Infectious bovine rhinotracheitis virus gB monoclonal antibody with blocking effect and application thereof

Abstract

The invention relates to the technical field of biological detection, in particular to an infectious bovine rhinotracheitis virus gB monoclonal antibody with a blocking effect and application of the infectious bovine rhinotracheitis virus gB monoclonal antibody. The amino acid sequence of the variable region of the heavy chain of the infectious bovine rhinotracheitis virus gB monoclonal antibody is as shown in SEQ ID No.2. The amino acid sequence of the light chain variable region is as shown in SEQ ID No.4. The amino acid sequence of the heavy chain variable region is formed by coding a nucleotide sequence of the heavy chain variable region, and is as shown in SEQ ID No. 1; the amino acid sequence of the light chain variable region is formed by coding a nucleotide sequence of the light chain variable region, and is shown as SEQ ID No.3. The infectious bovine rhinotracheitis virus gB monoclonal antibody can specifically recognize the infectious bovine rhinotracheitis virus gB protein, and the infectious bovine rhinotracheitis virus neutralizing antibody in bovine serum can effectively block the reaction between the monoclonal antibody and the infectious bovine rhinotracheitis virus gB protein. The monoclonal antibody can be used for establishing an infectious bovine rhinotracheitis virus gB protein blocking ELISA antibody detection method. The invention relates to an infectious bovine rihinotracheitis virus gB monoclonal antibody and application thereof, which provide material support and technical support for development of detection and diagnosis technologies of infectious bovine rihinotracheitis in China and are beneficial to further promotion of purification of infectious bovine rihinotracheitis in China and improvement of culture benefits.

Description

Technical Field

[0001] This application relates to the technical field of biological detection, and specifically relates to a bovine infectious rhinotracheitis virus gB monoclonal antibody with a blocking effect and its application. Background Art

[0002] Infectious bovine rhinotracheitis (IBR) is a bovine respiratory infectious disease caused by bovine alphaherpesvirus 1 (BoAHV1) or infectious bovine rhinotracheitis virus (IBRV). Clinical symptoms include nasal tracheitis, dyspnea, runny nose, etc., and can also cause conjunctivitis, mastitis, genital tract infections, abortions, etc. The World Organization for Animal Health (OIE) lists IBR as a notifiable animal disease.

[0003] IBRV is an enveloped double-stranded DNA virus and an important member of the genus Varicellovirus in the subfamily Alphaherpesvirinae of the family Herpesviridae. It has a complex structure with icosahedral symmetry and is composed of a capsid, a core, and an envelope located on the surface of the virus particle. Eleven glycoproteins have been identified on the envelope of IBRV, including glycoprotein B (gB). In alphaherpesviruses, gB is a highly conserved glycoprotein and a protein essential for virus replication. The mature gB consists of 932 amino acids and 865 amino acids after removing the signal sequence. Previous studies have shown that the amino-terminal part of gB can bind to heparin, while the carboxyl group contains a fusion-related domain. The extracellular region of gB can induce humoral and cellular immune responses, causing infected cattle to produce a large number of neutralizing antibodies.

[0004] To evaluate the possibility of animals being infected with IBRV by detecting gB antibodies, common serological detection methods include serum neutralization test, latex agglutination test, enzyme-linked immunosorbent assay (ELISA), etc. ELISA has the advantages of simple operation, easy standardization, high sensitivity, and suitability for large-scale sample detection, and can be used to diagnose various diseases using milk, plasma, and serum samples. Summary of the Invention

[0005] The purpose of the present invention is to provide a bovine infectious rhinotracheitis virus gB monoclonal antibody with a blocking effect and its application to solve the problems existing in the above-mentioned prior art. The bovine infectious rhinotracheitis virus gB protein monoclonal antibody prepared by the present invention has the advantages of high specificity and high blocking activity, providing a solid foundation for the development of bovine infectious rhinotracheitis antibody detection technology in China.

[0006] In order to achieve the above purpose, the technical solutions adopted by the present invention are:

[0007] The present invention provides a bovine infectious rhinotracheitis virus gB monoclonal antibody with a blocking effect. The amino acid sequence of the heavy chain variable region of the bovine infectious rhinotracheitis virus gB monoclonal antibody is as shown in SEQ ID No.1; the amino acid sequence of the light chain variable region of the bovine infectious rhinotracheitis virus gB monoclonal antibody is as shown in SEQ ID No.3.

[0008] The present invention also provides a nucleic acid molecule, which comprises a nucleic acid sequence capable of encoding a monoclonal antibody against bovine infectious rhinotracheitis virus gB protein, wherein the nucleic acid sequence comprises an amino acid sequence which is the light chain variable region respectively; and an amino acid sequence which is the heavy chain variable region respectively.

[0009] The present invention further includes a vector, which comprises the above-mentioned nucleic acid molecule.

[0010] The present invention also provides a host cell, which comprises the above-mentioned nucleic acid molecule or the above-mentioned vector.

[0011] According to the second aspect of the present invention, a method for preparing the above-mentioned bovine infectious rhinotracheitis virus gB monoclonal antibody is provided, which is characterized by comprising vector construction of pCDNA3.1-IBRV gB, transfection of pCDNA3.1-IBRV gB into HEK293T cells, expression and purification of recombinant IBRV gB protein, culture of hybridoma cells and screening of bovine infectious rhinotracheitis virus gB monoclonal antibody.

[0012] Furthermore, the heavy chain of the bovine infectious rhinotracheitis virus gB monoclonal antibody is IgG1, and the light chain is Kappa.

[0013] The present invention also provides an application of the bovine infectious rhinotracheitis virus gB monoclonal antibody in preparing a bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method.

[0014] Furthermore, the bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method specifically includes: diluting the recombinant IBRV gB protein with carbonate buffer to 2 μg / mL, coating an ELISA plate at 100 μL / well, and incubating at 2 - 8 °C for 16 hours; discarding the solution in the wells and patting dry. Using phosphate buffer containing 5% sheep serum as the blocking solution, adding 200 μL per well, and incubating at 37 °C for 2 hours; discarding the solution in the wells and patting dry. Washing the plate once with the washing solution, patting dry on the absorbent material, adding the serum to be tested diluted 1:1, 100 μL per well, and incubating at 37 °C for 120 minutes. Discarding the liquid in the wells, washing the plate 5 times with the washing solution, 300 μL per well, and finally patting dry on the absorbent material; adding the HRP-labeled bovine infectious rhinotracheitis virus gB monoclonal antibody (1:8000), 100 μL per well, and incubating at 37 °C for 30 minutes. Discarding the liquid in the wells, washing the plate 5 times with the washing solution, 300 μL per well, and finally patting dry on the absorbent material; adding the substrate chromogenic solution, 100 μl per well, and developing color at 37 °C in the dark for 10 minutes; adding the stop solution, 50 μl per well; measuring the OD 450nm value.

[0015] Furthermore, the determination criterion for the bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method is as follows:

[0016] When the blocking rate (PB) of the serum sample to be tested ≥ 45%, the detection result of the bovine infectious rhinotracheitis virus gB antibody is judged as positive. When the blocking rate (PB) of the serum sample to be tested < 45%, the detection result of the bovine infectious rhinotracheitis virus gB antibody is judged as negative.

[0017] The present invention discloses the following technical effects:

[0018] The immunogen used in the present invention is the recombinant IBRV gB protein expressed in eukaryotes, which is similar in structure to the natural gB and is simple to prepare, having the advantage of making the antibody have better affinity.

[0019] The monoclonal antibody provided by the present invention can be efficiently blocked by the positive serum of bovine infectious rhinotracheitis virus antibody from binding to the recombinant IBRV gB protein in the blocking ELISA, indicating that the monoclonal antibody can be used to establish a bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method. It provides a solid foundation for the development of serological detection technology for bovine infectious rhinotracheitis in China.

[0020] The blocking ELISA established by the present invention, by detecting negative and positive samples, as well as positive sera of bovine viral diarrhea, bovine foot-and-mouth disease, bovine mycoplasma, and bovine brucellosis, shows that the method has good specificity and sensitivity.

[0021] The monoclonal antibody of the present invention is prepared by combining the hybridoma cell technology with the single cell preparation technology, and a monoclonal antibody with affinity that can bind to bovine infectious rhinotracheitis virus gB, does not bind to BVDV, FMDV, Mycoplasma bovis, or positive serum of Brucella bovis, and binds to bovine infectious rhinotracheitis virus gB is screened out. Using this monoclonal antibody, the antibody level of bovine serum immunized with IBRV vaccine can be detected. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Agarose gel electrophoresis pattern of the target fragment of bovine infectious rhinotracheitis virus gB

[0023] Figure 2 Western Blot pattern of pCDNA3.1-IBRV gB transfected into HEK293T cells

[0024] Figure 3 SDS-PAGE electrophoresis pattern of recombinant IBRV gB protein

[0025] Figure 4 Western Blot pattern of biotin-labeled recombinant IBRV gB protein; where 1-Marker, 2-biotin-labeled recombinant IBRV gB protein, 3-unlabeled recombinant IBRV gB protein.

[0026] Figure 5 SDS-PAGE electrophoresis pattern of purified monoclonal antibody of bovine infectious rhinotracheitis virus gB; where 1-Marker, 2-purified monoclonal antibody of bovine infectious rhinotracheitis virus gB. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0027] The principles and features of the present invention are described below through specific embodiments. However, the embodiments are exemplary only and do not limit the scope of the present invention in any way. Any simple modification, change, and equivalent transformation made to the embodiments according to the technical essence of the present invention still fall within the protection scope of the present invention.

[0028] The raw materials and equipment used in the present invention are all common raw materials and equipment in the art without special instructions; the methods used in the present invention are all conventional methods in the art without special instructions.

[0029] Example 1 Preparation of recombinant IBRV gB protein

[0030] 1 The pCDNA3.1 vector carries a 6×His tag, which is convenient for purification and identification. Construction of the pCDNA3.1-IBRV gB vector

[0031] 1.1 Design primers for PR amplification

[0032] gB-F: TTAAACTTAGCCACCATGGCCGCTCGCGGC;

[0033] gB-R: CTAATGGTGATGGTGATGATGGCGGAAGTAGCGCTT;

[0034] Template: Extract the IBRV genome from the cell culture medium containing bovine infectious rhinotracheitis virus according to the instructions of the TransGen virus DNA / RNA extraction kit as a template. Perform PCR amplification using Phanta Max Super-Fidelity DNA Polymerase, and recover the 2046 bp target fragment of bovine infectious rhinotracheitis virus gB by agarose gel electrophoresis after electrophoresis as Figure 1 shown.

[0035] 1.2 Ligation and transformation:

[0036] Recombine the bovine infectious rhinotracheitis virus gB fragment and the pCDNA3.1 vector using 2×Uniclone Seamless Cloning Mix, transform DH5α competent cells, pick several monoclonal colonies, culture them overnight, extract the plasmids, and send the positive plasmids for sequencing after identification.

[0037] 2 Transfection of HEK293T cells with pCDNA3.1-IBRV gB

[0038] Transfect 2.5 μg of the plasmid with completely correct sequencing results into HEK293T cells in a 6-well plate growing in a monolayer in a 37°C incubator. After 32 hours, discard the cell culture medium, add 5×SDS loading buffer to collect the samples. Identify the samples by Western Blot, and the results are as Figure 2 shown.

[0039] 3 Expression and purification of recombinant IBRV gB protein

[0040] Take a total of 20 10-cm cell culture dishes of HEK293T cells growing well in a monolayer, and transfer the recombinant plasmid into the cells according to the instructions of the Lipo293 TM transfection reagent of Beyotime. After culturing in a 37°C incubator for 32 hours, discard the cell supernatant, wash once with PBS, add 2 mL of PBS to each cell culture dish, scrape the cells on ice, and break them using an ultrasonic cell disruptor. Centrifuge at 4°C and 4000 r / min for 30 min, take the supernatant, purify it by nickel affinity chromatography, and identify it by SDS-PAGE as Figure 3 shown.

[0041] Example 2 Screening of hybridoma cells secreting monoclonal antibodies against bovine infectious rhinotracheitis virus gB

[0042] 1 Immunization of Balb / c mice

[0043] Take healthy 6-week-old female Balb / c mice and conduct routine immunization as shown in Table 1. Immunogen: recombinant IBRV gB protein. Blood was collected 7 days after the fourth immunization to separate serum and determine the serum titer.

[0044] Table 1 Results of serum titer determination of immunized mice

[0045]

[0046] 2 Cell fusion

[0047] According to the results of serum titer detection, select mice with ideal titers for cell fusion, and boost the immunization once 3 days before fusion, with an intraperitoneal injection of 200 μg / animal of the immunogen.

[0048] 2.1 sp2 / 0 cell culture and preparation

[0049] Prepare sp2 / 0 cells before the fusion experiment, with good growth status and vigorous division. Collect sp2 / 0 cells in a 50 mL sterile centrifuge tube, centrifuge at 1000 r / min for 5 min, discard the supernatant, and resuspend the cell pellet with RPMI-1640 medium. Repeat this operation 2 times, and then resuspend with 10 mL of RPMI-1640 medium.

[0050] 2.2 Feeder layer preparation

[0051] Take 1 blank mouse, sacrifice it by cervical dislocation, disinfect it with 75% alcohol, take peritoneal feeder cells in a biosafety cabinet, suspend them with HAT medium and inoculate them into a 96-well plate.

[0052] 2.3 Spleen cell preparation

[0053] Take the prepared immunized mice, collect blood from the orbital cavity, then sacrifice them by cervical dislocation and disinfect them with 75% alcohol. Centrifuge the whole blood of the mice at 4000 r / min for 10 min, take the supernatant as the positive control for screening hybridoma cells, and store it at -20 °C. Take the mouse spleen in a biosafety cabinet, wash the spleen 2 times with RPMI-1640 medium and grind it to fully separate the spleen. Filter the mouse spleen cell suspension through a 200-mesh cell sieve and transfer it to a 50 mL sterile centrifuge tube. Centrifuge at 1500 r / min for 10 min, discard the supernatant, repeat 2 times, and resuspend the cells with 10 mL of RPMI-1640 medium.

[0054] 2.4 Cell fusion

[0055] Mix the above-prepared mouse spleen cells and myeloma cells in a 50 mL centrifuge tube at a ratio of 10:1 - 5:1, centrifuge at 1500 r / min for 10 min, and discard the supernatant. Gently flick the centrifuge tube wall with your finger to loosen the cell pellet. Place the centrifuge tube in a 37 °C water bath, and then slowly add 800 μL of pre-warmed PEG 1450 to the cell pellet, and add 9 mL of pre-warmed RPMI-1640 medium within 5 min. After standing in the 37 °C water bath for 5 min, centrifuge at 800 r / min for 5 min, discard the supernatant, and loosen the cell pellet.

[0056] 2.5 Cell seeding and culture

[0057] Suspend the cells in 5 mL of HAT medium in the above cell pellet, add an appropriate amount of HAT medium, gently pipette to mix evenly, inoculate into a 96-well plate coated with feeder cells, and culture in an incubator at 37 °C with 5% carbon dioxide.

[0058] 3 Screening of hybridoma cells

[0059] 3.1 Labeling of recombinant IBRV gB protein

[0060] Biotin-label the above-purified recombinant IBRV gB protein according to the instructions of the biotin labeling kit, and test by Western Blot as Figure 4 shown.

[0061] 3.2 Preparation of cell samples for flow sorting

[0062] Take the above successfully fused hybridoma cells, resuspend them with RPMI-1640 medium, place them in a 15 mL centrifuge tube, centrifuge at 800 r / min for 10 min, discard the supernatant, wash twice according to the above steps with PBS, discard the supernatant, resuspend the cell pellet with 2 mL of PBS, count with a cell counting chamber, and add 1×10 6 cells into 0.5 mL of biotin-labeled gB protein, incubate on ice for 30 min, then centrifuge at 800 r / min for 5 min, discard the supernatant, wash 3 times with PBS, discard the supernatant. Resuspend the cells with 2 mL of PBS, add 1×10 6 cells into 0.5 mL of PE-labeled anti-biotin antibody, incubate on ice for 30 min, then centrifuge at 800 r / min for 5 min, discard the supernatant, wash 3 times with PBS, discard the supernatant. Resuspend the cell pellet with 2 mL of RPMI-1640 medium and place it on ice.

[0063] 3.3 Sorting of positive hybridoma cells

[0064] The prepared hybridoma cell-like cells were sorted for single positive hybridoma cells using a BD flow cytometer, and the single positive hybridoma cells were separately collected in a 96-well plate containing 2% penicillin-streptomycin-gentamicin HAT medium. After sorting, the 96-well plate was placed in an incubator at 37°C with 5% carbon dioxide for culture. After the cell wells were fully grown, the titer of the cell supernatant and the blocking effect were measured, and the results are shown in Table 2.

[0065] Table 2 Determination of the Activity of Hybridoma Cell Supernatant

[0066]

[0067] 4 Preparation of Ascites

[0068] The hybridoma cells (7G3) that had been screened by flow cytometry and had a blocking effect were used for ascites preparation. Each mouse was injected with 5×10 5 cells, and the ascites was collected after about 10 days.

[0069] 5 Purification of Ascites

[0070] Take 5 mL of ascites and centrifuge it at 4000 r / min for 10 min. Take the supernatant and purify the ascites through a protein A+G column. After dialysis, collect the purified antibody, measure the concentration, and test the purity by SDS-PAGE. The results are as Figure 5 shown. For titer determination, the coated antigen: recombinant IBRV gB protein was diluted at 2 μg / mL and coated overnight at 2 - 8°C. The blocking solution: PBS buffer containing 10% sheep serum, blocked at 37°C for 2 hours. The secondary antibody: HRP-labeled goat anti-mouse IgG diluted 1:5000. The coating solution: carbonate buffer (pH 9.0); the dilution solution: 0.01M phosphate buffer (pH 7.4). The results are shown in Table 3, and the titer reached 1:128000.

[0071] Table 3 Determination of the Titer of Purified Monoclonal Antibody

[0072]

[0073] Example 3 Verification of the Characteristics of Bovine Infectious Rhinotracheitis Virus gB Monoclonal Antibody

[0074] 1 Subtype Identification of Monoclonal Antibody

[0075] The mouse monoclonal antibody subclass identification kit from Sigma was used to analyze the subclass of the bovine infectious rhinotracheitis virus gB monoclonal antibody. According to the kit instructions, the cell culture supernatant was identified. The results showed that the heavy chain of the bovine infectious rhinotracheitis virus gB monoclonal antibody was IgG1 and the light chain was Kappa. The results are shown in Table 4.

[0076] Table 4 Subclass Identification

[0077]

[0078] Example 4 PCR Amplification and Sequence Determination of Variable Region Genes of Monoclonal Antibodies Against Bovine Infectious Rhinotracheitis Virus gB

[0079] Total RNA was extracted from hybridoma cells secreting monoclonal antibodies against bovine infectious rhinotracheitis virus gB by Trizol lysis method, and then cDNA was synthesized by reverse transcription. 10 pairs of degenerate primers were designed for amplification of variable region genes of monoclonal antibodies against bovine infectious rhinotracheitis virus gB, and 10 pairs of degenerate primers were designed for amplification of variable region genes of heavy chains of monoclonal antibodies against bovine infectious rhinotracheitis virus gB, as shown in Table 5 and Table 6. After amplification, agarose gel electrophoresis was carried out. The variable region gene fragments of heavy and light chains of monoclonal antibodies against bovine infectious rhinotracheitis virus gB were inserted into pMD-18T vector, and the recombinant plasmid was transferred into DH5α competent cells. Positive clones were selected for sequencing.

[0080] Table 5 Primer Sequences for Amplifying Variable Region of Heavy Chain

[0081]

[0082] Table 6 Primer Sequences for Amplifying Variable Region of Light Chain

[0083]

[0084] The sequencing results showed that the nucleotide sequence of the variable region of the heavy chain of the monoclonal antibody against bovine infectious rhinotracheitis virus gB was as shown in SEQ ID No.1;

[0085] The amino acid sequence of the variable region of the heavy chain of the monoclonal antibody against bovine infectious rhinotracheitis virus gB was as shown in SEQ ID No.2;

[0086] The nucleotide sequence of the variable region of the light chain of the monoclonal antibody against bovine infectious rhinotracheitis virus gB was as shown in SEQ ID No.3;

[0087] The amino acid sequence of the variable region of the light chain of the monoclonal antibody against bovine infectious rhinotracheitis virus gB was as shown in SEQ ID No.4.

[0088] Example 5 Establishment of a Blocking ELISA Antibody Detection Method for Bovine Infectious Rhinotracheitis Virus gB Protein

[0089] Dilute the recombinant IBRV gB protein to 2 μg / mL with carbonate buffer, coat an ELISA plate at 100 μL / well, and incubate at 2 - 8 °C for 16 hours; discard the solution in the wells and pat dry. Use phosphate buffer containing 5% sheep serum as the blocking solution, add 200 μL to each well, and incubate at 37 °C for 2 hours; discard the solution in the wells and pat dry. Wash the plate once with the washing solution, pat dry on the absorbent material, add the serum to be tested diluted 1:1, 100 μL per well, and incubate at 37 °C for 120 minutes. Discard the liquid in the wells, wash the plate 5 times with the washing solution, 300 μL per well, and pat dry on the absorbent material for the last time; add the HRP-labeled bovine infectious rhinotracheitis virus gB monoclonal antibody (1:8000), 100 μL per well, and incubate at 37 °C for 30 minutes. Discard the liquid in the wells, wash the plate 5 times with the washing solution, 300 μL per well, and pat dry on the absorbent material for the last time; add the substrate chromogenic solution, 100 μL per well, and develop color at 37 °C in the dark for 10 minutes; add the stop solution, 50 μL per well; measure the OD 450nm value.

[0090] The judgment criteria for the bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method are as follows:

[0091] When the blocking rate (PB) of the serum sample to be tested ≥ 45%, the detection result of the bovine infectious rhinotracheitis virus gB antibody is judged as positive. When the blocking rate (PB) of the serum sample to be tested < 45%, the detection result of the bovine infectious rhinotracheitis virus gB antibody is judged as negative.

[0092] Example 6 Performance test of the bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method

[0093] 1 Sensitivity test

[0094] Dilute the bovine infectious rhinotracheitis positive serum (neutralizing antibody titer 1:16) with PBS to 2-fold, 4-fold, 8-fold,..., 256-fold for detection, and calculate the blocking rate (PB) of the serum sample to be tested. The results show that when the bovine infectious rhinotracheitis positive serum is diluted 32-fold, the detection result of this blocking ELISA is positive; when diluted to 64-fold, the detection result is negative. The results are shown in Table 7.

[0095] Table 7 Results of the sensitivity test

[0096]

[0097] 2 Specificity test

[0098] Using the above-mentioned blocking ELISA antibody detection method for bovine infectious rhinotracheitis virus gB protein to detect bovine infectious rhinotracheitis negative serum, bovine viral diarrhea positive serum, bovine foot-and-mouth disease positive serum, bovine mycoplasma positive serum, bovine brucella positive serum, bovine mycobacterium positive serum, etc., to evaluate the specificity of the blocking ELISA antibody detection method of the present invention. The results showed that the above serum test results were all negative, and the results are shown in Table 8.

[0099] Table 8 Results of specificity test

[0100]

[0101] 3 Concordance test

[0102] Using the above-mentioned blocking ELISA antibody detection method for bovine infectious rhinotracheitis virus gB protein and serum neutralization test to detect 80 clinical bovine sera, and compare the concordance rate of the two methods. The results showed that the total concordance rate between blocking ELISA and serum neutralization test was 98.75%, and the results are shown in Table 9.

[0103] Table 9 Results of concordance test

[0104]

[0105] The above are only the preferred embodiments of the present invention, and do not limit the patent scope of the present invention accordingly. All equivalent structural transformations made under the inventive concept of the present invention by using the content of the specification and drawings of the present invention, or directly or indirectly applied in other related technical fields, are included in the patent protection scope of the present invention.

Claims

1. A bovine infectious rhinotracheitis virus gB monoclonal antibody, characterized in that, The amino acid sequence of the heavy chain of the bovine infectious rhinotracheitis virus gB monoclonal antibody is shown in Seq ID No.2, and the amino acid sequence of the light chain is shown in Seq ID No.

4.

2. The bovine infectious rhinotracheitis virus gB monoclonal antibody according to claim 1, characterized in that, The amino acid sequence of the heavy chain variable region is encoded by the nucleotide sequence of the heavy chain variable region, as shown in Seq ID No.1; the amino acid sequence of the light chain variable region is encoded by the nucleotide sequence of the light chain variable region, as shown in Seq ID No.

3.

3. A carrier, characterized in that, The vector includes the nucleic acid molecule described in claim 2.

4. A host cell, characterized in that, The host cell includes the nucleic acid molecule described in claim 2 or the vector described in claim 3.

5. A method for preparing a bovine infectious rhinotracheitis virus gB monoclonal antibody as described in any one of claims 1 or 2, characterized in that, It includes the construction of the vector pCDNA3.1, the transfection of pCDNA3.1-IBRV gB into HEK293T cells, the expression and purification of the recombinant IBRV gB protein, the culture of hybridoma cells and the screening of the bovine infectious rhinotracheitis virus gB monoclonal antibody.

6. The bovine infectious rhinotracheitis virus gB monoclonal antibody according to claim 1 or 2, characterized in that, The heavy chain of the bovine infectious rhinotracheitis virus gB monoclonal antibody is IgG1, and the light chain is Kappa.

7. Use of a bovine infectious rhinotracheitis virus gB monoclonal antibody according to claim 1 or 2 in the preparation of a bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method.

8. The detection method according to claim 7, wherein the recombinant IBRV gB protein is prepared as described in claim 5; the HRP-labeled monoclonal antibody is a monoclonal antibody obtained by purifying the ascites of the monoclonal antibody described in claim 5 and then performing HRP conjugation labeling.

9. The detection method according to claim 7, wherein the coating concentration of the recombinant IBRV gB protein is 2 μg / mL; the detection dilution of the HRP-labeled monoclonal antibody is 1:8000.

10. The bovine infectious rhinotracheitis virus gB protein blocking ELISA antibody detection method according to claim 7, wherein The judgment criterion is: When the blocking rate (PB) of the serum sample to be tested ≥ 45%, the detection result of the bovine infectious rhinotracheitis virus gB antibody is judged as positive. When the blocking rate (PB) of the serum sample to be tested < 45%, the detection result of the bovine infectious rhinotracheitis virus gB antibody is judged as negative.

Images