High-risk myelodysplastic syndrome screening genes and diagnostic kits

Abstract

The present invention belongs to the field of biological genetic engineering technology and relates to high-risk myelodysplastic syndrome screening genes and diagnostic kits. The present invention provides an application of detecting the expression of YTHDF2, METTL3, and NAT10 genes in bone marrow cells of high-risk MDS patients as a specific molecular marker for screening high-risk myelodysplastic syndrome. By detecting the expression levels of YTHDF2, METTL3, and NAT10 genes mRNA, it helps to screen patients with high-risk myelodysplastic syndrome and better guide the treatment and prognosis evaluation of patients with high-risk myelodysplastic syndrome. The present invention only needs to extract the patient's bone marrow fluid and collect it together when the patient undergoes bone marrow cytology examination. The patient compliance is good, and the material is taken from human bone marrow fluid mononuclear cells. The test results are more accurate and suitable for large-scale clinical application.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological gene engineering and relates to a high-risk myelodysplastic syndrome screening gene and a diagnostic kit thereof. Background Art

[0002] Myelodysplastic syndrome (MDS) is a malignant clonal hematopoietic stem cell disorder and one of the most common hematologic malignancies. With a median age of onset of 49 years, it poses a serious threat to human health. Reports indicate that the incidence of MDS has been increasing rapidly in recent years, with an average annual growth rate of 11.6%, necessitating significant attention. MDS presents an insidious onset and is highly heterogeneous. Current diagnostic criteria rely on nonspecific criteria such as bone marrow morphology, immunophenotyping, next-generation sequencing, and chromosome analysis, which lack sensitivity and specificity, making diagnosis and risk stratification challenging. Treatment options vary depending on the diagnosis and risk stratification of MDS. Low-risk MDS patients primarily receive supportive care with oral medications, while high-risk MDS patients require hypomethylation therapy, chemotherapy, or bone marrow transplantation. The prognosis varies significantly between the two groups. High-risk MDS patients face significant challenges, particularly limited treatment options, short survival, and a high risk of progression to acute leukemia. Misdiagnosis or inaccurate stratification of MDS patients can lead to delayed treatment and compromise long-term survival. To date, there is still a lack of sufficient molecular markers for the diagnostic stratification of MDS. People are still exploring and developing a marker with high sensitivity and strong specificity to achieve more accurate diagnosis, improve treatment effects, and prolong patient survival.

[0003] Epigenetic abnormalities are common in the development of MDS. Previous studies have focused on abnormal RNA and DNA methylation. Demethylation therapy targeting abnormal gene methylation has played a role in MDS, but the vast majority of patients develop drug resistance and failure after treatment, leading to disease progression. Once patients develop acute leukemia, their survival is significantly shortened. Therefore, it is speculated that in addition to abnormal DNA methylation, MDS patients may also have other genetic abnormalities that contribute to the onset, progression, or loss of efficacy of MDS. RNA modification is an important component of epitranscriptomics. By chemically modifying individual nucleotides, RNA modification can alter the electrostatic charge, hydrophobic surface, and base pairing of RNA molecules, thereby regulating RNA metabolism and function, affecting gene expression and various biological processes.

[0004] Detection of abnormal single-gene expression can be subject to racial disparities and inaccurate bone marrow detection. Combined detection of differential multi-gene expression may address these clinical diagnostic deficiencies. Fluorescence quantitative methods are simple to operate and offer the advantages of high sensitivity, specificity, and accuracy. Their widespread availability and rapidity play an important role in clinical epigenetic testing. Currently, this technology platform lacks technical products that can rapidly, simply, and specifically detect myelodysplastic syndrome (MDS). Therefore, developing a method for detecting abnormal multi-gene expression based on mRNA in bone marrow cells from patients with high-risk MDS is of great significance. Summary of the Invention

[0005] Aiming at the problem of lack of traditional high-risk myelodysplastic syndrome diagnostic products, the present invention proposes a novel high-risk myelodysplastic syndrome screening gene combination and a diagnostic kit thereof.

[0006] In order to achieve the above object, the present invention is implemented by adopting the following technical solutions:

[0007] The present invention provides a gene differential expression detection combination for high-risk myelodysplastic syndrome screening, wherein the specific molecular marker combination includes: YTHDF2, METTL3, and NAT10 genes. The present invention proposes the use of YTHDF2, METTL3, and NAT10 genes as combined markers in the preparation of a screening kit for diagnosing or assisting in the diagnosis of high-risk myelodysplastic syndrome, wherein the YTHDF2 gene sequence is shown in SEQ ID NO: 1 in the sequence listing, the METTL3 gene sequence is shown in SEQ ID NO: 2 in the sequence listing, and the NAT10 gene sequence is shown in SEQ ID NO: 3 in the sequence listing.

[0008] The present invention also provides a detection primer and probe combination for screening high-risk myelodysplastic syndrome. The kit also includes specific primers and probes for detecting differential expression of the genes.

[0009] The primer sequences are as follows:

[0010] YTHDF2-F: CCTTAGGTGGAGCCATGATTG,

[0011] YTHDF2-R:TCTGTGCTACCCAACTTCAGT.

[0012] The sequence of YTHDF2-F is shown in SEQ ID NO: 4 in the sequence listing, and the sequence of YTHDF2-R is shown in SEQ ID NO: 5 in the sequence listing.

[0013] METTL3-F: TTGTCTCCAACCTTCCGTAGT,

[0014] METTL3-R: CCAGATCAGAGAGGTGGTGTAG.

[0015] The sequence of METTL3-F is shown in SEQ ID NO: 6 in the sequence listing, and the sequence of METTL3-R is shown in SEQ ID NO: 7 in the sequence listing.

[0016] NAT10-F:GCCTCTTGTAAGAAGTGTCTCG,

[0017] NAT10-R:TCTTTTCAGAGATGCCCTCGAT.

[0018] The NAT10-F sequence is shown in SEQ ID NO: 8 in the sequence listing, and the NAT10-R sequence is shown in SEQ ID NO: 9 in the sequence listing.

[0019] The internal reference sequence is as follows:

[0020] GAPDH-F: 5'-GGACCTGACCTGCCGTCTAG-3'

[0021] GAPDH-R: 5'-GTAGCCCAGGATGCCCTTGA-3'.

[0022] The sequence of GAPDH-F is shown in SEQ ID NO: 10 in the sequence listing, and the sequence of GAPDH-R is shown in SEQ ID NO: 11 in the sequence listing.

[0023] YTHDF2 and METTL3 are key genes involved in RNA m6A modification. METTL3 regulates gene expression through m6A modification, thereby influencing tumor cell proliferation. By regulating m6A modification on specific genes, it influences cell differentiation and promotes ATP synthesis, providing energy for rapid tumor cell proliferation. The mechanism of YTHDF2 in tumors is similar to that of METTL3, supporting tumor cell proliferation. As an m6A reader, YTHDF2 can reduce the expression of certain immune-related molecules, promoting immune evasion in tumor cells. NAT10 is a key enzyme involved in RNA ac4C modification. Through ac4C modification, it influences gene expression and, in turn, regulates biological behaviors such as cell proliferation, migration, and apoptosis.

[0024] Through high-throughput mRNA sequencing, the present invention proposed that the expression of YTHDF2, METTL3, and NAT10 in the bone marrow cells of MDS patients was higher than that in normal controls. qPCR was then used to confirm that the expression of the above genes in MDS patients was higher than that in normal controls. Therefore, the present invention proposes that YTHDF2, METTL3, and NAT10 can be used as ideal markers for screening high-risk MDS.

[0025] Compared with the prior art, the advantages and positive effects of the present invention are:

[0026] 1. The present invention provides the use of detecting the combined expression of YTHDF2, METTL3, and NAT10 genes in bone marrow cells of high-risk MDS patients as a specific molecular marker for screening high-risk myelodysplastic syndrome. By detecting the mRNA expression levels of YTHDF2, METTL3, and NAT10 genes, the present invention helps screen patients with high-risk myelodysplastic syndrome and better guides the treatment and prognosis assessment of patients with high-risk myelodysplastic syndrome.

[0027] 2. The present invention only requires the extraction of bone marrow fluid from patients, which is collected together with bone marrow cytology examination. Patient compliance is good, and the material is taken from human bone marrow fluid mononuclear cells, so the test results are more accurate and suitable for large-scale clinical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Comparison of RNA-Seq results between MDS patients and normal controls.

[0029] Figure 2 It indicates the results of qPCR verification of the differential expression of YTHDF2, METTL3, and NAT10 in MDS patients.

[0030] Figure 3 is the ROC curve. DETAILED DESCRIPTION

[0031] In order to more clearly understand the above-mentioned objects, features and advantages of the present invention, the present invention is further described below in conjunction with specific embodiments. It should be noted that, in the absence of conflict, the embodiments of the present application and the features therein can be combined with each other.

[0032] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways than those described herein. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0033] Example 1

[0034] In this example, total RNA was first extracted from bone marrow mononuclear cells (MONOCs) from patients with myelodysplastic syndrome (MDS) using TRIzol reagent. Quality control was then performed to determine RNA concentration and purity. An RNA library was constructed using a kit and quality controlled using an Agilent 2100 Bioanalyzer. qPCR was then performed to examine the expression of YTHDF2, METTL3, and NAT10 genes in the bone marrow mononuclear cells of MDS patients. The specific steps are as follows.

[0035] (1) Isolation of human bone marrow mononuclear cells

[0036] Bone marrow fluid was collected once from the patient (samples were obtained from the Department of Hematology, Qilu Hospital, Shandong University, with informed consent from the patient; size: 5 mL / tube, anticoagulated with EDTA). Mononuclear cells were isolated using Ficoll solution within 2 hours. Lymphocyte separation solution was pre-added to a 15 mL centrifuge tube at a 1:1 volume ratio of separation solution to blood. The bone marrow fluid was then slowly added to the separation solution and centrifuged at 400 × g for 30 minutes at room temperature. The buffy coat was carefully aspirated and added to 10 mL of PBS buffer. The tube was then centrifuged at 250 × g for 10 minutes at room temperature. The supernatant was discarded, and the cell pellet was washed twice, discarded, and added to TRIzol reagent for later use.

[0037] (2) RNA extraction

[0038] Total RNA was first extracted from the sample using TRIzol reagent. After adding TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) to the cell pellet, the lysis solution was pipetted until it was no longer sticky. The lysate was then transferred to a 1.5 mL RNase-free polypropylene tube. 200 μL of chloroform was added to the tube, and the tube was vigorously shaken for 15–30 seconds and placed on ice for 5 minutes. The tube was centrifuged at 12,000 g for 15 minutes at 4°C. The upper aqueous phase was aspirated to a new polypropylene tube, 500 μL of isopropanol was added, the mixture was mixed, and the tube was allowed to stand for 15 minutes. The tube was then centrifuged at 12,000 g for 15 minutes at 4°C. The supernatant was discarded, 1 mL of 75% ethanol was added, vortexed, and centrifuged at 9,000 g for 5 minutes at 4°C. The supernatant was discarded, the tube was briefly centrifuged, and the tube was dried under vacuum at room temperature for 5 minutes. Then dissolve the RNA in 20μL DEPC water; measure the concentration using NanoDrop and mark the sample; after measuring the RNA concentration, proceed to subsequent experiments or store it at -80°C (RNA storage method: add 0.1 times the volume of RNA to the RNA solution with 3M sodium acetate and 2 times the volume of RNA to the RNA solution, and store at -80°C).

[0039] (3) Ribosomal RNA (rRNA) was removed from total RNA using the GenSeq® rRNA Removal Kit (GenSeq, Inc., Shanghai, China). The ribosomal-removed RNA was fragmented to ~300 nt in length, and sequencing libraries were constructed using the GenSeq® Directional RNA Library Prep Kit (GenSeq, Inc., Shanghai, China). Finally, 150 bp paired-end sequencing was performed on a high-throughput sequencer.

[0040] The heatmap2 function of R was used to perform cluster analysis of differentially expressed mRNA using standardized counts. The horizontal axis represents sample clusters, and the color represents gene expression abundance. The darker the red, the more significant the gene upregulation, and the darker the blue, the more significant the gene downregulation ( Figure 1 After sequencing, it was found that YTHDF2, METTL3, and NAT10 genes were highly expressed in high-risk MDS patients (p<0.05), suggesting that they are related to the disease.

[0041] Example 2

[0042] To verify the high expression of YTHDF2, METTL3, and NAT10 genes in high-risk MDS patients, 27 MDS patients and 6 healthy controls were collected. 5 mL of bone marrow fluid was collected from each patient, and mRNA was extracted. cDNA synthesis and fluorescence quantitative PCR were then performed to detect the differential expression levels of YTHDF2, METTL3, and NAT10 genes in the patients. The specific steps are as follows.

[0043] (1) Isolation of human bone marrow mononuclear cells

[0044] Bone marrow fluid was collected from the patient once (samples were obtained from the Department of Hematology, Qilu Hospital, Shandong University, with informed consent, in 5 mL tubes, anticoagulated with EDTA). Within 2 hours, mononuclear cells were isolated using Ficoll solution. Lymphocyte separation buffer was pre-added to a 15 mL centrifuge tube at a 1:1 volume ratio of separation buffer to blood. The bone marrow fluid was then slowly added to the separation buffer and centrifuged at 400 × g for 30 minutes at room temperature. The buffy coat was carefully aspirated and added to 10 mL of PBS. The tubes were then centrifuged at 250 × g for 10 minutes at room temperature. The supernatant was discarded, and the cell pellet was washed twice, the supernatant discarded, and the cell pellet was added to TRIzol reagent for later use.

[0045] (2) RNA extraction

[0046] Total RNA was first extracted from the sample using TRIzol reagent. After adding TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) to the cell pellet, the lysis solution was pipetted until it was no longer sticky. The lysate was then transferred to a 1.5 mL RNase-free polypropylene tube. 200 μL of chloroform was added to the tube and the tube was vigorously shaken for 15–30 seconds. The tube was then incubated on ice for 5 minutes. The tube was centrifuged at 12,000 g for 15 minutes at 4°C. The upper aqueous phase was aspirated to a new polypropylene tube, 500 μL of isopropanol was added, the mixture was mixed, and the tube was incubated for 15 minutes. The tube was then centrifuged at 12,000 g for 15 minutes at 4°C. The supernatant was discarded, 1 mL of 75% ethanol was added, vortexed, and centrifuged at 9,000 g for 5 minutes at 4°C. The supernatant was discarded, the tube was briefly centrifuged, and the tube was dried under vacuum at room temperature for 5 minutes. Then dissolve the RNA in 20 μL of DEPC water; measure the concentration using NanoDrop and mark the RNA; after measuring the RNA concentration, proceed to subsequent experiments or store it at -80°C (RNA storage method: add 0.1 times the volume of RNA to the RNA solution with 3M sodium acetate and 2 times the volume of RNA to the RNA solution, and store at -80°C).

[0047] Use the TaKaRa kit (Product No. RR047A) for reverse transcription. Add all components to an RNase-free PCR tube on ice, mix thoroughly, and centrifuge briefly: PrimeScript RT Enzyme Mix I: 1.0 μL; RT Primer Mix *4: 1.0 μL; 5× PrimeScript Buffer: 24.0 μL; RNase-Free dH2O: 4.0 μL.

[0048] Reverse transcription procedure: Perform reverse transcription reaction on a PCR instrument according to the following reaction procedure: 37℃, 15min; 85℃, sec; 4℃, hold.

[0049] qPCR reaction system: TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×): 10 μL; PCR Forward Primer (10 μM): 0.8 μL; PCR Reverse Primer (10 μM): 0.8 μL; ROX Reference Dye or Dye II (50×)*3: 0.4 μL; Reaction solution (cDNA solution): 2 μL; Sterile water: 6 μL; Total 20 μL.

[0050] The primer sequences are as follows:

[0051] YTHDF2-F: 5'-CCTAGGTGGAGCCATGATTG-3',

[0052] YTHDF2-R: 5'-TCTGTGCTACCCAACTTCAGT-3'.

[0053] METTL3-F: 5'-TTGTCTCCAACCTTCCGTAGT-3',

[0054] METTL3-R: 5'-CCAGATCAGAGAGGTGGTGTAG-3'.

[0055] NAT10-F: 5'-GCCTCTTGTAAGAAGTGTCTCG-3',

[0056] NAT10-R: 5'-TCTTTTCAGAGATGCCCTCGAT-3'.

[0057] Internal reference gene: GAPDH-F: 5′-GGACCTGACCTGCCGTCTAG-3′;

[0058] GAPDH-R: 5'-GTAGCCCAGGATGCCCTTGA-3'.

[0059] qPCR amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 sec; annealing at 55°C for 20 sec; extension at 72°C for 20 sec, for 40 cycles.

[0060] The results of PCR amplification were automatically analyzed using a real-time fluorescence quantitative PCR instrument. The threshold and baseline were adjusted according to the negative control to determine the Ct value of each sample. After export, the relative quantitative method (2 ‐ΔΔ Ct) was used to quantify the expression difference of the target gene between myelodysplastic syndrome patients and healthy subjects. The calculation formula is as follows: △Ct = Ct 目的基因 -Ct 内参基因（GAPDH基因） , and then find the average value of △Ct of healthy people (△Ct 对照平均 ), each group uses △Ct-△Ct 对照平均 , calculate the △△Ct value, that is, △△Ct=△Ct 样本 -△Ct 对照平均 , and then calculate two groups of 2 -△△ The CT value is the relative expression level of the gene in each group. P < 0.05 was considered statistically significant.

[0061] The results are as follows Figure 2 As shown, from Figure 2It can be seen that the expression of YTHDF2, METTL3 and NAT10 in MDS patients was upregulated, which was significantly different from that in normal controls (P < 0.05).

[0062] The YTHDF2, METTL3, and NAT10 gene expressions of patients with high-risk myelodysplastic syndrome provided by the present invention were used as detection markers. The samples of the research subjects were tested according to the method described in Example 2. The results were as follows: Figure 3 As shown. Figure 3 It can be seen that the area under the curve of the kit of the present invention for diagnosing high-risk MDS is 0.938.

[0063] The present invention enriches the diagnostic and stratification indicators of high-risk myelodysplastic syndrome by proposing the use of YTHDF2, METTL3, and NAT10 genes as joint markers in the preparation of a screening kit for diagnosing or assisting in the diagnosis of high-risk myelodysplastic syndrome. The prepared kit can help quickly and accurately diagnose myelodysplastic syndrome and risk stratification, thereby improving diagnostic efficiency.

[0064] The above description is merely a preferred embodiment of the present invention and does not constitute any other form of limitation to the present invention. Any person skilled in the art may utilize the technical contents disclosed above to change or modify them into equivalent embodiments with equivalent changes for application in other fields. However, any simple modification, equivalent change, and modification of the above embodiments made in accordance with the technical essence of the present invention without departing from the technical solution of the present invention shall still fall within the scope of protection of the technical solution of the present invention.

Claims

1. Use of a reagent for specifically detecting the expression levels of YTHDF2, METTL3, and NAT10 genes in the preparation of a screening kit for diagnosing or assisting in the diagnosis of high-risk myelodysplastic syndrome, wherein the YTHDF2 gene sequence is shown in the sequence listing as SEQ ID NO: 1, the METTL3 gene sequence is shown in the sequence listing as SEQ ID NO: 2, and the NAT10 gene sequence is shown in the sequence listing as SEQ ID NO:

3.

2. The application according to claim 1, characterized in that: The kit also contains primers for specific amplification of YTHDF2, METTL3, and NAT10 genes, and the primer sequences are as follows: YTHDF2-F: CCTTAGGTGGAGCCATGATTG, YTHDF2-R:TCTGTGCTACCCAACTTCAGT; METTL3-F: TTGTCTCCAACCTTCCGTAGT, METTL3-R: CCAGATCAGAGAGGTGGTGTAG; NAT10-F:GCCTCTTGTAAGAAGTGTCTCG, NAT10-R:TCTTTTCAGAGATGCCCTCGAT; The internal reference sequence is as follows: GAPDH-F: 5'-GGACCTGACCTGCCGTCTAG-3'; GAPDH-R: 5'-GTAGCCCAGGATGCCCTTGA-3'.

3. The application according to claim 2, characterized in that: The kit detects the mRNA expression levels of YTHDF2, METTL3, and NAT10 genes in the subject's bone marrow mononuclear cells, and upregulation indicates a high risk of high-risk myelodysplastic syndrome.

Images