Rhizobium mutant and application thereof

Abstract

The invention relates to the technical field of microorganisms, and provides a rhizobium mutant and application thereof, the rhizobium mutant is HH103 delta nuo, and is a mutant obtained by taking sinorhizobium fredii (sinorhizobium fredii) HH103 as a starting strain and performing gene knockout on a nuo control unit in an NADH oxidoreductase subunit I of the sinorhizobium fredii HH103. When the HH103 delta nuo is inoculated in the soybean seedling stage, the plant shows that the leaves are darker green, the plant biomass is up-regulated, the nitrogenase activity of a single plant is obviously higher than that of a wild type strain, and the plant height is integrally increased, so that the HH103 delta nuo improves the symbiotic effect of the rhizobium and the soybean.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a rhizobium mutant and its application. Background Art

[0002] The symbiotic nitrogen fixation process is a highly complex physiological activity that requires strict metabolic balance of rhizobia. During this process, rhizobia need to undergo a series of metabolic changes to maintain the intracellular redox balance. The catalytic reduction reaction of N2 has one of the highest energy barriers in biology and requires a large amount of reducing chemical energy and complex metal cofactors to complete this process. Among them, carbon storage is an important regulatory method, and rhizobia will store excess carbon in the form of poly-β-hydroxybutyrate (PHB), lipids or glycogen. These storage substances are not only energy reservoirs but also play a key role in maintaining redox homeostasis.

[0003] The degradation products of PHB participate in the supply of respiratory chain substrates, enabling the respiratory chain to continuously operate to generate energy. At the same time, the ATP generated by the respiratory chain can provide energy support for the synthesis of PHB, forming a dynamic balance and cooperative mechanism of energy metabolism. There are two different respiratory chain NADH dehydrogenase protein complexes in Bradyrhizobium japonicum. One exists in the cell membrane of free-living rhizobia, and the other only exists in bacteroids. Transcriptome data analysis of Bradyrhizobium japonicum NGR234 found that the gene for the synthesis of this respiratory chain NADH dehydrogenase protein complex was highly up-regulated during the symbiotic period. The applicant's research found that: similar to NGR234, the HH103 genome also contains two NADH dehydrogenase synthesis gene clusters, in which nuoh3 (SFHH103_02097) and nuoi3 (SFHH103_02097) together form a transcription unit, participate in the synthesis of NADH dehydrogenase subunit 1, and are homologous to the up-regulated genes of the NADH dehydrogenase cluster in NGR234 bacteroids. Therefore, the regulation and modification of the NADH dehydrogenase subunit 1 gene are expected to optimize the electron transfer efficiency of rhizobia and enhance the symbiotic nitrogen fixation efficiency with leguminous plants such as soybeans. Summary of the Invention

[0004] In view of this, the present invention proposes a rhizobium mutant that can improve the symbiotic effect between rhizobia and soybeans and its application.

[0005] The technical solution of the present invention is realized as follows: In the first aspect, the present invention provides a rhizobium mutant, which is HH103Δnuo, a mutant obtained by knocking out the nuo operon in the NADH oxidoreductase subunit I of Sinorhizobium fredii HH103 using Sinorhizobium fredii HH103 as the starting strain.

[0006] Based on the above technical solutions, preferably, the nucleotide sequence of the nuo manipulation unit is as shown in SEQ ID No. 1.

[0007] Based on the above technical solutions, preferably, the nucleotide sequence of HH103Δnuo is as shown in SEQ ID No. 2.

[0008] In a second aspect, the present invention provides a method for constructing a rhizobium mutant, comprising the following steps:

[0009] S1. Using the genomic DNA of Sinorhizobium fredii HH103 as a template, PCR amplify the upper and lower arms of the homologous exchange of the nuo manipulation unit;

[0010] S2. Sequentially ligate the amplified upper and lower arm fragments to the digested vector pCM351 to construct a recombinant plasmid;

[0011] S3. Introduce the recombinant plasmid into Escherichia coli to obtain a donor bacterium, use Sinorhizobium fredii HH103 as a recipient bacterium, and introduce the recombinant vector into Sinorhizobium fredii HH103 through biparental conjugation transfer, and obtain a mutant after homologous recombination.

[0012] Based on the above technical solutions, preferably, in step S1, the primer pair for amplification is:

[0013] nuo-up-F: TCCCCGAAAAGTGCC;

[0014] nuo-down-R; TGGACCAGTTGCGTGAG;

[0015] nuo-down-F: TTGGGCATACGGGAAGA;

[0016] nuo-up-F: GCGTGGAAAGCCTGGTC.

[0017] In a third aspect, the present invention provides a symbiotic nitrogen-fixing bacterium for improving the nitrogen-fixing ability of leguminous crops, and the symbiotic nitrogen-fixing bacterium is HH103Δnuo.

[0018] Based on the above technical solutions, preferably, inoculate HH103Δnuo on the seedlings of leguminous crops.

[0019] In a fourth aspect, the present invention provides an application of a rhizobium mutant in improving the symbiotic effect between rhizobia and soybeans.

[0020] Based on the above technical solutions, preferably, when the soybean seedlings grow to the stage of opposite true leaves, inoculate the bacterial solution of HH103Δnuo.

[0021] A rhizobium mutant of the present invention and its application have the following beneficial effects compared with the prior art:

[0022] The present invention constructed a single-gene knockout strain of nuoh3 (Δnuoh3) and a whole-operon knockout strain of nuo (Δnuo), and inoculated the mutated bacterial solution during the soybean seedling stage. It was found that the plant phenotype of the triple-gene knockout mutant strain (Δnuo) of the operon unit where nuo is located had greener leaves than that of HH103 WT, the plant biomass was increased, the nitrogenase activity of a single plant was significantly higher than that of the wild-type strain, and the plant height increased as a whole; while the single-gene knockout of nuoh3 (Δnuoh3) showed a downward trend in the overall growth of soybean plants. This indicates that the mutant strain obtained by the whole-operon knockout of nuo (Δnuo) has the effect of improving the symbiotic effect between rhizobia and soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0024] Figure 1 Electrophoresis diagram of HH103 NADH oxidoreductase gene mutant strain; lanes 1-8, HH10Δnuoh3, 2371 bp; lanes 9-16, HH103Δnuo, 2387 bp; Marker1: DS2000; Marker2: 1Kb.

[0025] Figure 2 Results diagram of phenotype investigation of nuo series gene deletion mutant strains inoculated on Williams 82 potted plants; CK: control of non-inoculated soybean plants; HH103Δnuoh3: HH103 mutant strain with nuo h3 gene deletion inoculated on soybean plants; HH103Δnuo: HH103 mutant strain with nuo operon unit deletion inoculated on soybean plants; HH103 WT: HH103 wild-type strain inoculated on soybean plants.

[0026] Figure 3 Data analysis diagram of nuo series gene deletion mutant strains on soybean potted plants; CK: control of non-inoculated soybean plants; HH103Δnuoh3: HH103 mutant strain with nuo h3 gene deletion inoculated on soybean plants; HH103Δnuo: HH103 mutant strain with nuo operon unit deletion inoculated on soybean plants; HH103 WT: HH103 wild-type strain inoculated on soybean plants.

[0027] Figure 4Electrophoresis diagram of PCR for the strain with the NADH oxidoreductase gene complemented; a: HH103 ce Nuo, 2537 bp; Marker: 1Kb; b: HH103 ceNuoh3, 1527 bp; Marker: DS2000.

[0028] Figure 5 Phenotype investigation results of inoculating the HH103Δnuo functional complementation strain into the Williams 82 potted plants; CK: Control of soybean plants without inoculation; WT: Soybean plants inoculated with the HH103 wild-type strain; Δnuo: Soybean plants inoculated with the HH103 nuo operon knockout mutant; CE: Soybean plants inoculated with the HH103Δnuo operon gene functional complementation strain.

[0029] Figure 6 Data analysis diagram of inoculating the HH103Δnuo and its functional complementation strain into the Williams 82 potted plants; CK: Control of soybean plants without inoculation; HH103Δnuo: Soybean plants inoculated with the HH103 nuo operon knockout mutant; HH103 WT: Soybean plants inoculated with the HH103 wild-type strain; HH103 ce nuo: Soybean plants inoculated with the functional complementation strain of HH103Δnuo. Specific implementation manners

[0030] Next, in combination with the embodiments of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0031] Example 1 Construction of the HH103 NADH oxidoreductase gene deletion mutant

[0032] Poly-β-hydroxybutyrate (PHB) is a storage substance for bacterial carbon sources and energy. When PHB decomposes, a large amount of reducing power NAD(P)H will be generated. Therefore, the synthesis and degradation of PHB can play a regulatory role as an alternative electron acceptor. NADH oxidoreductase is the entry point of the electron transport chain in the energy production of bacteroids respiration. Genome analysis found that there are two NADH oxidoreductase synthesis gene clusters in the HH103 genome. Among them, nuoh3 and nuoi3 jointly participate in the synthesis of the NADH oxidoreductase subunit I and form an independent operon with an unknown function gene SFHH103_02099.

[0033] Nucleotide sequence of the nuoh3 single gene: atggagcttgtcgttgccattggcctgatcgtcttcaaagttgcgttgctg attgcgatgctcttgctcctgcccttgccgctgacctgggtggaacgcaagatcgccgggcacatgcagcagcggctgggaccgatgcgcgttggctggcacgggctgctgcagccggtggcggacgggatcaagctcctgaccaaggaagaccacatcccggccgaggccgaccgcttcctgttcaaacttgcgccaatcctggcgctcgcgccgccctttgtggtgttcgtggcaatcccgttcggagagtctgtctctgtgctcggcaacgagatcaccctctacgtctcgaacatgaacgtggcgctgctcttcgttttcgcggtgatcggtctggaagtctatggcgtgattttcggcggctgggcggcgaacagcaaatatgcggtgcttggcagcctcaggacctgcgcgcagatgatcagctacgagatcccgatggggtttgcggtgatcggcgtggtcatgctggcgcagtcgatgagcctcctcgagatcgtccgggcccaggaagaggtctggaacatcgtctaccagccgatcgggttcttcgtgttcttcgtcgccggcctcgccgaagcgcagcgcatccccttcgacctgtcggaggcggaaggcgatcttggggccggcttccacaccgaatatagcggcatccgcttcgccttcttcatggtcagtgaatacgtcgtcatgcttttggtgtcggtcctgacggtgatcctgtttttcggcgggtggaacggcgtgctgatccccttgccgccgctcctctggttcgcactcaaggtggcgttcttcgtctatttgttcatgtggttccgctttactttcccccgttatcgctacgaccagctgatggcgatcggttggaaggtcttgcttcctctgtcgatggcgaacataattattactggtattgctttc。

[0034]

[0035] This study started from this operon unit, and used Cre-loxp to construct single-gene knockout (Δnuoh3) of nuoh3 and whole operon knockout (Δnuo) strains. The nucleotide sequence of the single gene nuoh3 is shown in SEQ ID No.3, and the nucleotide sequence of nuo is shown in SEQ ID No.1. The specific methods are as follows:

[0036] Using Sinorhizobium fredii HH103 as a template, and using TCCCCGAAAAGTGCC and TGGACCAGTTGCGTGAG; TTGGGCATA CGGGAAGA and GCGTGGAAAGCCTGGTC as primer pairs, the upstream and downstream fragments of the operon unit nuo were amplified by PCR (PCR amplification reaction system: Phanta UniFi MasterMix 2 μL; 2×PhantaMax Buffer 20 μL; dNTP Mix 2 μL; Primer-F 2 μL; Primer-F 2 μL; ddH2O 10 μL; template-HH103 2 μL) as the arms for homologous double exchange, and linked to both sides of the resistance gene Gm (gentamicin) of the vector pCM351 by homologous recombination to obtain the "upstream + Gm + downstream" fragment. The vector pCM351 was digested into a linear form by double digestion with EcoRⅠ and AgeⅠ, and the "upstream + Gm + downstream" fragment was linked to pCM351 by homologous recombination and introduced into Escherichia coli JM83. After the transformed strain was sequenced correctly, the plasmid was extracted and transformed into E.coli S17-1 to obtain the donor bacterium for biparental hybridization.

[0037] Using the wild-type Sinorhizobium fredii HH103 as the recipient strain, plasmid transfer could occur during the co-culture of the two parents. The homologous recombination vector constructed in the donor bacterium was transferred to HH103 by biparental conjugation transfer, and the transfer conjugants were screened using TY + Gm medium. After the length of the conjugants was verified by PCR to be correct, they were the mutants with complete knockout of the operon unit (Δnuo).

[0038] The nucleotide sequence of the HH103Δnuo mutant is shown in SEQ ID No.2.

[0039] Nucleotide sequence of the HH103Δnuo mutant: ggtaccatggatgcatatggcggccgcataacttcgtatagcatacattatacgaagttatctacgcgtcaattctcgaattgacataagcctgttcggttcgtaaactgtaatgcaagtagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttgttatgactgtttttttgtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggtggctcaagtatgggcatcattcgcacatgtaggctcggccctgaccaagtcaaatccatgcgggctgctcttgatcttttcggtcgtgagttcggagacgtagccacctactcccaacatcagccggactccgattacctcgggaacttgctccgtagtaagacattcatcgcgcttgctgccttcgaccaagaagcggttgttggcgctctcgcggcttacgttctgcccaggtttgagcagccgcgtagtgagatctatatctatgatctcgcagtctccggcgagcaccggaggcagggcattgccaccgcgctcatcaatctcctcaagcatgaggccaacgcgcttggtgcttatgtgatctacgtgcaagcagattacggtgacgatcccgcagtggctctctatacaaagttgggcatacgggaagaagtgatgcactttgatatcgacccaagtaccgccacctaacaattcgttcaagccgagatcggcttcccggccgacgcgtagataacttcgtatagcatacattatacgaagttatggatccagcttatcgataccgcgg。

[0040] Using HH103Δnuo as the recipient strain again, the plasmid pCM157 was transferred into the mutant by conjugal transfer of two parental strains. The Cre recombinase expressed by pCM157 can delete the resistance fragment. After more than 3 subcultures, the resistance was eliminated, and finally a mutant strain without resistance was obtained. The PCR electrophoresis gel images of the related mutant strains are shown in Figure 1 .

[0041] Figure 1 As shown, the target band of the HH103Δnuoh3 mutant (the mutant strain of HH103 with a deletion mutation of the nuoh3 gene) is 2371 bp; the target band of the HH103Δnuo (the mutant strain of HH103 with a knockout mutation of the nuo operon) mutant is 2387 bp.

[0042] Example 2 Investigation of the soybean pot phenotype of the NADH oxidoreductase gene deletion mutant

[0043] In order to investigate the effect of the deletion mutation of the NADH oxidoreductase gene, a key node of the bacteroid respiratory chain in HH103, on soybean symbiosis, in this example, soybean Williams 82 was selected for a soybean pot experiment with HH103Δnuoh3, HH103Δnuo, and HH103 WT.

[0044] Pot experiment: Vermiculite was used as the substrate during potting, and Fahraeus nitrogen-free nutrient solution was used as the plant nutrient solution. Soybean seeds with uniform size and plump grains were surface sterilized with sodium hypochlorite and then sown in vermiculite pots sterilized at 121 °C for 30 min. On the 7th day after sowing, seedlings growing to the opposite true leaf stage were selected, and 1 mL (OD 600 was 0.2) of the rhizobial suspension was inoculated into the soybean seedlings with a syringe. The nutrient solution was regularly watered, and the plants were harvested 28 days after inoculation for phenotype detection. The growth of the plants is shown in Figure 2 .

[0045] Fahareus nitrogen-free plant nutrient solution (1 L): Weigh 0.01 g of CaCl2·2H2O, 0.12 g of MgSO4·7H2O, 0.10 g of KH2PO4, 0.15 g of Na2HPO4·12H2O, 5.0 mg of iron citrate, 1.0 mL of Gibson trace element solution, and make up to 1000 mL with dH2O.

[0046] Gibson trace element solution 1 (1 L): Weigh 2.86 g of H3BO3, 2.03 g of MgSO4·7H2O, 0.22 g of ZnSO4·7H2O, 0.13 g of Na2MoO4·2H2O, 0.08 g of CuSO4·5H2O, and make up to 1000 mL with dH2O.

[0047] Bacterial liquid preparation: Take the HH103 wild-type strain, HH103Δnuoh3, and HH103Δnuo, prepare TY solid media with corresponding resistances, streak each strain, and culture in an incubator at 28 °C until monoclonal colonies grow. Select the monoclonal colonies and transfer them to liquid media with their corresponding resistances for further culturing and activation until the OD 600 is 0.2.

[0048] Figure 2 It can be seen that the triple-gene knockout mutant strain of the nuo-containing operon has a greener leaf phenotype and a generally higher plant height when inoculated on plants compared to the HH103 WT; while the single-gene knockout HH103Δnuoh3 shows a trend of overall decline in soybean plants. This indicates that the mutant strain obtained by the overall knockout of the nuo operon (Δnuo) has the effect of enhancing the symbiotic effect between rhizobia and soybeans.

[0049] Statistical analysis of soybean pot data shows that ( Figure 3 ) the overall deletion mutation of the nuo operon leads to an increase in the biomass of symbiotic soybean plants, a significantly higher nitrogenase activity per single plant compared to the wild-type strain, and an increase in plant height; while the single-gene deletion mutant nuoH3 causes a decrease in the growth of symbiotic plants in terms of both above-ground fresh weight and plant height.

[0050] The above results indicate that the overall deletion mutation of the nuo operon involved in the synthesis of NADH oxidoreductase subunit I can enhance the symbiotic effect between rhizobia HH103 and soybeans, suggesting that this operon plays an important role in regulating the expression of bacteroid NADH oxidoreductase and the electron transfer pathway.

[0051] Example 3 Construction of a strain with functional complementation of the NADH oxidoreductase gene

[0052] Using pBBR1MCS-2 as the expression vector, the nuo sequence was amplified with TCGACGGTATCGATAAGCTTGAAACG CCCATCCA and CTCTAGAACTAGTGGATCCCGGCCGCTGCTGA as primers (reaction system: 2 μL of Phanta UniFi Master Mix; 20 μL of 2×Phanta Max Buffer; 2 μL of dNTP Mix; 2 μL of Primer-F; 2 μL of Primer-F; 10 μL of ddH2O; 2 μL of template-HH103). After the vector pBBR1MCS-2 was digested with HindⅢ and BamHⅠ, it was homologously recombined with the PCR product to construct the nuo functional complementation vector pBBR2-nuo. After successful sequencing alignment, it was transformed into Escherichia coli S17-1. Using S17-1 pBBR2-nuo as the donor bacterium, the complementation vector was transferred to the nuo mutant strain through biparental conjugation transfer to obtain the complemented strain HH103 cenuo.

[0053] The specific steps of biparental conjugation transfer are as follows:

[0054] (1) Bacterial culture: Using E. coli s17-1 containing the recombinant PCM351 plasmid as the donor bacterium, it was cultured overnight in liquid at 37°C; using wild-type rhizobia as the recipient bacterium, it was cultured in liquid at 28°C for about 2 - 3 days.

[0055] (2) Co-culture of the two bacteria: Collection of bacteria. Centrifuge at 5000 rpm for 3 min at room temperature, and collect the donor bacterium and the recipient bacterium in different EP tubes respectively, and wash them twice with TY medium. Mix the two bacteria, take one tube of bacteria and add 1 mL of TY medium, blow the bacteria evenly, and transfer them to an EP tube containing different bacteria, mix the bacteria thoroughly, centrifuge at 5000 rpm for 3 min, aspirate 950 μL of the supernatant, and blow the remaining bacterial liquid evenly. Stick the sterilized microporous filter membrane on the TY plate without antibiotics, then add the mixed bacteria in the EP tube to the center of the filter paper, place the plate steadily until the bacteria are absorbed, and then invert and culture it in an incubator at 28°C for 2 days.

[0056] TY medium (1 L): Weigh 5.0 g of tryptone, 0.87 g of CaCl2·2H2O, 3.0 g of yeast powder, adjust the pH to 7.0 - 7.2, and make up the volume to 1000 mL with dH2O.

[0057] (3) Coating the selective plate: Take out the microporous filter membrane and wash the bacteria cultured on it into an EP tube. Make 10× serial dilutions: 10 –2 、10 –3 、10 –4, Take 200 μL and spread it on the corresponding resistant AMS plates. Place the plates in an incubator at 28 °C for 5 - 6 days.

[0058] The PCR electrophoresis pattern of the complemented strain is shown in Figure 4 as follows. Figure 4 As shown, the target band of HH103 ce nuo is 2537 bp; the target band of HH103 ce nuoh3 is 1527 bp.

[0059] Example 4 Investigation of the soybean pot phenotype of the Δnuo functional complemented strain

[0060] In this example, according to the pot phenotype of the nuo operon deletion mutation, it was found that the overall deletion mutation of the nuo operon improved the soybean symbiotic phenotype.

[0061] To verify that the symbiotic phenotype difference of this mutant strain is due to the deletion of the three genes in this operon, in this example, the soybean pots of Δnuo and its functional complemented strain were investigated.

[0062] Pot experiment: Vermiculite was used as the substrate for potting, and Fahraeus nitrogen-free nutrient solution was used as the plant nutrient solution. Soybean seeds with uniform size and plump grains were surface sterilized with sodium hypochlorite and then sown in vermiculite pots sterilized at 121 °C for 30 min. At the 7th day after sowing, seedlings growing to the opposite true leaf stage were selected, and 1 mL (OD 600 of 0.2) of rhizobial suspension was inoculated into the soybean seedlings with a syringe. The nutrient solution was poured regularly, and the plants were harvested after 28 days to measure the data. The results are shown in Figures 5-6 .

[0063] Preparation of the bacterial suspension: Take the HH103 wild-type strain, HH103Δnuoh3, and HH103 ce nuo, prepare the corresponding resistant TY solid medium, streak each strain, and culture it in an incubator at 28 °C until single colonies grow. Select the single colonies and transfer them into their corresponding resistant liquid media for further culturing and activation until OD 600 is 0.2.

[0064] Analysis of the potting data showed that ( Figures 5-6 ), after knocking out the nuo operon in the NADH oxidoreductase subunit I of soybean rhizobia, the leaves of the soybean potted plants inoculated with this mutant strain were green, and the plant height, above-ground fresh weight, nodule number, and nodule weight were all higher than those of the wild type. After inoculating the functional complemented strain (CE) into soybean Williams 82 pots, its traits were the same as or lower than those of the wild type, indicating the specific function of the nuo operon genes in the symbiosis process between rhizobia and soybeans.

[0065] Based on the above results, it is speculated that the reason for this phenomenon may be due to the negative regulation of the nuo operon on the expression of HH103 NADH oxidoreductase. After gene knockout of the nuo operon, the symbiotic effect between HH103 and soybean was enhanced.

[0066] The above description is only for the preferred embodiments of the present invention and is not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A rhizobium mutant, characterized in that: The rhizobium mutant is HH103Δnuo, which is a mutant obtained by knocking out the nuo operon in subunit I of NADH oxidoreductase of Sinorhizobium fredii HH103 using Sinorhizobium fredii HH103 as the starting strain.

2. The rhizobium mutant according to claim 1, wherein: The nucleotide sequence of the nuo operon is shown in SEQ ID No.

1.

3. A rhizobium mutant according to claim 1, characterized in that: The nucleotide sequence of HH103Δnuo is shown in SEQ ID No.

2.

4. A method for constructing a rhizobium mutant according to any one of claims 1-3, characterized in that: It includes the following steps: S1, Using the genomic DNA of Sinorhizobium fredii HH103 as a template, PCR amplify the upstream and downstream homologous exchange arms of the nuo operon. S2, Connect the amplified upstream and downstream fragments to the digested vector pCM351 in sequence to construct a recombinant plasmid. S3, Introduce the recombinant plasmid into Escherichia coli to obtain the donor bacterium. Using Sinorhizobium fredii HH103 as the recipient bacterium, transfer the recombinant vector into Sinorhizobium fredii HH103 through biparental conjugation transfer, and obtain the mutant after homologous recombination.

5. The construction method according to claim 4, characterized in that: In step S1, the primer pair for amplification is: nuo-up-F: TCCCCGAAAAGTGCC; nuo-down-R; TGGACCAGTTGCGTGAG; nuo-down-F: TTGGGCATACGGGAAGA; nuo-up-F: GCGTGGAAAGCCTGGTC.

6. A symbiotic nitrogen-fixing bacterium for improving the nitrogen fixation ability of leguminous crops, characterized in that: The symbiotic nitrogen-fixing bacterium is HH103Δnuo described in claim 1.

7. The symbiotic nitrogen-fixing bacterium according to claim 6, characterized in that: Inoculate HH103Δnuo on the seedlings of leguminous crops.

8. The application of a rhizobium mutant according to any one of claims 1-3 in improving the symbiotic effect between rhizobia and soybeans.

9. The application according to claim 8, characterized in that: When the soybean seedlings grow to the stage of opposite true leaves, inoculate the bacterial solution of HH103Δnuo.

Images