1 Using the cDNA synthesized by the above reverse transcription as a template, perform specific PCR amplification on the TMA7 gene with the designed primer pair TMA7 At the same time, use the primers ( TMA7 rtF: 5'- TTCCTGTGTTTTATCCATGTAGCC -3', SEQ ID NO.5 and TMA7 rtR: 5'- CAGTCACTCTCCTACGAACATGATAG-3', SEQ ID NO.6) to perform PCR amplification on rapeseed TMA7The gene (BnaC05g11560D) was specifically amplified (the amplified product was 120 bp in length) for quantitative analysis as an internal control. The reaction conditions were: 95 °C for 30 sec; 95 °C for 5 sec, 60 °C for 34 sec, for 50 cycles.

[0043] Fluorescence detection for real-time quantitative analysis was performed during the reaction.

[0044] The results of quantitative PCR showed that EPY1 the expression levels of the gene in transgenic lines EPY1-1, EPY1-4, and EPY1-103 were significantly higher than those in the control ZS6 (see Figure 2 A in it). The results of Western blotting also showed that the expression levels of EPY1 protein in transgenic lines EPY1-1, EPY1-4, and EPY1-103 were significantly higher than those in the wild-type lines (see Figure 2 B in it). The above results confirmed that transgenic lines EPY1-1, EPY1-4, and EPY1-103 were EPY1 rapeseed overexpression lines of the gene and were used for subsequent functional identification.

[0045] III. EPY1 Identification of the photosynthetic capacity of gene overexpression transgenic lines at the seedling stage in the field EPY1 The gene overexpression transgenic lines and the control ZS6 were planted in the transgenic base in Hanchuan. When the seedlings grew to the 6-leaf stage, the third fully expanded leaf from the bottom was used for chlorophyll fluorescence and photosynthesis measurement and analysis.

[0046] Specific methods for measuring photosynthetic traits and physiological parameters: The photosynthesis measuring instrument Li-6800 is equipped with an independent leaf chamber and can directly measure physiological indexes such as the net photosynthetic (respiration) rate, transpiration rate, stomatal conductance, and intercellular CO2 concentration of rapeseed experimental materials in the field; the PAM-2500 portable modulated chlorophyll fluorometer is used to measure specific parameters of the photosystem of experimental materials, including fluorescence yield (F) and maximum fluorescence (Fm), photosynthetic quantum yield (ΔF / Fm), fluorescence quenching analysis (qP, qN, and NPQ), and light response curves.

[0047] The results of chlorophyll fluorescence analysis showed that during the light reaction stage, EPY1 the relative electron transfer rate (ETR) of the gene overexpression transgenic lines was significantly higher than that of the control ZS6 (see Figure 3 ), and its maximum electron transfer rate ETRmax was more than 36% higher than that of the control. Its photosynthetic electron yield (YⅡ) was also significantly higher than that of the control lines under relatively strong effective photosynthetic radiation (PAR200 - 3000). At the same time, the non-photochemical quenching NPQ was significantly lower than that of the control, indicating that EPY1Gene overexpression significantly improves the photosynthetic electron utilization efficiency and reduces non-photosynthetic energy dissipation simultaneously.

[0048] The measurement results of photosynthetic parameters in the dark reaction stage show that EPY1 the net photosynthetic rate (NPR) of the gene overexpression transgenic lines is significantly higher than that of the control ZS6 (see Figure 4 ), and the increase range is 41% - 59%. At the same time, the transpiration rate and stomatal conductance are also significantly higher than those of the control lines. The above analysis results indicate that EPY1 gene overexpression significantly improves the photosynthetic efficiency in both the light reaction and dark reaction stages of transgenic rapeseed.

[0049] IV. EPY1 Identification of the field phenotypes and yield-related traits of gene overexpression transgenic lines at the adult stage In view of EPY1 the significantly improved photosynthetic level of the gene overexpression lines at the seedling stage, the present invention conducts a detailed analysis of the phenotypes, biomass, and yield-related traits of these lines at the adult stage in the field.

[0050] Firstly, at the field growth and maturity stage, EPY1 the plant height and the starting height of branches of the gene overexpression lines decrease by about 10% and 20% respectively compared with the control ZS6, while EPY1 the number of branches of the overexpression lines increases by 18%, and the total number of siliques on branches increases significantly by more than 53% (see Figure 5 and Figure 6 A). The significant increase in the total number of siliques on branches also leads to an increase in the total number of siliques per plant. EPY1 The total number of siliques per plant of the overexpression lines is 43% - 68% higher than that of the control ZS6. At the same time EPY1 the fresh weight biomass per plant of the overexpression lines is also significantly higher than that of ZS6.

[0051] The present invention conducts an analysis of the yield-related traits of EPY1 the overexpression lines and the control ZS6 at the harvest stage (see Figure 6 B). The results show that EPY1 the yield per plant of the overexpression lines significantly exceeds that of the control ZS6, with an increase range of 32% - 44%. And its dry weight biomass is 14% - 34% higher than that of the control, and the increase range of grain yield is significantly higher than that of the whole plant biomass, indicating that EPY1 overexpression simultaneously brings an increase in the harvest index.

[0052] Through functional identification, the present invention finds that EPY1The gene simultaneously controls photosynthesis and yield traits and plays a key role in improving photosynthesis and yield in rapeseed. This discovery will be of great significance for deepening the understanding of the photosynthetic regulation mechanism in rapeseed and for the photosynthetic improvement and high-yield breeding of rapeseed and other crops.

[0053] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.

Claims

1. A EPY1 gene or EPY1 overexpression vector thereof in enhancing photosynthesis and yield of rapeseed, characterized in that EPY1 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The said EPY1 gene or EPY1 overexpression vector is used to increase the plant height of rapeseed, and improve the number of branches and the total number of siliques on the branches of rapeseed.

3. The application according to claim 1, characterized in that The EPY1 overexpression vector is obtained by ligating the EPY1 sequence into the vector pENTR / SD / D-TOPO.

4. The application according to claim 3, wherein The said EPY1 overexpression vector was constructed according to the following steps: Using the cDNA of rapeseed as a template, primers were designed for PCR amplification; The amplified product is ligated with the linearized vector pENTR / SD / D-TOPO, and the resulting recombinant product is transferred into the tool cells to obtain the EPY1 overexpression vector.

5. The application according to claim 4, characterized in that The primer sequences for PCR amplification are as follows: EPY1F: 5'- CTTAACGATGGAGTTTGGTG -3'; EPY1R: 5'- CACATTATTCGTCGTCTTGTTA -3'.

6. The application according to claim 4, characterized in that, The conditions for PCR amplification were: pre-denaturation at 95 °C for 2 min; 95 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, for 32 cycles; extension at 72 °C for 15 min.

7. A method for cultivating high-yield rapeseed, characterized in that, Including introducing the overexpression vector of the gene described in claim 1 EPY1 or EPY1 into rapeseed plants.

8. The cultivation method according to claim 7, characterized in that, It includes the following steps: Transfer the overexpression vector of EPY1 into competent cells, culture them to obtain an infection solution; Using the said infection solution to infect the hypocotyls of sterile rapeseed seedlings, culturing to obtain high-yield rapeseed plants.

9. A method for improving the photosynthesis of rapeseed, characterized in that, Including introducing the overexpression vector of the gene described in claim 1 EPY1 or EPY1 into rapeseed plants.

10. The method for improving the photosynthesis of rape according to claim 9, characterized in that, It includes the following steps: Transfer the overexpression vector of EPY1 into competent cells, culture to obtain an infection solution; Using the said infection solution to infect the hypocotyls of sterile rapeseed seedlings, culturing to obtain rapeseed plants with improved photosynthesis.

Images