SNP (Single Nucleotide Polymorphism) molecular marker combination related to chicken subtype J avian leukosis resistance, application and related method

Abstract

The invention discloses a J subtype avian leukosis virus resistance-related SNP (Single Nucleotide Polymorphism) site, a site combination and application thereof, and belongs to the field of biological breeding of poultry. According to the invention, SNP loci related to the resistance of the subtype J avian leukosis of the opisthopapus taihangensis are successfully screened through genome-wide association analysis, and the SNP loci are respectively located at the 76782221 basic group, the 76783766 basic group, the 76810215 basic group, the 76813237 basic group, the 76894295 basic group and the 76896586 basic group of the second chromosome of the opisthopapus taihangensis. By detecting the SNP site combination, J subtype avian leukosis virus resistant individuals can be screened. Therefore, the SNP molecular marker provided by the invention can be used for molecular marker-assisted breeding of the opisthopause chicken and local chickens thereof, accelerates breeding of disease-resistant chicken varieties, and provides a reference basis for disease-resistant breeding work of the opisthopause chicken.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a SNP molecular marker on chicken chromosome 2 related to J subtype avian leukosis resistance and its application as well as a related identification method and an improved breeding method. Background Art

[0002] Chicken immunosuppression is widely prevalent among poultry breeding diseases in my country and causes serious losses in the poultry industry. Among them, avian leukosis virus (ALV) is particularly harmful. The most widely spread avian leukosis virus is the J subgroup avian leukosis virus (ALV-J). Infected chickens show decreased production performance (egg production rate, egg quality, etc.) and immunosuppression (reduced vaccine immunity, increased pathogenicity, and multiple diseases or secondary infections), resulting in a decline in breeding economic benefits; at the same time, it will also increase the difficulty of local chicken seed preservation. ALV is mainly transmitted vertically, and its infection can be amplified from great-grandparent generation (pure line) → grandparent generation → parent generation → commercial generation, with an infection rate of about 5%-20% per generation. After one great-grandparent generation (pure line) breeder chicken is infected with ALV, 240,000 commercial chickens can be infected and eliminated.

[0003] The chicken's resistance to avian leukosis is controlled by multiple genes and is genetically antagonistic to economic traits such as growth rate and egg-laying performance. Traditional disease-resistant breeding has the problems of low phenotypic selection efficiency and the difficulty of synergistic improvement of multiple traits. However, the currently developed biological breeding technology can be used to analyze disease-resistant genes, explore molecular markers significantly associated with resistance, and use genomic selection technology to significantly improve the efficiency of disease-resistant breeding. Taihang chicken is an excellent local breed in Hebei. Although it has strong disease resistance, it also faces the problem of avian leukosis virus infection. An association analysis was conducted on the polymorphic sites in the Taihang chicken population and the J subtype avian leukosis resistance. The sites that affect the Taihang chicken's resistance to J subtype avian leukosis were screened and utilized, which is expected to fundamentally solve the harm of avian leukosis. Summary of the invention

[0004] One of the purposes of the present invention is to provide a SNP molecular marker combination associated with chicken J subtype avian leukosis resistance, which consists of the following six SNP molecular markers:

[0005] SNP molecular marker 1: the nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2, and the difference between the two nucleotide sequences is the C / T polymorphism of one of the SNP sites, i.e., the C>T mutation at position 76782221 on chromosome 2 of the chicken GRCg6a genome;

[0006] SNP molecular marker 2: The nucleotide sequence is as shown in SEQ ID NO.3 or SEQ ID NO.4. The difference between these two nucleotide sequences lies in the A / T polymorphism at one SNP locus, that is, the A>T mutation at position 76783766 on chromosome 2 of the chicken GRCg6a genome;

[0007] SNP molecular marker 3: The nucleotide sequence is as shown in SEQ ID NO.5 or SEQ ID NO.6. The difference between these two nucleotide sequences lies in the C / T polymorphism at one SNP locus, that is, the C>T mutation at position 76810215 on chromosome 2 of the chicken GRCg6a genome;

[0008] SNP molecular marker 4: The nucleotide sequence is as shown in SEQ ID NO.7 or SEQ ID NO.8. The difference between these two nucleotide sequences lies in the T / C polymorphism at one SNP locus, that is, the T>C mutation at position 76813237 on chromosome 2 of the chicken GRCg6a genome;

[0009] SNP molecular marker 5: The nucleotide sequence is as shown in SEQ ID NO.9 or SEQ ID NO.10. The difference between these two nucleotide sequences lies in the A / G polymorphism at one SNP locus, that is, the A>G mutation at position 76894295 on chromosome 2 of the chicken GRCg6a genome;

[0010] SNP molecular marker 6: The nucleotide sequence is as shown in SEQ ID NO.11 or SEQ ID NO.12. The difference between these two nucleotide sequences lies in the G / A polymorphism at one SNP locus, that is, the G>A mutation at position 76896586 on chromosome 2 of the chicken GRCg6a genome.

[0011] The sequences of the SNP markers are specifically shown in Table 1:

[0012] Table 1 SNP molecular marker information table

[0013]

[0014] AATAGTAGTGACAAATGATCTCTGATTCTA

[0015] AGCTGAGCAATGGAATTAGCATGAGTAGA

[0016] TGCCTGTGTTAGCAAATGCTCTTCCT

[0017] CAGAGACAGTGGGTCACCTCTGCTGGTGC

[0018] AGATTTTAACTAGTGCAGCGTGCAGGCTTT

[0019] SEQ ID TGTTCATGGCTGGCAAAATGCACAGATCA

[0020] SNP 3 TGGTGGTAACTG[C / T]GTTGAAAAATAGTG 2:g.76810215C>TNO.5 or 6TTTTGTAGCTGAGAATTTGCTCTATCACTT

[0021] GTTGTTATTGTGATTTTGACATCTACTGTA

[0022] GTTTCCAAGGAAATAAATAGGAGGTG

[0023] TGTAGGGAGGGGCCCATTGTTTTTGTGAGT

[0024] GAAAGCTCTAAAGTAGGCCTGCAAAAACT

[0025] SEQ ID GGGTGGAAGGACAGCTCAGTATAGTAAAG

[0026] SNP 4 TAATAAACATGG[T / C]CATTTGAGATTTTC 2:g.76813237T>CNO.7 or 8AGTTCTCAAGCTTTTCATAGGTGCGTCAGA

[0027] AAAATATAATGTATCTGTGTAACCACATG

[0028] GCACAGTGTCCTGGTTTTGGCTGGGAT

[0029] ACTGAATAGCAATCGAACAAAATATCCAC

[0030] ATTCCTCCCAGTAACCAGTTGTATAAAATA

[0031] SEQ ID ACCACAACAGGAAATCACTATAATTAGGA

[0032] SNP 5 TTAAAGCATGGG[A / G]GCAAGAATATTTTT 2:g.76894295A>GNO.9 or 10TACATTGCTGAAAATTTCCATGGAGAAGG

[0033] CTTCAATGAAAGTCTCAGATCTTTACACAA

[0034] GACATTAATGATTTCATAAACCAAAAT

[0035]

[0036] Note: [C / T] in the nucleotide sequence of SEQ ID NO.1 or 2 means that the position is C in SEQ ID NO.1 and T in SEQ ID NO.2, and the bases at the remaining positions are the same. The meanings of other sequence numbers in the table are the same.

[0037] Another object of the present invention is to provide the application of the above SNP molecular marker combination for detecting the resistance of chickens to avian leukosis subtype J or improving the resistance traits of chickens to avian leukosis subtype J.

[0038] Preferably, the chicken is Taihang chicken or the expanded line of Taihang chicken.

[0039] Another object of the present invention is to provide a method for identifying or assisting in identifying the strength of the avian leukosis resistance trait of chickens, including the following steps: detecting the genotypes of the above SNP locus combination, and the individuals with the genotypes of TT, TT, CC, TT, AA, and AA at SNP locus 1 to SNP locus 6 in sequence are disease-resistant individuals; the individuals with the genotypes of CC, AA, TT, CC, GG, and GG at SNP locus 1 to SNP locus 6 in sequence are susceptible individuals.

[0040] Another object of the present invention is to provide a method for improving the resistance trait of chickens to avian leukosis subtype J, including the following steps: detecting the genotypes of the above SNP locus combination, and eliminating non-resistant individuals according to the detection results to gradually increase the genotype frequency related to the resistance trait of avian leukosis subtype J at the corresponding locus.

[0041] The present invention has the following beneficial effects: new SNP molecular markers affecting the resistance trait of chickens to avian leukosis subtype J are determined, and it is proved that there is a strong linkage relationship between these SNP molecular markers. At the same time, these SNP molecular markers are further applied to the genetic improvement of the resistance trait of breeding chickens to avian leukosis subtype J, which can improve the disease resistance of offspring to avian leukosis subtype J in chickens, and thus enhance the market competitiveness of seed industry enterprises. Description of the Drawings

[0042] Figure 1 It is a phenotypic difference diagram (organ autopsy, body weight, P27 antigen level, and organ index diagram) of the resistant group and the susceptible group of Taihang chickens. In the figure, **** indicates P≤0.0001; *** indicates P≤0.001; ** indicates P≤0.01; * indicates P≤0.05.

[0043] Figure 2 It is a linkage map of SNP loci on chromosome 2 of the chicken reference genome GRCg6a of Taihang chickens.

[0044] Figure 3 It is the genotype distribution frequencies of SNPs in the susceptible group and resistant group of subgroup J avian leukosis. In the figure, **** indicates P≤0.0001; *** indicates P≤0.001; ** indicates P≤0.01; * indicates P≤0.05. Specific implementation manners

[0045] Example 1 Modeling of subgroup J avian leukosis and identification of resistant and susceptible individuals

[0046] Taihang chickens were from a conservation farm. 168 one-day-old Taihang chicken chicks were selected for artificial virus infection experiments. Each chick was intraperitoneally injected with 0.2 mL of ALV-JNX0101 strain. Blood samples were collected from the wing vein at the 2nd, 3rd, 4th, and 5th weeks after virus challenge. Serum was separated, and avian leukosis P27 antigen was detected using an avian leukosis P27 antigen detection kit (Harbin Guosheng Biotechnology Co., Ltd.). The S / P value was calculated based on the P27 antigen detection data. Individuals with an S / P value > 0.2 were defined as susceptible individuals, and individuals with an S / P < 0.2 were defined as resistant individuals, as shown in Figure 1 A; It was observed that at the 5th week after infection, the average body weight of susceptible individuals decreased compared with that of resistant individuals, as shown in Figure 1 B; Autopsy found that the spleen, liver, and kidneys of susceptible individuals were swollen, and the bursa of Fabricius and thymus were atrophied, as shown in Figure 1 C, and except for the thymus, the organ indices of the other tissues and organs were significant or extremely significant in the two groups, as shown in Figure 1 D. A total of 74 resistant individuals and 94 susceptible individuals were identified based on the above indicators.

[0047] Example 2 Genome resequencing and SNP locus mining for the resistant trait of subgroup J avian leukosis

[0048] Collect wing vein blood from the above individuals, extract individual DNA using the TIANamp genomic kit (TIANGEN, Beijing, China), and detect the sample purity using a NanoDrop TM One spectrophotometer, and Qubit The concentration of the DNA sample was detected by a fluorometer, and the integrity of the DNA sample was detected by 1% agarose gel electrophoresis. After the sample passed the detection, a library was constructed according to the method described in the MGIEasyFast Enzyme Digestion Library Preparation Reagent Kit V2.0 (MGI, Shenzhen, China). First, the qualified DNA sample was digested and fragmented by enzymes, followed by end repair and adapter ligation. The target fragments were enriched by PCR and purified, and finally a sequencing library was obtained. The qualified library was circularized, and then DNA nanoballs (DNBs) were prepared using rolling circle amplification (RCA) technology. Then, the DNBs were loaded onto the sequencing chip through an automatic sample loading system. Finally, sequencing was performed using DNBSEQ-T7 (MGI, Shenzhen, China) to obtain 150-bp paired-end sequencing reads.

[0049] Quality control was performed on the paired-end sequencing reads. The whole-genome resequencing depth was 10X. The obtained high-quality sequences were aligned with the reference genome (GRCg6a) using BWA. Variant detection was performed using the GATK software. After filtering the SNP data for site deletion rate and minor allele frequency using VCFtools, the genotyping results were obtained. A total of 11,545,677 SNPs were obtained for genome-wide association study (GWAS) analysis. GWAS was performed on the avian leukosis P27 antigen level and genotype data using the GEMMA software. To reduce false-positive association results, a mixed linear model (MLM) was used for trait association analysis, with population genetic structure as a fixed effect and individual kinship as a random effect to correct the influence of population structure and individual kinship on the results. The model was y = Xα + Zβ + Wμ + e, where y is the phenotypic trait, X is the indicator matrix of the fixed effect, α is the estimated parameter of the fixed effect; Z is the indicator matrix of the SNP, β is the effect of the SNP; W is the indicator matrix of the random effect, μ is the predicted random individual, and e is the random residual, which follows and the first three PCA components were selected as covariates, and the disease-resistant phenotype was in the format of a mixed linear model. Loci with P values reaching the threshold were significantly correlated, and the threshold was set to -log 10 (2.40E-06) = 5, where 2.40E-06 represents 1×10 -5.62 , and through GWAS analysis, it was found that a 114.36-kb region on chromosome 2 was significantly associated with the susceptibility / resistance of Taihang chickens to subgroup J avian leukosis. Haplotype blocks were formed at the SNP loci in this region, indicating linkage disequilibrium between these loci. The six most significant SNPs had strong linkage disequilibrium (D’ >= 0.90) ( Figure 2 ), and the specific nucleotide sequences are shown in Table 1.

[0050] To further determine the relationship between the genotypes of SNPs and the resistance and susceptibility to avian leukosis virus subgroup J, the chi-square test results showed that six SNPs were significantly associated with susceptibility / resistance to avian leukosis virus subgroup J (Table 2). At the same time, it was found that there were significant differences in the genotype frequencies of the six identified significant SNP loci between the disease-resistant group and the susceptible group ( Figure 3 ). According to the higher genotype frequencies in the resistant group than in the susceptible group, the TT genotype at the chr2_76782221 locus, the TT genotype at the chr2_76783766 locus, the CC genotype at the chr2_76810215 locus, the TT genotype at the chr2_76813237 locus, the AA genotype at the chr2_76894295 locus, and the AA genotype at the chr2_76896586 locus were determined as the dominant genotypes related to resistance to avian leukosis virus subgroup J, which was beneficial to the breeding for resistance to avian leukosis virus subgroup J.

[0051] Table 2 SNPs significantly associated with susceptibility / resistance to avian leukosis virus subgroup J on chromosome 2

[0052]

Claims

1. SNP molecular marker combination related to chicken J-subtype avian leukosis resistance, characterized in that The SNP molecular marker combination consists of the following six SNP molecular markers: SNP molecular marker 1: The nucleotide sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2; SNP molecular marker 2: The nucleotide sequence is as shown in SEQ ID NO.3 or SEQ ID NO.4; SNP molecular marker 3: The nucleotide sequence is as shown in SEQ ID NO.5 or SEQ ID NO.6; SNP molecular marker 4: The nucleotide sequence is as shown in SEQ ID NO.7 or SEQ ID NO.8; SNP molecular marker 5: The nucleotide sequence is as shown in SEQ ID NO.9 or SEQ ID NO.10; SNP molecular marker 6: The nucleotide sequence is as shown in SEQ ID NO.11 or SEQ ID NO.

12.

2. Use of the SNP molecular marker combination according to claim 1, characterized in that: It is used to detect the resistance to avian leukosis virus subgroup J in chickens or improve the traits related to the resistance to avian leukosis virus subgroup J in chickens.

3. Application of the SNP locus combination in detecting the resistance to avian leukosis virus subgroup J in chickens. The SNP locus combination consists of the following SNP loci: SNP locus 1: A C>T mutation at position 76782221 on chromosome 2 of the chicken GRCg6a genome; SNP locus 2: An A>T mutation at position 76783766 on chromosome 2 of the chicken GRCg6a genome; SNP locus 3: A C>T mutation at position 76810215 on chromosome 2 of the chicken GRCg6a genome; SNP locus 4: A T>C mutation at position 76813237 on chromosome 2 of the chicken GRCg6a genome; SNP locus 5: An A>G mutation at position 76894295 on chromosome 2 of the chicken GRCg6a genome; SNP locus 6: A G>A mutation at position 76896586 on chromosome 2 of the chicken GRCg6a genome.

4. The SNP molecular marker combination according to claim 1 or the application according to claim 2 or 3, characterized in that, The chicken is Taihang chicken or an expanded line of Taihang chicken.

5. A method for identifying or assisting in identifying the strength of resistance to avian leukosis subtype J in chickens, comprising the following steps: For an individual whose genotypes of the SNP loci from SNP locus 1 to SNP locus 6 are TT, TT, CC, TT, AA, and AA in sequence when detecting the genotype of the SNP locus combination as described in claim 3, it is a disease-resistant individual; for an individual whose genotypes of the SNP loci from SNP locus 1 to SNP locus 6 are CC, AA, TT, CC, GG, and GG in sequence, it is a susceptible individual.

6. A method for improving the resistance trait of chicken to subgroup J avian leukosis, characterized in that, The method includes the following steps: Detect the genotype of the SNP locus combination as described in claim 3, and eliminate non-resistant individuals according to the detection results to gradually increase the genotype frequency of the corresponding loci related to the trait of resistance to avian leukosis virus subgroup J.

Images