Recombinant escherichia coli for producing ergothioneine and application thereof
By heterologously expressing ergothionein synthetic protein in E. coli BL21 (DE3) and modifying metabolic pathways, the problem of low biosynthetic ergothionein production is solved, and efficient ergothionein production is achieved, which is suitable for industrial applications.
Patent Information
- Application Number
- CN202510590104.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-07-18
AI Technical Summary
In the prior art, the yield of biosynthetic ergothione is relatively low, and the supply of precursors required for synthesis during fermentation is difficult, making it difficult to achieve large-scale industrial production.
E. coli BL21 (DE3) is used as the chassis strain to heterologously express the genes egtD, egtE, egt1T and their combinations of ergothionine synthetic proteins, and the metabolic pathway of ergothionine synthesis precursors is modified, including knocking out sdaA in the cysteine metabolic pathway and metJ or thrB in the methionine metabolic pathway to optimize the ergothionine synthesis pathway.
The production of ergothionine has been significantly improved, with the fermentation output of shake flasks up to 250 mg/L, and the output in the 3 L fermentation tank reaches 1.81 g/L, which has the potential for industrial production.
Smart Images
Figure CN120330117A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of synthetic biology, and particularly relates to a recombinant Escherichia coli producing ergothioneine and its application. Background Art
[0002] Ergothioneine (EGT), 2-mercapto-L-histidine trimethyl inner salt, is a natural amino acid derivative and a thiol compound derived from histidine. Ergothioneine was first discovered in 1909 in a kind of ergot fungus Clavicepspurpurea It can be stably present in physiological pH value and strong alkaline solution without self-oxidation. Ergothioneine has strong antioxidant effects. It can chelate metal ions that promote the reaction of H2O2, thereby reducing the pathways for generating ROS. Moreover, ergothioneine can improve the stability of other antioxidant substances and play a synergistic role in vivo. In addition, ergothioneine also has various biological activities such as anti-inflammatory effects, immunomodulatory effects, and ultraviolet protection effects.
[0003] Traditional methods for producing ergothioneine are mainly obtained by extracting from raw materials such as the fruiting bodies of edible fungi that can naturally synthesize ergothioneine. The problems are that the content of the extract is low, and there are impurities and agricultural residues, making it difficult to achieve large-scale industrial production. The purity of ergothioneine synthesized by chemical synthesis method is high, but it has disadvantages such as high cost, great difficulty, and difficult to guarantee product safety. Therefore, the production of ergothioneine by biosynthesis method has received wide attention. Ergothioneine produced based on synthetic biology methods has a series of advantages such as high synthesis efficiency, good selectivity, high purity, and low cost.
[0004] Existing studies have confirmed the feasibility of constructing ergothioneine engineering bacteria to produce ergothioneine through metabolic engineering methods. However, ergothioneine has synthetic pathways from various different sources. Therefore, it is necessary to optimize and combine different ergothioneine synthetic pathways to construct an efficient synthetic pathway. On this basis, it is also necessary to regulate, optimize, and reconstruct the entire metabolic network to ensure sufficient supply of precursors required for ergothioneine synthesis and achieve efficient synthesis of ergothioneine. Summary of the Invention
[0005] The present invention aims to overcome the problems in the prior art that the yield of biosynthetic ergothioneine is relatively low and it is easy to have difficulties in supplying precursors required for synthesis during the fermentation process, and provides a recombinant Escherichia coli producing ergothioneine and its application to overcome the above defects.
[0006] To achieve the purpose of the above invention, the present invention is realized through the following technical solutions: In a first aspect, the present invention discloses a recombinant Escherichia coli producing ergothioneine, which uses Escherichia coli BL21(DE3) as a chassis strain and heterologously expresses one or more of the following genes in the chassis bacterium: (1) Mycolicibacteriumsmegmatis The ergothioneine synthase protein-encoding gene derived from egtD ; (2) Mycolicibacteriumsmegmatis The ergothioneine synthase protein-encoding gene derived from egtE ; (3) Neurosporacrassa The coding gene of histidylcysteine sulfoxide synthase protein only retained, derived from egt1 T 。
[0007] The sequence of the ergothioneine synthase protein-encoding gene egtD is shown in SEQ ID NO.1, and the sequence of the ergothioneine synthase protein-encoding gene egtE is shown in SEQ ID NO.2, and the sequence of the ergothioneine synthase protein-encoding gene egt1 T is shown in SEQ ID NO.3.
[0008] Furthermore, the recombinant Escherichia coli also heterologously expresses one or more of the following genes in the chassis bacterium: (1) Methylobacteriumpseudosasicola The ergothioneine synthase protein-encoding gene derived from egtB ; (2) Neurosporacrassa The ergothioneine synthase protein-encoding gene derived from egt1 ; (3) Neurosporacrassa The ergothioneine synthase protein-encoding gene derived from egt2 。
[0009] The sequence of the ergothioneine synthase protein-encoding gene egt1 is shown in SEQ ID NO.4, and the sequence of the ergothioneine synthase protein-encoding gene egt2 is shown in SEQ ID NO.5, and the sequence of the ergothioneine synthase protein-encoding gene egtB is shown in SEQ ID NO.6.
[0010] Furthermore, the expression vector of the recombinant Escherichia coli includes plasmid pET28a.
[0011] Furthermore, the metabolic pathway of the ergothioneine synthesis precursor in the chassis strain is modified in the recombinant Escherichia coli, and the ergothioneine synthesis precursor is at least one of cysteine and S-adenosylmethionine.
[0012] Furthermore, in the recombinant Escherichia coli, the gene encoding bypass serine deaminase in the cysteine metabolic pathway was knocked out in the chassis bacterium. sdaA The gene encoding serine deaminase sdaA has the sequence shown in SEQ ID NO.7.
[0013] Furthermore, in the recombinant Escherichia coli, at least one of the genes encoding DNA-binding transcriptional repressor and the gene encoding homoserine kinase in the methionine metabolic pathway was knocked out in the chassis bacterium. metJ , the gene encoding homoserine kinase thrB . The sequence of the gene encoding DNA-binding transcriptional repressor metJ is shown in SEQ ID NO.8, and the sequence of the gene encoding homoserine kinase thrB is shown in SEQ ID NO.9.
[0014] In the second aspect, the present invention also discloses the application of the above-mentioned recombinant Escherichia coli producing ergothioneine in the preparation of ergothioneine or products containing ergothioneine.
[0015] In the third aspect, the present invention also discloses a method for fermentatively producing ergothioneine, which includes the following steps: fermenting and culturing the above-mentioned recombinant Escherichia coli producing ergothioneine in a fermentation medium to obtain a fermentation broth containing ergothioneine.
[0016] Furthermore, the temperature of the fermentation culture is 24 - 37 °C, and lactose or IPTG is added to the fermentation medium for subsequent culture after 6 - 8 h of fermentation culture.
[0017] Furthermore, the fermentation medium includes glycerol, peptone, yeast powder, Na2HPO4·12H2O, KH2PO4, NH4Cl, Na2SO4, MgSO4·7H2O. In practice, when the glycerol in the medium is exhausted, feeding medium is used for feeding, and the feeding medium includes 300 - 400 g / L of glycerol.
[0018] Therefore, the present invention has the following beneficial effects: (1) The present invention uses Escherichia coli BL21(DE3) as the chassis strain, and imports the ergothioneine synthesis protein coding genes from different sources into the chassis cells through plasmid vectors for heterologous expression, providing a new type of ergothioneine engineering bacterium with considerable yield; (2) On the basis of heterologously expressing the ergothioneine synthesis protein coding genes, the present invention modifies the metabolic pathway of Escherichia coli, further improving the yield of ergothioneine, and having good application prospects for de novo synthesis and production of ergothioneine. Description of the Drawings
[0019] Figure 1Schematic diagram of ergothioneine production by recombinant Escherichia coli in shake flasks in Examples 1 to 3.
[0020] Figure 2 Schematic diagram of the growth curve and ergothioneine production at different time points during fed-batch fermentation of recombinant Escherichia coli E1 in a 3-L fermenter.
[0021] Figure 3 Schematic diagram of the growth curve and ergothioneine production at different time points during fed-batch fermentation of recombinant Escherichia coli E5 in a 3-L fermenter.
[0022] Figure 4 HPLC detection result chart of ergothioneine synthesized by recombinant Escherichia coli E5. Detailed implementation manners
[0023] The present invention will be further described below in conjunction with specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following descriptions are usually only a part of the embodiments of the present invention, rather than all the embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments of the present invention shall fall within the scope of protection of the present invention. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The test materials used in the following embodiments are all conventional biochemical reagents unless otherwise specified.
[0024] Escherichia coli DH5α involved in the following embodiments was purchased from Sangon Biotech (Shanghai) Co., Ltd. Escherichia coli BL21(DE3), Escherichia coli DH5α(pET28a), Escherichia coli DH5α(pDXW-T7- egtD1 T E ),Escherichia coli DH5α(pDXW-T7- egtDBE ),Escherichia coli DH5α(pDXW-T7- egt12 ) are strains preserved in the laboratory.
[0025] The culture media involved in the following embodiments: LB liquid medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L; LB solid medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar powder 18 g / L; Fermentation medium: yeast powder 10 - 14 g / L, peptone 12 - 18 g / L, glycerol 8 - 12 g / L, Na2HPO4·12H2O 8 - 10 g / L, KH2PO4 2 - 4 g / L, NH4Cl 2 - 3 g / L, Na2SO4 0.5 - 1 g / L, MgSO4·7H2O 0.2 - 0.5 g / L.
[0026] In subsequent examples of the present invention, the ergothioneine synthase protein - coding gene was overexpressed in the chassis strain through a plasmid vector egtD 、 egtE 、 egt1 T combination to obtain engineering strain E1; the ergothioneine synthase protein - coding gene egt1 、 egt2 was overexpressed to obtain engineering strain E2; the ergothioneine synthase protein - coding gene egtD 、 egtE 、 egt1 T and egtB were overexpressed to obtain engineering strain E3; the ergothioneine synthase protein - coding gene egtD 、 egtE 、 egt1 T and egt2 were overexpressed to obtain engineering strain E4.
[0027] Example 1: Construction of recombinant Escherichia coli E1 and E2: The plasmid of Escherichia coli DH5α(pET28a), Escherichia coli DH5α(pDXW - T7 - egtD1 T E ), Escherichia coli DH5α(pDXW - T7 - egt12 ) was extracted using a plasmid extraction kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.), namely plasmid pET28a, plasmid pDXW - T7 - egtD1 T E , plasmid pDXW - T7 - egt12 . Using plasmid pET28a as a template, inverse PCR amplification was performed with primers pET28a - F and pET28a - R to obtain and purify the vector linear fragment; using plasmid pDXW - T7 - egtD1 T E , plasmid pDXW - T7 - egt12Using [template] as a template, PCR amplification was performed with primers T7-F and T7-R to obtain the target gene fragment and purified it. The target gene fragment was ligated to the linear vector using the one-step cloning method and transformed into competent Escherichia coli DH5α cells. The transformed product was spread on LB solid medium containing kanamycin and cultured in a constant temperature incubator at 37°C for 12 - 16 h. Transformants were picked for colony PCR verification. The transformants with correct verification were transferred to LB liquid medium containing kanamycin and cultured overnight. After plasmid extraction, sequencing verification was performed to obtain plasmid pET28a-T7- egtD1 T E and plasmid pET28a-T7- egt12 .
[0028] Plasmid pET28a-T7- egtD1 T E and plasmid pET28a-T7- egt12 were transformed into competent Escherichia coli BL21(DE3) cells. The transformed product was spread on LB solid medium containing kanamycin and cultured in a constant temperature incubator at 37°C for 12 - 16 h. The obtained transformants were the recombinant Escherichia coli E1 and E2. The primer sequences in Example 1 are shown in Table 1.
[0029] Table 1: Primer sequence table of Example 1 Primer Sequence 5’→3’ pET28a-F GGGGTTTTTTGCTGAAAGGAGGAACTATATCCG pET28a-R ATAGTGAGTCGTATTAATTTCGCGGGATCGAGATC T7-F CCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGG T7-R CTCCTTTCAGCAAAAAACCCCTCAAGACCCG Example 2: Construction of recombinant Escherichia coli E3 and E4 Plasmids pET28a, plasmid pDXW-T7- egtDBE ), plasmid pDXW-T7- egt12 ) were extracted from Escherichia coli DH5α(pET28a), Escherichia coli DH5α(pDXW-T7- egtDBE and plasmid pDXW-T7- egt12 . Using plasmid pET28a as a template, inverse PCR amplification was performed with primers pET28a-T7-F and pET28a-T7-R to obtain the vector linear fragment and purified it; using plasmid pDXW-T7- egtDBE and plasmid pDXW-T7- egt12Using [template], PCR amplification was performed with primers EgtB-F and EgtB-R, Egt2-F and Egt2-R to obtain the target gene fragment and purified. The target gene fragment was ligated to the linear vector using the one-step cloning method, and then transformed into competent Escherichia coli DH5α cells. The transformed products were spread on LB solid medium containing kanamycin and cultured in a 37°C constant temperature incubator for 12 - 16 h. Transformants were picked for colony PCR verification. The correctly verified transformants were transferred to LB liquid medium containing kanamycin, cultured overnight, and then the plasmids were extracted and verified by sequencing to obtain plasmid pET28a-T7- egtB and plasmid pET28a-T7- egt2 .
[0030] Extract plasmid pET28a-T7- egtD1 T E ) from Escherichia coli DH5α(pET28a-T7- egtD1 T E . Using plasmid pET28a-T7- egtD1 T E as the template, inverse PCR amplification was performed with primers egtD1 T E-F and egtD1 T E-R to obtain the linear vector fragment and purified; using plasmid pET28a-T7- egtB and plasmid pET28a-T7- egt2 as the template, PCR amplification was performed with primers T7-egt-F and T7-egt-R to obtain the target gene fragment and purified. The target gene fragment was ligated to the linear vector using the one-step cloning method, and then transformed into competent Escherichia coli DH5α cells. The transformed products were spread on LB solid medium containing kanamycin and cultured in a 37°C constant temperature incubator for 12 - 16 h. Transformants were picked for colony PCR verification. The correctly verified transformants were transferred to LB liquid medium containing kanamycin, cultured overnight, and then the plasmids were extracted and verified by sequencing to obtain plasmid pET28a-T7- egtD1 T E -T7- egtB and plasmid pET28a-T7- egtD1 T E -T7- egt2 .
[0031] Transfer plasmid pET28a-T7- egtD1 T E -T7- egtB, plasmid pET28a-T7- egtD1 T E -T7- egt2 was transformed into competent Escherichia coli BL21(DE3) cells. The transformed product was spread on an LB solid medium containing kanamycin and cultured in a constant temperature incubator at 37 °C for 12 - 16 h. The obtained transformants were recombinant Escherichia coli E3 and E4. The primer sequences in Example 2 are shown in Table 2.
[0032] Table 2: Primer Sequence Table in Example 2 Primer Sequence 5’→3’ pET28a-T7-F GTCGGGATCGTCAGACATGTCCCCTAGCATAAC pET28a-T7-R GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG EgtB-F GTTTAACTTTAAGAAGGAGATATACCATGGCAGCAACCGCAGCACTG EgtB-R GACATGTCTGACGATCCCGACTTAAGCGACATCTGCCAGAC Egt2-F GTTTAACTTTAAGAAGGAGATATACCATGGTGGCAACCACCGTGGAAC Egt2-R GACATGTCTGACGATCCCGACTTATGCGGATTCCTTGTATTCG <![CDATA[egtD1 T E-F]]> CTTGAGGGGTTTTTTGATTGGCGAATGGGACGC <![CDATA[egtD1 T E-R]]> CCCTATAGTGAGTCGTATTACCGGATATAGTTCCTCCTTTC T7-egt-F CTATATCCGGTAATACGACTCACTATAGGGGAATTGTGAGCGG T7-egt-R CATTCGCCAATCAAAAAACCCCTCAAGACCCGTTTAG Yield tests were conducted on the engineered bacteria obtained in Example 1 and Example 2: The recombinant Escherichia coli engineering strains in Examples 1 - 3 stored at -80 °C were streaked on an LB solid medium and cultured overnight at 37 °C, and then passaged and activated once. Single colonies were picked from this fresh plate and inoculated into a 250 mL shake flask containing 50 mL of LB liquid medium, and cultured at 37 °C and 200 rpm for 12 h as the seed solution. The seed solution was inoculated into a 500 mL baffled shake flask containing 100 mL of fermentation medium at an inoculation amount of 1%, and cultured at 37 °C and 200 rpm. After culturing for 2 - 3 h, IPTG was added for induction, and cultured at 24 °C and 200 rpm. After culturing for 72 h, the fermentation broth was centrifuged to obtain the supernatant, and the ergothioneine content was detected by a high performance liquid chromatograph. The detection results are as Figure 1 shown. Among the engineering strains E1, E2, E3, and E4, the engineering strain E1 had the highest yield of ergothioneine in shake flask fermentation, which was 199 mg / L.
[0033] Example 3: Modification of the precursor metabolic pathway for synthesizing ergothioneine: Based on the engineering strain E1, the metabolic pathway of the ergothioneine synthesis precursor in the chassis strain was modified. The serine deaminase encoding gene sdaA was knocked out, and the ergothioneine synthesis protein encoding genes egtD , egtE , egt1 T were overexpressed in combination to obtain the engineering strain E5; the homoserine kinase encoding gene thrB was knocked out, and the ergothioneine synthesis protein encoding genes egtD , egtE , egt1 T were overexpressed in combination to obtain the engineering strain E6; the DNA-binding transcriptional repressor encoding gene in the methionine metabolic pathway metJ was knocked out, and the ergothioneine synthesis protein encoding genes egtD , egtE ,egt1 T Combine to obtain the engineered strain E7. The Escherichia coli BL21(DE3) was modified using the Red homologous recombination technique.
[0034] Using plasmid pKD3 (the sequence is shown in SEQ ID NO.10) as a template, and sdaA-F and sdaA-R, metJ-F and metJ-R, thrB-F and thrB-R as primers, the gene targeting fragment was amplified. The gene targeting fragment was electrotransformed into the competent cells of Escherichia coli BL21(DE3) carrying plasmid pKD46 using an electroporator (Bio-Rad) for homologous recombination knockout. The successfully knocked-out Escherichia coli BL21(DE3) was prepared into competent cells, and the expression plasmid pDXW-T7- egtD1 T E transformed into Escherichia coli BL21(DE3) knockout sdaA 、 thrB 、 metJ competent cells, and the transformants obtained were the recombinant Escherichia coli E5, E6, and E7. The primer sequences used in Example 3 are shown in Table 3.
[0035] Table 3: Primer sequence table for Example 3 Primer Sequence 5’→3’ sdaA-F TGTTATTAGTTCGTTACTGGAAGTCCAGTCACCTTGTCAGGAGTATTATCCATGGTCCATATGAATATCCTCCTT sdaA-R AAAACCGCCGCCGATGGAATAATAAGTTTTGCTGTAGACGACTTCATCGCGTGTAGGCTGGAGCTGCTTC metJ-F CAACTGTGTGGTCTGGTCTCAATTTATTGACGAAGAGGATTAAGTATCTCCATGGTCCATATGAATATCCTCCTT metJ-R GATAAGCGTAGCGCATCAGGCGATTCCACTCCGCGCCGCTCTTTTTTGCTGTGTAGGCTGGAGCTGCTTC thrB-F TGTCTTTGCCGATCTGCTACGTACCCTCTCATGGAAGTTAGGAGTCTGACCATGGTCCATATGAATATCCTCCTT thrB-R ACCACCAAGAAAACACGGTGCCACGTTGTCGTAATGAATGCTGCCGGAGAGTGTAGGCTGGAGCTGCTTC Perform a yield test on the engineered bacteria obtained in Example 3: Streak the recombinant Escherichia coli engineered strain from Example 3 stored at -80 °C on an LB solid medium and culture it overnight at 37 °C, and passage and activate it once. Pick a single colony from this fresh plate and inoculate it into a 250 mL flask containing 50 mL of LB liquid medium, and culture it at 37 °C and 200 rpm for 12 h as the seed solution. Inoculate the seed solution into a 500 mL baffled flask containing 100 mL of fermentation medium at an inoculation amount of 1%, and culture it at 37 °C and 200 rpm. After culturing for 2 - 3 h, add IPTG for induction and culture it at 24 °C and 200 rpm. After culturing for 72 h, take the fermentation broth, centrifuge to obtain the supernatant, and detect the ergothioneine content by high performance liquid chromatography. The detection results are as Figure 1 shown, among which the engineered strain E5 has the highest yield of ergothioneine in shake flask fermentation, reaching 250 mg / L at 72 h of shake flask culture, and it can be seen that on the basis of the engineered strain E1, knocking out the bypass serine deaminase encoding gene sdaA gene in the cysteine metabolic pathway can further improve the yield of ergothioneine.
[0036] Example 4: Fed-batch culture of the recombinant Escherichia coli engineered strain in a 3 L fermenter The recombinant Escherichia coli engineering strains E1 and E5 stored at -80°C were streaked on LB solid medium respectively, cultured overnight at 37°C, and subcultured and activated once. Single colonies were picked from this fresh plate and inoculated into 250 mL flasks containing 50 mL of LB liquid medium, and cultured at 37°C and 200 rpm for 12 h to obtain the primary seed solution. The primary seed solution was inoculated into 250 mL flasks containing 50 mL of LB liquid medium at an inoculation amount of 2%, and cultured at 37°C and 200 rpm for 4 h to obtain the secondary seed solution.
[0037] The liquid volume in the 3 L fermenter was 1 L of fermentation medium. Besides the medium components, 1 mL of antifoaming agent was added. Kanamycin at 50 mg / mL was additionally added to the medium. The secondary seed solution was inoculated into the 3 L fermenter at an inoculation amount of 5%. The initial culture temperature was set at 37°C, and the temperature was gradually decreased after 2 h, and decreased to 24°C and maintained at 6 h. Glycerol feeding was added at 5 h of culture; at 7 h of culture, when the OD 600 reached 15 - 20, lactose was added for induction. During the culture process, ammonia water was used to maintain the pH between 6.0 - 7.0.
[0038] Lactose was fed in a feeding manner at a rate of 20 - 25 mL / h for 10 h, and the final lactose feeding amount was 60 - 80 g.
[0039] During the culture process, samples were taken and stored at different time points, and the OD 600 values at different time points were measured by an ultraviolet spectrophotometer, and the ergothioneine concentration was detected by liquid chromatography. The results of the engineering strain E1 are as Figure 2 shown, and the results of the engineering strain E5 are as Figure 3 shown. It can be seen that after culturing the recombinant Escherichia coli engineering strains E1 or E5 for 90 h, 1.87 g / L and 1.81 g / L of ergothioneine were synthesized de novo, which is beneficial to the industrial production and large-scale application of ergothioneine.
[0040] The recombinant Escherichia coli E5 was detected by HPLC, and the detection results are as Figure 4 shown. In the figure, Figure A is the ergothioneine standard product, and Figure B is the fermentation broth sample. It can be seen that there are no significant shoulder peaks or impurity peaks in the fermentation broth sample, which can prove that the engineering strain E5 successfully produced ergothioneine with a relatively high purity.
[0041] Finally, it should be noted that the above experiments and examples are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A recombinant Escherichia coli producing ergothioneine, characterized in that: The recombinant Escherichia coli uses Escherichia coli BL21(DE3) as the chassis strain, and heterologously expresses one or more of the following genes in the chassis bacterium: (1) Mycolicibacterium smegmatis Ergothioneine synthase protein-encoding gene from egtD ; (2) Mycolicibacterium smegmatis Ergothioneine-synthesizing protein-encoding gene from egtE ; (3) Neurospora crassa The coding gene of the histidylcysteine sulfoxide synthase protein only from the source egt1 T .
2. The recombinant Escherichia coli producing ergothioneine according to claim 1, wherein: The recombinant Escherichia coli also heterologously expresses one or more of the following genes on the chassis bacterium: (1) Methylobacterium pseudosasicola The ergothioneine synthetic protein-encoding gene from egtB ; (2) Neurospora crassa Ergothioneine synthetic protein-encoding gene from egt1 ; (3) Neurospora crassa The ergothioneine-synthesizing protein-coding gene from egt2 .
3. A recombinant Escherichia coli producing ergothioneine according to claim 1 or 2, characterized in that: The expression vector of the recombinant Escherichia coli includes plasmid pET28a.
4. A recombinant Escherichia coli producing ergothioneine according to claim 1, characterized in that: In the recombinant Escherichia coli, the metabolic pathway of the ergothioneine synthesis precursor in the chassis strain is modified, and the ergothioneine synthesis precursor is at least one of cysteine and S-adenosylmethionine.
5. A recombinant Escherichia coli producing ergothioneine according to claim 4, characterized in that: The bypass serine deaminase-encoding gene in the cysteine metabolic pathway has been knocked out in the chassis bacteria of the recombinant Escherichia coli sdaA .
6. The recombinant Escherichia coli for producing ergothioneine according to claim 4, characterized in that: The recombinant Escherichia coli has knocked out at least one of the DNA-binding transcriptional repressor-encoding gene and homoserine kinase-encoding gene in the methionine metabolic pathway in the chassis bacterium. metJ , homoserine kinase-encoding gene thrB in the methionine metabolic pathway in the chassis bacterium.
7. Use of the recombinant Escherichia coli producing ergothioneine according to any one of claims 1 to 6 in the preparation of ergothioneine or a product containing ergothioneine.
8. A method for fermentatively producing ergothioneine, characterized in that, Comprising the following steps: Ferment and culture the recombinant Escherichia coli producing ergothioneine according to any one of claims 1 to 6 in a fermentation medium to obtain a fermentation broth containing ergothioneine.
9. A method for fermentatively producing ergothioneine according to claim 8, characterized in that: The temperature of the fermentation culture is 24-37 °C, and lactose or IPTG is added to the fermentation medium for subsequent culture after 6-8 h of fermentation culture.
10. A method for fermenting and producing ergothioneine according to claim 8, characterized in that: The fermentation medium includes glycerol, peptone, yeast powder, Na2HPO4·12H2O, KH2PO4, NH4Cl, Na2SO4, MgSO4·7H2O.