Novel influenza antigens

By performing amino acid replacement in the curly spiral region of influenza A HA, stable recombinant HA antigen is prepared, which solves the problem of insufficient protection of various influenza strains by existing vaccines, and achieves broad-spectrum immunogenicity and stable trimer form, which is suitable for preventing influenza A infection.

CN120379689APending Publication Date: 2025-07-25GLAXOSMITHKLINE BIOLOGICALS SA
View PDF 15 Cites 0 Cited by

Patent Information

Application Number
CN202380086993.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-20
Filing Date
2023-12-18
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

Due to antigen variability, existing influenza vaccines are difficult to provide effective protection for a variety of influenza A strains, and traditional methods are limited by strain specificity and cannot effectively prevent seasonal and possible influenza virus variants.

Method used

By performing amino acid substitution in the crimped spiral region of influenza A HA, stable recombinant HA antigen is prepared, trimerization domain is removed, forming a stable trimer form, containing the ectodomain of HA, and combining with a pharmaceutically acceptable carrier to form an immunogenic composition.

Benefits of technology

The recombinant HA antigen can induce an immune response against a variety of influenza A strains in vivo, including strains of the same and different subtypes, provide broad-spectrum protection, and is easy to express and purify, improving the immunogenicity and stability of the vaccine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120379689A_ABST
    Figure CN120379689A_ABST
Patent Text Reader

Abstract

Immunogenic compositions comprising an influenza A strain hemagglutinin antigen and a polynucleotide encoding the antigen.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to novel influenza virus antigens, nucleotide sequences encoding them, novel immunogenic or vaccine compositions, and the use of these antigens and compositions and methods for producing these antigens and compositions. In particular, the present invention relates to an immunogenic composition comprising a modified form of influenza hemagglutinin (HA) from an influenza A strain or a nucleotide sequence encoding the same, a method for producing the same, and its use in preventing influenza A virus infection. Background Art

[0002] Influenza viruses have a major impact on global public health, causing millions of severe illnesses, thousands of deaths, and significant economic losses each year. Influenza viruses belong to the family Orthomyxoviridae, which is a family of enveloped viruses whose genomes contain segmented, negative-sense single-stranded RNA. Influenza viruses are divided into three main types that infect humans: influenza A virus, influenza B virus, and influenza C virus. Influenza A and influenza B are the types most clinically relevant to humans and are the cause of the annual influenza season. Influenza C virus infections generally result in mild illness and are not considered to cause human influenza pandemics. Influenza strains are classified according to the host species of origin, geographical location, year of isolation, and serial number, and for influenza A, by the serological properties of the subtypes of two major surface glycoproteins, HA and neuraminidase (NA). It is these surface proteins, particularly HA, that determine the antigenic specificity of the influenza subtype or lineage.

[0003] Influenza A and influenza B diverged from each other approximately 2000 years ago, and HA has structural similarities but very low sequence identity (Ni et al., Biochemistry, 2014, 53:846 - 854). Influenza B virus was first isolated in 1940, and since the 1980s, two genetic lineages have been identified based on the antigenic properties of HA: B / Victoria / 2 / 87 (B / Vic) and B / Yamagata / 16 / 88 (B / Yam).

[0004] In terms of genetic and antigenic properties, influenza B virus strains generally evolve more slowly than influenza A strains. Influenza A viruses are constantly evolving and undergoing antigenic variation and are the cause of past influenza pandemics.

[0005] Vaccination plays a key role in controlling influenza epidemics and pandemics. Due to antigenic variability, annual vaccination is required to provide immunity against circulating influenza viruses. These circulating influenza viruses are predicted based on viral surveillance data. Since current influenza vaccines are mainly strain-specific, selecting the appropriate vaccine strain poses many challenges and frequently results in suboptimal protection. Current seasonal influenza vaccines are trivalent (TIV), containing two influenza A strains and one influenza B strain virus; or quadrivalent (QIV), containing two influenza A and two influenza B strain viruses. QIV contains the B / Victoria and B / Yamagata influenza B strains, while TIV contains one influenza B strain from either the Victoria or Yamagata lineage.

[0006] The immune response to current vaccines is mainly directed against the highly variable HA. HA is a trimeric protein, where each monomer contains two polypeptide chains, HA1 and HA2, which are linked by a disulfide bond and anchored in the viral envelope by a C-terminal transmembrane domain. Each monomer is initially expressed as inactive HA0, which is subsequently cleaved by host proteases into HA1 and HA2 subunits, which are linked by a disulfide bond to form a metastable prefusion state HA. The triggering event that has converted HA from the prefusion to the postfusion conformation has been associated with the pH change (drop) upon virus uptake / endocytosis leading to membrane fusion and virus internalization. Although influenza A and B viruses share conserved features in the conformational transition between the prefusion and postfusion conformations, there are substantial differences in the detailed mechanisms affecting this process (Ni et al., Biochemistry, 2014, 53:846-854).

[0007] HA can be functionally divided into two domains, namely the globular head and the stalk or stem. The globular head consists of a portion of HA1, while the stalk or stem structure consists of the N-terminal and C-terminal fragments of HA1 and all of HA2 (Hai et al., J. Virol, 2012 86(10):5774-5781). The transmembrane domain and cytoplasmic tail are also part of HA2. The HA globular head is the main target of antibodies against influenza viruses, but is also highly variable and undergoes continuous antigenic drift. In contrast, the HA stalk is highly conserved and rarely undergoes antigenic drift, but has low immunogenicity.

[0008] There remains a need for an influenza vaccine that is not restricted by the specificity of the native viral strain and that can provide protection against heterologous influenza strains. There is also a need for an influenza vaccine that does not require existing egg-based production methods. In particular, a vaccine against a range of influenza strains, including recent and evolving seasonal strains, as well as potentially emerging seasonal influenza strains in the future, would be highly desirable. Various approaches have been taken to attempt to provide a "universal" influenza A vaccine that protects individuals against heterologous strains, such as the recent use of the conserved stalk portion of HA (Yassine et al., Nature Medicine, 2015, 21(9):1065-1070; Corbett et al., mBio, 2019, 10(1):e02810-18). SUMMARY OF THE INVENTION

[0009] It has been found that by making amino acid substitutions in the coiled-coil region of HA from influenza A strains, a stable trimeric influenza A strain recombinant HA antigen can be obtained that retains the antigenicity of the wild-type influenza strain and can further elicit an immune response against a variety of different influenza A strains.

[0010] It has further been found that certain recombinant influenza A strain HA extracellular domain constructs expressed as fusions with heterologous trimerization domains are surprisingly stable after removal of the trimerization domain. It has also been found that certain recombinant influenza A strain HA extracellular domain constructs form stable trimers that can be expressed in the absence of a trimerization domain. These stable trimeric recombinant HA extracellular domain antigens without a trimerization domain (whether removed or absent) can potentially be used in immunogenic compositions.

[0011] In one aspect, the present invention provides an immunogenic composition comprising a recombinant influenza A strain hemagglutinin (HA) antigen in trimeric form and a pharmaceutically acceptable carrier, wherein the antigen comprises the extracellular domain of HA without a transmembrane domain or a cytoplasmic domain, and wherein the extracellular domain comprises:

[0012] (i) a globular head domain; and

[0013] (ii) a stalk domain having a coiled-coil region comprising one or more mutations in the coiled-coil region that individually or together stabilize the HA extracellular domain in a pre-fusion trimeric form;

[0014] and wherein the recombinant HA optionally comprises a heterologous trimerization domain.

[0015] In another aspect, the present invention provides an immunogenic composition comprising an isolated polynucleotide (such as DNA or mRNA) encoding the recombinant HA antigen described herein and a pharmaceutically acceptable carrier.

[0016] In another aspect, the present invention provides the immunogenic compositions described herein for prophylaxis and / or vaccination against influenza A strain infection or disease.

[0017] In another aspect, the present invention provides the immunogenic composition for prophylaxis and / or vaccination against influenza infection or disease caused by at least one different influenza A strain, which influenza A strain may be the same or different influenza A strain subtype as the HA subtype from which the HA extracellular domain antigen is derived.

[0018] In another aspect, the present invention provides a method for preparing the immunogenic compositions described herein, the method comprising:

[0019] (i) expressing the recombinant HA antigen in a eukaryotic cell from a polynucleotide sequence encoding the HA antigen fused to a heterotrimerization domain (e.g., foldon);

[0020] (ii) purifying the recombinant HA trimer from the cell supernatant;

[0021] (iii) removing the trimerization domain;

[0022] (iv) combining the recombinant HA trimer with a pharmaceutically acceptable carrier.

[0023] In another aspect, the present invention provides a method for preparing the immunogenic compositions described herein, the immunogenic composition comprising an HA extracellular domain containing one or more mutations in the coiled-coil region that individually or together stabilize the HA extracellular domain in a pre-fusion trimeric form, the method comprising:

[0024] (i) expressing the recombinant HA antigen from a polynucleotide sequence encoding the recombinant HA antigen, with or without a trimerization domain;

[0025] (ii) purifying the trimeric recombinant HA from the cell supernatant;

[0026] (iii) optionally, if the trimerization domain is present, removing it;

[0027] (iv) combining the recombinant HA trimer with a pharmaceutically acceptable carrier.

[0028] In another aspect, the present invention provides a method for prophylaxis and / or vaccination against influenza A strain infection or disease, which comprises administering the antigen or polynucleotide or immunogenic composition as described above to a human in need, such as a human identified as being at risk of influenza virus infection or disease.

[0029] In another aspect, the present invention provides a method of generating an immune response against an influenza A strain, which comprises administering to a human subject the recombinant influenza A strain HA antigen or polynucleotide or immunogenic composition described herein.

[0030] In another embodiment, the present invention provides the use of the recombinant influenza A strain HA antigen or polynucleotide described herein in the preparation of an immunogenic composition for generating an immune response against an influenza A strain in a human subject.

[0031] In another aspect, the present invention provides an immunogenic composition comprising a recombinant influenza A strain HA extracellular domain antigen obtained by expressing the extracellular domain of influenza A strain HA fused to a trimerization domain and subsequently removing the trimerization domain.

[0032] Brief Description of Sequences

[0033] SEQ ID NO:1 is the full-length HA sequence from an A / Brisbane / 02 / 2018 (H1N1)pdm09-like virus (H1 Bri18 ) and is also referred to as Bri18.

[0034] SEQ ID NO:2 is the full-length HA sequence from A / Darwin / 9 / 2021 H3N2 and is also referred to as A / Darw21 or H3Darw21 or Dar21.

[0035] SEQ ID NO:3 Mut10 amino acid sequence – the H1 Brisbane 18 wild-type sequence with the mutations shown in Table 1. It contains a signal sequence, foldon, and poly-H tail.

[0036] SEQ ID NO:4 Mut17 amino acid sequence - the H1 Brisbane 18 wild-type sequence with the mutations shown in Table 1. It contains a signal sequence, foldon, and poly-H tail.

[0037] SEQ ID NO:5 Mut18 amino acid sequence - the H1 Brisbane 18 wild-type sequence with the mutations shown in Table 1. It contains a signal sequence, foldon, and poly-H tail.

[0038] SEQ ID NO:6 Mut23 amino acid sequence - the H1 Brisbane 18 wild-type sequence with the mutations shown in Table 1. It contains a signal sequence, foldon, and poly-H tail.

[0039] SEQ ID NO:7 Mut24 Amino Acid Sequence - H1 Brisbane 18 wild-type sequence with the mutations shown in Table 1. Contains a signal sequence, foldon, and poly-H tail.

[0040] SEQ ID NO:8 Mut27 Amino Acid Sequence - H1 Brisbane 18 wild-type sequence with the mutations shown in Table 1. Contains a signal sequence, foldon, and poly-H tail.

[0041] SEQ ID NO:9 Foldon Sequence

[0042] SEQ ID NO:10 Signal Peptide from H1 Brisbane 18

[0043] SEQ ID NO:11 Nucleotide Sequence Encoding Mut10

[0044] SEQ ID NO:12 Nucleotide Sequence Encoding Mut17

[0045] SEQ ID NO:13 Nucleotide Sequence Encoding Mut18

[0046] SEQ ID NO:14 Nucleotide Sequence Encoding Mut23

[0047] SEQ ID NO:15 Nucleotide Sequence Encoding Mut24

[0048] SEQ ID NO:16 Nucleotide Sequence Encoding Mut27

[0049] SEQ ID NO:17 Flu622 Amino Acid Sequence – H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0050] SEQ ID NO:18 Flu629 Amino Acid Sequence – H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0051] SEQ ID NO:19 Flu632 Amino Acid Sequence – H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0052] SEQ ID NO:20 Flu638 Amino Acid Sequence – H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0053] SEQ ID NO:21 Flu639 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0054] SEQ ID NO:22 Flu643 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0055] SEQ ID NO:23 Flu650 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0056] SEQ ID NO:24 Flu672 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0057] SEQ ID NO:25 Flu679 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0058] SEQ ID NO:26 Flu680 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0059] SEQ ID NO:27 Flu681 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0060] SEQ ID NO:28 Flu682 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0061] SEQ ID NO:29 Flu683 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0062] SEQ ID NO:30 Flu685 Amino Acid Sequence - H3 Darw21 Wild-Type Sequence with the Mutations Shown in Table 3. Contains a Signal Sequence, a Foldon, and a Poly-H Tail.

[0063] SEQ ID NO:31 Flu686 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0064] SEQ ID NO:32 Flu687 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0065] SEQ ID NO:33 Flu688 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0066] SEQ ID NO:34 Flu689 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0067] SEQ ID NO:35 Flu690 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0068] SEQ ID NO:36 Flu691 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0069] SEQ ID NO:37 Flu692 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0070] SEQ ID NO:38 Flu693 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0071] SEQ ID NO:39 Flu695 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0072] SEQ ID NO:40 Flu696 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0073] SEQ ID NO:41 Flu697 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0074] SEQ ID NO:42 Flu707 Amino Acid Sequence - H3 Darw21 wild-type sequence with the mutations shown in Table 3. Contains a signal sequence, foldon, and poly-H tail.

[0075] SEQ ID NO:43 Signal Peptide from H3 Darw21

[0076] SEQ ID NO:44 Nucleotide Sequence Encoding Flu622

[0077] SEQ ID NO:45 Nucleotide Sequence Encoding Flu629

[0078] SEQ ID NO:46 Nucleotide Sequence Encoding Flu632

[0079] SEQ ID NO:47 Nucleotide Sequence Encoding Flu638

[0080] SEQ ID NO:48 Nucleotide Sequence Encoding Flu639

[0081] SEQ ID NO:49 Nucleotide Sequence Encoding Flu643

[0082] SEQ ID NO:50 Nucleotide Sequence Encoding Flu650

[0083] SEQ ID NO:51 Nucleotide Sequence Encoding Flu672

[0084] SEQ ID NO:52 Nucleotide Sequence Encoding Flu679

[0085] SEQ ID NO:53 Nucleotide Sequence Encoding Flu680

[0086] SEQ ID NO:54 Nucleotide Sequence Encoding Flu681

[0087] SEQ ID NO:55 Nucleotide Sequence Encoding Flu682

[0088] SEQ ID NO:56 Nucleotide Sequence Encoding Flu683

[0089] SEQ ID NO:57 Nucleotide Sequence Encoding Flu685

[0090] SEQ ID NO:58 Nucleotide Sequence Encoding Flu686

[0091] The nucleotide sequence of SEQ ID NO:59 encodes Flu687

[0092] The nucleotide sequence of SEQ ID NO:60 encodes Flu688

[0093] The nucleotide sequence of SEQ ID NO:61 encodes Flu689

[0094] The nucleotide sequence of SEQ ID NO:62 encodes Flu690

[0095] The nucleotide sequence of SEQ ID NO:63 encodes Flu691

[0096] The nucleotide sequence of SEQ ID NO:64 encodes Flu692

[0097] The nucleotide sequence of SEQ ID NO:65 encodes Flu693

[0098] The nucleotide sequence of SEQ ID NO:66 encodes Flu695

[0099] The nucleotide sequence of SEQ ID NO:67 encodes Flu696

[0100] The nucleotide sequence of SEQ ID NO:68 encodes Flu697

[0101] The nucleotide sequence of SEQ ID NO:69 encodes Flu707

[0102] SEQ ID NO:70 H1(Bri18) wild-type – foldon polypeptide sequence: signal sequence – HA – TEV cleavage site – foldon – His tag

[0103] SEQ ID NO:71 H3(Darw21) wild-type – foldon polypeptide sequence: signal sequence – HA – TEV cleavage site – foldon – His tag

[0104] SEQ ID NO:72 HA sequence from shown in Figure Figure 2 The HA sequence from Bri18 shown, which does not contain the native linker and transmembrane and cytoplasmic regions present in the full-length sequence

[0105] SEQ ID NO:73 Figure 2 The HA sequence from Darw21 shown, which does not contain the native linker and transmembrane and cytoplasmic regions present in the full-length sequence Brief Description of the Drawings

[0106] Figure 1 : The full-length sequence of the wild-type HA polypeptide of A / Brisbane / 02 / 2018 (H1N1)pdm09-like virus (H1 Bri18 , also referred to herein as Bri18), is shown in order: signal peptide (absent in the mature protein) - HA1 chain - HA1 / HA2 cleavage site - HA2 chain – region removed in the construct as described herein within the dashed square, including the transmembrane domain (dark background) and cytoplasmic domain. The positions of individual amino acids mutated in various combinations in certain constructs described herein are shaded in both the HA1 and HA2 chains.

[0107] Figure 2 : Sequence comparison showing the extracellular domain HA sequences of the H1 strain Bri18 and the H3 strain H3-Darw21, where the positions of mutations (amino acid substitutions) are indicated by triangles / asterisks / cross symbols, and regions A, B, and C are indicated by different underlines.

[0108] Figure 3 : H1 / H3 wild-type HA extracellular domain-foldon polypeptide sequences showing the linker, TEV cleavage site, foldon, and polyHis tail; (a) H1 (Bri18) wild-type HA extracellular domain-foldon sequence and (b) H3 (Darw21) wild-type HA extracellular domain-foldon sequence.

[0109] Figure 4 : Schematic diagrams of wild-type and recombinant H1 and H3 HAs, shown in order:

[0110] ● signal peptide - stalk, head, stalk of HA1 - stalk of HA2 - linker (native) - transmembrane domain - cytoplasmic tail (wild-type); and

[0111] ● signal peptide - stalk, head, stalk of HA1 - stalk of HA2 - linker (recombinant) - TEV cleavage site - linker (recombinant) – foldon - His tag (recombinant).

[0112] Figure 5 : Ribbon structures of the extracellular domains of H1 and H3 HAs (Bri18 and Darw21, respectively), shown as monomers separated from the trimeric molecule to indicate the positions of mutations in regions A and B of the coiled-coil region of the stalk domain. The positions of helix A and helix B are shown in the H1 monomer and the H3 monomer, respectively; both helices are present at the same position in each monomer.

[0113] Figure 6 : Ribbon structures of the extracellular domain trimers of H1 and H3 HAs (Bri18 and Darw21), showing the head domain and the stalk domain, including regions A, B, and C of the stalk domain.

[0114] Figure 7: Anti-HA functional HI responses induced by HA mut 10 and / 23 against homologous H1N1 strains and post-pandemic heterologous H1N1 strains 14 days after dose 2

[0115] Figure 8: Anti-HA IgG antibody and functional antibody responses induced by HA mut 10 and / 23 against heterologous H1N1 strains 14 days after dose 2

[0116] Figure 9: Anti-H1 stem-specific CD4 and CD8 T cell responses induced by HA mut 10 and / 23 14 days after dose 2

[0117] Figure 10: Anti-HA IgG antibody responses induced by HA mut 10 and / 23 against pre-pandemic heterologous H1N1 strains and heterosubtypic (H2N2, H5N1, and H9N2) strains 14 days after dose 2

[0118] Figure 11: Anti-HA functional HI responses induced by HA mut 10 and / 23 against pre-pandemic heterologous H1N1 strains and heterosubtypic (H2N2, H5N1, and H9N2) strains 14 days after dose 2

[0119] Figure 12: Neutralization titers induced by HA mut 10 and / 23 against heterosubtypic (H2N2, H5N1, and H9N2) strains 14 days after dose 2

[0120] Figure 13: Anti-HA IgG antibody responses induced by HA mut 10 and / 23 against group A2 (H3N2, H10 stem) or B lineage (B / Yam and B / Vic) strains 14 days after dose 2 DETAILED DESCRIPTION

[0121] Influenza HA extracellular domain

[0122] The recombinant influenza A virus HA antigen provided herein comprises an HA extracellular domain containing both the head domain and the stem domain of HA. Thus, the HA antigen is not a stem-only (or headless HA stem) antigen. The recombinant influenza HA antigen has advantageous properties such as providing a soluble HA composition. HA lacking a transmembrane domain does not insert into the membrane and is thus soluble rather than membrane-bound. In contrast, for nucleic acid delivery, the recombinant HA antigen can be linked to a transmembrane domain to provide an antigen that does not insert into the membrane in vivo.

[0123] Influenza virus HA is a homotrimeric surface glycoprotein. Each monomer consists of two subunits, HA1 and HA2, linked by two disulfide bonds. These subunits HA1 and HA2 are produced by proteolytic cleavage of a single HA precursor protein, HA0. HA1 contains all the residues at the N-terminus of the HA1 / HA2 cleavage peptide in the precursor HA0 protein and includes the receptor-binding domain of the HA protein. The HA2 chain contains all the residues at the C-terminus of the HA1 / HA2 cleavage peptide in the precursor HA0 protein, including a hydrophobic peptide responsible for insertion into the host cell membrane during membrane fusion, a transmembrane domain across the viral membrane, and a cytoplasmic tail. For example, for the H1 strain Bri18, HA1 refers to the region of the HA protein containing approximately amino acid residues 1 - 344 from the HA0 protein, while HA2 refers to the region of the HA protein containing approximately amino acid residues 345 - 566 from the HA0 polypeptide. When referring to the chains independently, the residues within the HA2 chain are usually numbered independently of those in HA1, such that for Bri18, for example, the HA2 residues can be numbered 1 - 174.

[0124] The HA head domain is the globular head region of the HA protein and does not include the stem, transmembrane domain, and cytoplasmic region. The HA head is formed by a portion of approximately 250 - 300 amino acid residues in the center of the HA1 sequence. The HA head consists of a receptor-binding domain and a residual esterase domain. It contains a sialic acid-binding pocket that mediates the attachment of the virus to the host cell.

[0125] The influenza HA stem domain is located in the membrane-proximal region of the native HA protein, directly below the residual esterase domain of the HA1 globular head. The influenza HA stem is composed of amino acid residues from the two termini of the HA1 chain and the extracellular domain portion of the HA2 chain. For example, for the H1 strain Bri18, the HA stem contains residues approximately 18 - 58 and 293 - 344 from the HA1 chain and residues 1 - 222 (or 1 - 176 for only the extracellular domain portion) of the HA2 chain. The stem domain does not include the transmembrane domain or the cytoplasmic domain.

[0126] In one embodiment, the head domain and the stem domain are from the same influenza strain.

[0127] In one embodiment, the recombinant HA extracellular domain antigen is a homotrimer, i.e., a trimer formed by three identical HA extracellular domain monomers.

[0128] In one embodiment, the recombinant HA antigen further comprises a heterotrimerization domain that can be fused (e.g., covalently linked) to the C-terminus. In another embodiment, the recombinant HA antigen is a trimeric antigen from which the trimerization domain (such as the heterotrimerization domain) has been removed. In another embodiment, the recombinant HA antigen is expressed in the absence of the trimerization domain.

[0129] In one embodiment, the C-terminus of the stem domain:

[0130] (1) is covalently linked to a heterotrimerization domain; or

[0131] (2) is covalently linked to a carrier protein or nanoparticle; or

[0132] (3) is not covalently linked to another amino acid molecule.

[0133] In one embodiment, the extracellular domain of the recombinant HA comprises all or substantially all of the globular head domain. Substantially all of the globular head domain represents at least 75% or at least 85% or at least 95% or at least 99% of the length of the amino acid sequence present in the wild-type influenza HA head domain.

[0134] In one embodiment, the extracellular domain of the recombinant HA comprises all or substantially all of the stem domain. Substantially all of the stem domain represents at least 75% or at least 85% or at least 95% or at least 99% of the length of the amino acid sequence present in the wild-type influenza HA stem domain.

[0135] In one embodiment, the extracellular domain of the recombinant HA comprises all or substantially all, such as at least 75% or at least 85% or at least 95% or at least 99%, of the amino acid sequence present in the wild-type influenza HA head domain, and all or substantially all, such as at least 75% or at least 85% or at least 95% or at least 99%, of the amino acid sequence present in the wild-type influenza HA stem domain.

[0136] In one embodiment, the extracellular domain of the recombinant HA comprises all or substantially all, such as at least 75% or at least 85% or at least 95% or at least 99%, of the amino acid sequence present in the wild-type influenza HA extracellular domain.

[0137] In one embodiment, the recombinant HA antigen comprises amino acid residues 1-520 of influenza A HA, or an immunogenic fragment or derivative thereof having both a head domain and a stem domain.

[0138] The full-length sequence of the HA polypeptide from the H1 influenza strain A / Brisbane / 02 / 2018 (H1N1)pdm09-like virus (H1 Bri18 ) is also referred to herein as Bri18 and is used herein as a reference sequence. This sequence is shown in Figure 1 and SEQ ID NO:1. The full-length sequence of the HA polypeptide from the H3 influenza strain A / Darwin / 9 / 2021 H3N2 is also referred to herein as Darw21 and is also used herein as a reference sequence. This sequence is shown in Figure 2(The extracellular domain) is compared with the sequence of Bri18 and is within SEQ ID NO:2 (full length). The specific amino acid sequences and positions of the HA of the influenza A virus strains mentioned herein are related to these reference sequences. However, it is clear that for other influenza A isolates and sequences, especially those from different subtypes, the numbering and / or amino acids at specific positions may be different, and the equivalent sequences and positions in these other isolates and sequences are also included within the scope of the polypeptide and polynucleotide constructs described herein. From the description and figures provided herein, those skilled in the art will be clear about these equivalent sequences and positions in other influenza A isolates.

[0139] The two virus strains shown here are from two different subtypes, H1 and H3, and these subtypes are from two different groups (or clades) of influenza A, called Group 1 and Group 2 (also known as Group A1 and Group A2). Figure 1 The full-length Bri18 HA sequence shown in SEQ ID NO:1 contains a signal sequence, HA1, HA2, a transmembrane region, and a cytoplasmic region. In the literature, the numbering of HA usually uses the H3 influenza as a reference sequence. However, since the starting point in this case is the HA sequence from an influenza H1 virus strain, this convention is not followed. It is clear that through sequence comparison with reference sequences and / or structural comparison, the equivalent positions in the extracellular domain of HA from other virus strains can be located. For example, Figure 2 shows the sequence alignment of the extracellular domain of HA from the virus strain Bri18 (which is an H1 virus strain from Group 1 of influenza A) with the extracellular domain of HA from Darw21 (which is an H3 virus strain from Group 2 of influenza A), including the positions of certain stabilizing mutations in these two sequences. Figure 5 shows the structural comparison of the monomers of each HA trimer from the same two H1 and H3 virus strains in the form of a ribbon diagram, indicating the positions of the equivalent stabilizing mutations of the HA from these two virus strains described herein. The structural comparison can be in two-dimensional form as shown in Figure 5 or three-dimensional form, or both.

[0140] In one embodiment, the extracellular domain of the HA contains all of HA1 and all of HA2 of the influenza HA without the transmembrane domain and the cytoplasmic region, or an immunogenic fragment or derivative thereof having a head and a stem domain. In a specific embodiment, the extracellular domain of the HA contains amino acid residues 1 - 520 of the influenza HA from Bri18 or an equivalent sequence containing all of HA1 and all of HA2 of the HA from another influenza A virus strain, or an immunogenic fragment or derivative thereof having a head and a stem domain.

[0141] The recombinant influenza A virus HA antigens described herein have been found to have a number of useful properties. One advantage relates to the nature of the extracellular domain antigen, which has the antigenic properties of the HA stem while also retaining the antigenic properties of the HA globular head. In addition, mutations that stabilize the coiled coil of the recombinant HA antigen can, in some cases, allow for the removal of the trimerization domain used to produce the recombinant HA (as shown herein for H1), or potentially allow for the expression of the recombinant antigen in the absence of the trimerization domain (e.g., for H3). Due to the absence of the HA transmembrane and cytoplasmic regions, the recombinant extracellular domain is soluble and easy to purify upon expression. The stabilizing mutations identified herein improve the manufacturability attributes of the recombinant HA, such as yield and thermal stability. In addition, by stabilizing the structure of the trimer in the native pre-fusion state, the antigenic properties of the HA are optimized to generate an immune response that recognizes the virus when encountered in vivo with wild-type influenza virus. This immune response has been shown to be directed not only against the influenza strain from which the HA of the recombinant antigen is derived, but also against other influenza strains, including strains from different influenza A subtypes.

[0142] In one embodiment, the influenza HA antigens described herein are capable of binding to antibodies directed against at least one epitope (suitably a neutralizing epitope) on wild-type HA. Thus, the modifications to wild-type influenza HA in the antigens described herein preserve the conformation of at least one wild-type HA epitope (suitably a neutralizing epitope). In one embodiment, the recombinant influenza HA antigen retains one or more epitopes present in the wild-type, suitably CR9114 or FI6, or more suitably both the CR9114 and FI6 epitopes.

[0143] Compared to the wild-type HA amino acid sequence, the recombinant influenza A HA antigens described herein contain mutations, such as amino acid deletions, substitutions (e.g., single amino acid substitutions), or additions. For the purposes herein, a substitution refers to the replacement of a wild-type amino acid with any other amino acid at the same amino acid position. In one embodiment, the one or more mutations stabilize the antigen in the correct conformation such that it is capable of eliciting an immune response against native HA. In one embodiment, the one or more mutations stabilize the antigen in the trimeric form. In one embodiment, the one or more mutations stabilize the antigen in the pre-fusion form.

[0144] Typically, compared to native HA, the recombinant influenza HA antigens described herein contain multiple amino acid substitutions (e.g., single amino acid substitutions), such as up to 4 or up to 6 or up to 8 or up to 10 amino acid substitutions, e.g., 1 to 4 or 1 to 6 amino acid substitutions, e.g., 1, 2, 3, 4, 5, or 6 amino acid substitutions. Typically, these amino acid substitutions (e.g., single amino acid substitutions) are in HA2. One or more amino acid substitutions may also be present in HA1, particularly one amino acid substitution in HA1. In one embodiment, there is one amino acid substitution in HA1 and one or two or three or four amino acid substitutions in HA2.

[0145] In one embodiment, the recombinant HA extracellular domain antigen does not contain additional elements of HA, such as a transmembrane region or a cytoplasmic region. In one embodiment, due to the absence of a transmembrane region or the absence of both a transmembrane region and a cytoplasmic region, the HA antigen is not membrane-bound. In an alternative embodiment for nucleic acid delivery, the HA antigen delivered by a nucleic acid delivery platform (such as mRNA) contains a transmembrane region, such as an HA transmembrane region, with or without a cytoplasmic region. For the H1 HA sequence shown herein, the transmembrane region of the influenza A strain HA is located at approximately amino acid positions 530 - 550, and the cytoplasmic tail is located at approximately positions 551 - 566. See Figure 4 the schematic diagram in

[0146] Pre-fusion conformation

[0147] The influenza HA antigen is suitably stabilized in a pre-fusion conformation or state. Stabilization is achieved by stabilization mutations in the coiled-coil region that stabilize the HA trimer, such as one or more amino acid substitutions, e.g., single amino acid substitutions. The presence of a trimerization domain can additionally contribute to stabilization. Once the trimerization domain is removed after expression of the recombinant HA antigen (e.g., by enzymatic cleavage), mutations in the coiled-coil region (such as one or more amino acid substitutions, e.g., single amino acid substitutions) can potentially stabilize the HA. Thus, in one embodiment, the HA antigen is expressed together with a trimerization domain that is removed after expression. In a specific embodiment, the HA antigen is an extracellular domain antigen without a trimerization domain, more specifically an extracellular domain antigen expressed together with a trimerization domain, and the trimerization domain is cleaved (e.g., enzymatically cleaved) from the extracellular domain antigen after expression.

[0148] Stabilization can be achieved, for example, by helix stabilization, loop optimization, disulfide bond addition, and side-chain repacking. Stabilization of HA can be achieved by introducing mutations that form or strengthen ionic bonds, salt bridges, or improve hydrophobic packing or cavity filling (e.g., amino acid substitutions, such as single amino acid substitutions). Hydrophobic packing promotes and / or drives the association of hydrophobic regions together to exclude water. Cavity filling fills the unoccupied cavity volume buried within the hemagglutinin protein (i.e., within the monomer) or at the interface of the hemagglutinin protein (i.e., between monomers in the trimer) by introducing amino acids that fill such space (e.g., amino acid substitutions, such as single amino acid substitutions), and allows and / or promotes good folding / packing and avoids water being encapsulated or incorporated into the folding of the protein. This can be achieved, for example, by substituting an amino acid with a very small side chain (e.g., (but not limited to) serine) with an amino acid with a larger side chain. Stabilization of the homotrimeric HA antigen can be evaluated by characterization studies such as those described in the examples. In one embodiment, stabilization in the pre-fusion form is evaluated by determining the presence of trimeric HA. Alternatively or additionally, stabilization in the pre-fusion form is evaluated by determining the presence of epitopes (such as the CR9114 and / or FI6 epitopes (e.g., FI6v3)), for example, by means of an mAb binding assay.

[0149] The pre-fusion conformation of HA is discussed in the literature, for example, Wu & Wilson, Viruses, 2020, 12:1053 and Ni et al. 2014. Stabilizing mutations are discussed in the literature, for example, Yassine et al., Nature Medicine, 2015, 21(9):1065 - 1070.

[0150] It should be understood that additional alterations may be present in the head region and / or the stem region or both, compared to wild-type HA, which will not have a negative impact on the recombinant influenza HA described herein or will further optimize the recombinant influenza HA described herein. For example, amino acid insertions, deletions, or substitutions can be made that do not disrupt the pre-fusion conformation of HA or have a negative impact on the antigenic properties of the HA described herein. Such amino acid substitutions, deletions, or insertions can be used, for example, to alter the properties of one or more epitopes of HA in the globular head or stem region or both.

[0151] Stabilizing mutations

[0152] Stabilization can be determined by observing one or more different parameters after expression and purification, such as the productivity (yield) of recombinant antigen expression relative to that of the wild-type antigen during recombinant expression. Higher productivity is generally associated with more stable folding of the recombinant protein. Alternatively or additionally, structural analysis such as nanoDSF and / or stress testing can be performed to confirm improved folding stability. Stress testing includes, for example, thermal stability testing, such as evaluating the degradation and / or aggregation levels of the recombinant antigen after one week at room temperature or 37 °C. Alternatively or additionally, stabilization can be evaluated by the presence of trimers and / or by examining the presence of epitopes present on native HA, such as CR9114 and FI6 (such as FI6v3). Suitably, the stabilized HA antigen will be equal to or better than the wild-type recombinant HA in terms of at least one parameter, suitably two or more parameters, where such parameters are selected from the parameters described herein, such as the yield after expression, folding stability as measured by nanoDSF, stress testing (such as thermal stability testing), the presence of trimers, and the presence of CR9114 and / or FI6 (such as FI6v3) epitopes as measured by binding to CR9114 and / or FI6 (such as FI6v3) antibodies.

[0153] The influenza HA trimeric antigens described herein can be stabilized by introducing mutations in the coiled-coil region, which are suitably site-specific mutations, such as individual amino acid substitutions, additions, or deletions designed to confer increased stability to the HA antigen or trimer. These can be mutations in the center of the coiled coil or in regions closely surrounding the center of the coiled coil. In one embodiment, the HA antigen comprises one or more stabilizing mutations in the helical structure of the coiled coil, such as helix A or helix B of pre-fusion influenza HA, see Figure 5 , where helix A is the smaller helix in each monomer and helix B is the larger helix. In another embodiment, the HA antigen comprises one or more stabilizing mutations in one or more of regions A, B, and C. Figure 2 , Figure 4 , Figure 5 and Figure 6 illustrate regions A, B, and C associated with H1 and H3 strains in

[0154] In one embodiment, the coiled-coil region of the stem domain containing one or more mutations is 317 to 472 of H1, such as 322 to 467; or 342 to 473 of H2, such as 347 to 468; or an equivalent range of the coiled-coil region of other HA influenza A strains or subtypes.

[0155] For example, it has been found that mutations (e.g., single amino acid substitutions) at one or more positions among positions 322, 395, 431, 432, 436, 438, 439, 447, 449, 450, 453, 460, 464, and 467 of the HA from the H1 subtype (more specifically, strain Bri18) can help stabilize the extracellular domain of HA. Similarly, it has been found that mutations (e.g., single amino acid substitutions) at one or more positions among positions 347, 396, 399, 418, 428, 437, 440, 448, 451, 454, 465, and 468 of the HA from the H3 subtype (more specifically, strain Darw21) can help stabilize the extracellular domain of HA. Specifically, it has been found that amino acid substitutions at position 395 and optionally at positions 322, 436, and 447 can have beneficial effects on recombinant HA from H1 strains, such as increasing yields. Similarly, it has been found that amino acid substitutions at one or more positions selected from 396, 399, 418, 437, and 448 can have beneficial effects on recombinant HA from H3 strains. For example, it has been found that a mutation (e.g., a single amino acid substitution) at position 395 of the HA from the H1 subtype, in particular the K395M substitution (e.g., the H1 construct from strain Bri18, herein referred to as Mut10), or a mutation (e.g., a single amino acid substitution) at position 396 of the HA from the H3 subtype, in particular the K396V / L / I / M substitution, helps to stabilize the extracellular domain trimer. This mutation (395 / 396, depending on the strain) is in a smaller α-helix adjacent to the coiled coil, herein referred to as helix A (see the smaller helix depicted in Figure 5 the depiction of the HA monomer). It has also been found that the K395M substitution in the H1 subtype combined with three other substitutions: K322R, W436D, and E447L (herein referred to as Mut23) provides beneficial effects particularly on protein yield. The exemplary H1HA extracellular domain antigens Mut10 and Mut23 described herein have been shown to stimulate a broad anti-HA response against different influenza strains within the H1 subtype and against different influenza strains from other subtypes within group 1, such as H2, H5, and H9.

[0156] Similarly, combinations of substitutions at some equivalent positions in H3 (K396V / L / I / M, W437D, and E448V / L / I / M) with the further substitution R399L / I / M / F stabilize the extracellular domain of this subtype.

[0157] In one embodiment, compared to wild-type HA, the influenza HA antigen comprises one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, or fourteen of the following amino acid substitutions: K322R, K395M, G431C, F432C, W436D, Y438D, N439L, E447L, E449Q, R450W, D453L, K460I, E464F, and R467M, particularly one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine of the following amino acid substitutions compared to wild-type HA: K322R, K395M, W436D, N439L, E447L, E449Q, R450W, D453L, and K460I. In one embodiment, the recombinant H1 HA antigen contains one or more, two or more, three or more, four or more, five or more, six or more, seven or more, or eight of the following mutations: K322R, G431C, F432C, W436D, Y438D, K460I, E464F, and R467M. In certain embodiments, the HA is from H1.

[0158] In one embodiment, compared to wild-type HA, the recombinant HA extracellular domain contains K395M and one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, or thirteen of the following mutations (e.g., amino acid substitutions): K322R, G431C, F432C, W436D, Y438D, N439L, E447L, E449Q, R450W, D453L, K460I, E464F, and R467M. In one embodiment, compared to wild-type, the recombinant HA extracellular domain contains K395M and one or more, two or more, three or more, four or more, five or more, six or more, seven or more, or eight of the following mutations (e.g., amino acid substitutions): K322R, G431C, F432C, W436D, Y438D, K460I, E464F, and R467M. In certain embodiments, the HA is from H1.

[0159] In certain embodiments, the antigen is from H1 and comprises a mutation or combination of mutations shown in Table 1 or Table 2. Examples of other HA antigens comprising the mutations of Table 1 are described in Table 2 and in the Examples, including, for example, the combinations listed in Table 1 below for the specific HA extracellular domain constructs Mut10, Mut17, Mut18, Mut23, Mu24, and Mu27.

[0160] Table 1

[0161] K322R K395M W436D N439L E447L E449Q R450W D453L K460I Mut10 √ Mut17 √ √ √ √ √ Mut18 √ Mut23 √ √ √ √ Mut24 √ √ √ √ √ √ Mut27 √ √ √ √ √ √ √ √

[0162] Table 2

[0163]

[0164]

[0165] The mutations in H1 described in Tables 1 and 2 and the mutations in H3 similarly described in Table 3 target different regions or areas of HA, which are located with reference to Figure 2 、 Figure 4 、 Figure 5 and Figure 6 the amino acid sequences and HA structure diagrams annotated in:

[0166] (i) Region A, which is the membrane-distal fusion domain region;

[0167] (ii) Region B, which is the central fusion domain region; and

[0168] (iii) Region C, which is the fusion peptide / membrane-proximal fusion domain region.

[0169] In one embodiment, the influenza HA antigen comprises one or more Region A mutations, such as substitutions (e.g., single amino acid substitutions) at one or more positions selected from 322 / 323 and 436 / 437.

[0170] In another embodiment, the antigen comprises one or more Region B mutations, such as substitutions (e.g., single amino acid substitutions) at one or more positions selected from 395 / 396 and 447 / 448. In a specific embodiment with reference to the numbering of the H3 strain Darw21 described herein, the antigen comprises a combination of Region B mutations, such as substitutions (e.g., single amino acid substitutions) at each of positions 396, 399, and 448 and optionally position 437.

[0171] In another embodiment, the antigen comprises one or more Region C mutations, such as substitutions (e.g., single amino acid substitutions) at positions in Region C.

[0172] In a further embodiment, the antigen comprises one or more mutations, such as single amino acid substitutions from each of regions A and B, or from each of regions A and C, or from each of regions B and C, or from combinations of each of all three regions A, B, and C.

[0173] In the following embodiments, the numbering refers to an influenza A strain in which the amino acid positions are mapped according to the H1 sequence Bri18 described herein.

[0174] In one embodiment, the recombinant HA extracellular domain contains the K395M mutation and no other mutations in the coiled-coil region (such as Mut10).

[0175] In one embodiment, the recombinant HA extracellular domain contains the K322R, K395M, W436D, and E447L mutations and no other mutations in the coiled-coil region (such as Mut23 of H1).

[0176] In one embodiment, the recombinant HA extracellular domain contains the K395M mutation and an additional mutation selected from K322R, W436D, and E447L, and no other mutations in the coiled-coil region.

[0177] In one embodiment, the recombinant HA extracellular domain contains the K395M mutation and two additional mutations selected from K322R, W436D, and E447L, and no other mutations in the coiled-coil region.

[0178] In one embodiment, the recombinant HA extracellular domain contains the K322R and K395M mutations and no other mutations in the coiled-coil region.

[0179] In one embodiment, the recombinant HA extracellular domain contains the K395M and W436D mutations and no other mutations in the coiled-coil region.

[0180] In one embodiment, the recombinant HA extracellular domain contains the K395M and E447L mutations and no other mutations in the coiled-coil region.

[0181] In one embodiment, the recombinant HA extracellular domain contains the K322R, K395M, and W436D mutations and no other mutations in the coiled-coil region.

[0182] In one embodiment, the recombinant HA extracellular domain contains the K322R, K395M, and E447L mutations and no other mutations in the coiled-coil region.

[0183] In one embodiment, the recombinant HA extracellular domain contains the K395M, W436D, and E447L mutations and no other mutations in the coiled-coil region.

[0184] In the following embodiments, the numbering refers to the influenza A virus strains in which the amino acid positions are mapped according to the H3 sequence Darw21 described herein.

[0185] In one embodiment, the recombinant HA extracellular domain contains the V418P mutation and no other mutations in the coiled-coil region (e.g., Flu639 of H3).

[0186] In one embodiment, the recombinant HA extracellular domain contains the V418P mutation and the W437D mutation, and no other mutations in the coiled-coil region (e.g., Flu707 of H3).

[0187] In one embodiment, the recombinant HA extracellular domain contains the K396I / L, R399F / L, and E448L / I mutations, with or without the W437D mutation, and no other mutations in the coiled-coil region (e.g., Flu632, Flu680, Flu689 of H3). In a specific embodiment, the recombinant HA extracellular domain contains the K396I, R399F, and E448L mutations and no other mutations in the coiled-coil region (e.g., Flu632 of H3); or contains the K396L, R399L, W437D, and E448I mutations and no other mutations in the coiled-coil region (e.g., Flu680 of H3); or contains the K396L, R399F, W437D, and E448L mutations and no other mutations in the coiled-coil region (e.g., Flu689 of H3).

[0188] In certain embodiments, the antigen contains the mutations or combinations of mutations shown in Table 3. Examples of HA antigens containing the mutations in Table 3 are described in the Examples, including, for example, the combinations listed in Table 3 below for the specific HA extracellular domain constructs Flu622, Flu629, Flu632, Flu638, Flu639, Flu643, Flu650, Flu672, Flu679, Flu680, Flu681, Flu682, Flu683, Flu685, Flu686, Flu687, Flu688, Flu689, Flu690, Flu691, Flu692, Flu693, Flu695, Flu696, Flu697, and Flu707.

[0189] Table 3

[0190]

[0191]

[0192] It is clear that equivalent positions of substitutions and other mutations in the HA extracellular domain from influenza virus strains other than Bri18 or Darw21 (such as but not limited to other H1 strains or other H3 strains) are also included within the scope hereof. These equivalent positions can be located by reference to sequence comparisons with the Bri18 HA or Darw21 sequences shown herein, similar to Figure 2 the sequence comparisons illustrated. Equivalent positions of stabilizing mutations in the HA extracellular domain from other influenza virus strains can alternatively or additionally be identified using structural comparisons. Figure 5 The ribbon diagrams illustrated are one such structural comparison, showing a comparison of H1 and H3 (Bri18 and Darw21) monomers, where the structural positions of stabilizing mutations are indicated. Other structural comparisons can involve three-dimensional comparisons. Sequence comparisons can be used to determine equivalent positions, followed by confirmation using structural comparisons, or vice versa.

[0193] In one embodiment, the mutations introduced into the HA extracellular domain as described herein (such as single amino acid substitutions) do not create disulfide bonds.

[0194] The influenza HA antigen can be included in constructs containing other polypeptide sequences. These other polypeptide sequences can include, for example, one or more signal peptides. In some embodiments, the signal peptide is not present in the final construct or composition or method or use of the HA antigen herein.

[0195] It is clear that the specific mutations described herein in the table can potentially be replaced with conservative amino acid substitutions, i.e., the substituted amino acid itself can be conservatively replaced with an amino acid having similar properties, which achieves similar stability.

[0196] As mentioned herein, a conservative amino acid substitution means that an amino acid residue is replaced with another amino acid residue having a chemically similar side chain (R group), and generally does not significantly alter the functional properties of the protein being substituted.

[0197] Examples of groups of conservative amino acid substitutions include:

[0198] (1) Basic side chains: arginine, histidine, and lysine;

[0199] (2) Acidic side chains: aspartate (aspartic acid) and glutamate (glutamic acid);

[0200] (3) Aromatic side chains: phenylalanine, tryptophan, and tyrosine;

[0201] (4) Amide-containing side chains: asparagine and glutamine;

[0202] (5) Sulfur-containing side chains: cysteine and methionine;

[0203] (6) Aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; and

[0204] (7) Aliphatic-hydroxy side chains: serine and threonine.

[0205] Examples of conservative amino acid substitutions include:

[0206] alanine-valine,

[0207] arginine-lysine,

[0208] aspartic acid-glutamic acid,

[0209] asparagine-glutamine,

[0210] isoleucine-leucine-valine, and

[0211] phenylalanine-tyrosine.

[0212] The percent sequence identity / similarity can be adjusted to account for the effects of conservative substitutions (see Pearson (1994) Methods Mol. Biol. 24:307-331).

[0213] In a specific embodiment, the HA antigen comprises or more suitably consists of the constructs described in Tables 1, 2, and 3, such as polypeptide sequences selected from SEQ ID NOs: 3 to 8 and SEQ ID NOs: 17-42 with or without a signal peptide, or a sequence having at least 85% identity or at least 87% identity or at least 90% identity, such as 95% or higher, such as 98% or higher, such as 99% or higher sequence identity with any one of the amino acid sequences of SEQ ID NOs: 3-8 and 17-42 with or without a signal peptide. In a further embodiment, the HA antigen comprises the polypeptide sequence of SEQ ID NOs: 3-8 or 17-42 with or without a signal peptide, wherein certain elements are absent, such as a His tag or a His tag and a trimerization domain.

[0214] For example, the HA antigen can comprise one of the following, each of which can be in its final form without a signal peptide:

[0215] · (1) The HA extracellular domain antigen containing the mutations of Mut10 shown in Table 1, suitably SEQ ID NO: 3, with or without a trimerization domain and a His tag;

[0216] ·(2) The extracellular domain antigen of HA containing the mutations of Mut17 shown in Table 1, suitably SEQ ID NO:4, with or without a trimerization domain and a His tag;

[0217] ·(3) The extracellular domain antigen of HA containing the mutations of Mut18 shown in Table 1, suitably SEQ ID NO:5, with or without a trimerization domain and a His tag;

[0218] ·(4) The extracellular domain antigen of HA containing the mutations of Mut23 shown in Table 1, suitably SEQ ID NO:6, with or without a trimerization domain and a His tag;

[0219] ·(5) The extracellular domain antigen of HA containing the mutations of Mut24 shown in Table 1, suitably SEQ ID NO:7, with or without a trimerization domain and a His tag;

[0220] ·(6) The extracellular domain antigen of HA containing the mutations of Mut27 shown in Table 1, suitably

[0221] SEQ ID NO:8, with or without a trimerization domain and a His tag; ●(7) The extracellular domain antigen of HA containing the mutations of Flu622 shown in Table 3, suitably

[0222] SEQ ID NO:17, with or without a trimerization domain and a His tag; ●(8) The extracellular domain antigen of HA containing the mutations of Flu629 shown in Table 3, suitably

[0223] SEQ ID NO:18, with or without a trimerization domain and a His tag; ●(9) The extracellular domain antigen of HA containing the mutations of Flu632 shown in Table 3, suitably

[0224] SEQ ID NO:19, with or without a trimerization domain and a His tag; ●(10) The extracellular domain antigen of HA containing the mutations of Flu638 as shown in Table 3,

[0225] suitably SEQ ID NO:20, with or without a trimerization domain and a His tag;

[0226] ·(11) The extracellular domain antigen of HA containing the mutations of Flu639 shown in Table 3, suitably

[0227] SEQ ID NO:21, with or without a trimerization domain and a His tag; ·(12) The extracellular domain antigen of HA containing the mutations of Flu643 shown in Table 3, suitably

[0228] Suitably SEQ ID NO:22, with or without a trimerization domain and a His tag; ·(13) The HA extracellular domain antigen containing the mutations of Flu650 shown in Table 3, combined

[0229] Suitably SEQ ID NO:23, with or without a trimerization domain and a His tag; ·(14) The HA extracellular domain antigen containing the mutations of Flu672 shown in Table 3, combined

[0230] Suitably SEQ ID NO:24, with or without a trimerization domain and a His tag; ·(15) The HA extracellular domain antigen containing the mutations of Flu679 shown in Table 3,

[0231] Suitably SEQ ID NO:25, with or without a trimerization domain and a His tag;

[0232] ·(16) The HA extracellular domain antigen containing the mutations of Flu680 shown in Table 3, combined

[0233] Suitably SEQ ID NO:26, with or without a trimerization domain and a His tag; ·(17) The HA extracellular domain antigen containing the mutations of Flu681 shown in Table 3, combined

[0234] Suitably SEQ ID NO:27, with or without a trimerization domain and a His tag; ·(18) The HA extracellular domain antigen containing the mutations of Flu682 shown in Table 3, combined

[0235] Suitably SEQ ID NO:28, with or without a trimerization domain and a His tag; ·(19) The HA extracellular domain antigen containing the mutations of Flu683 shown in Table 3,

[0236] Suitably SEQ ID NO:29, with or without a trimerization domain and a His tag;

[0238] ●(20) The HA extracellular domain antigen containing the mutations of Flu685 shown in Table 3,

[0239] Suitably SEQ ID NO:30, with or without a trimerization domain and a His tag;

[0240] ·(21) The HA extracellular domain antigen containing the mutations of Flu686 shown in Table 3, combined

[0241] Suitably SEQ ID NO:31, with or without a trimerization domain and a His tag; ·(22) The HA extracellular domain antigen containing the mutations of Flu687 shown in Table 3, combined

[0242] Suitably SEQ ID NO: 32, with or without a trimerization domain and His tag; · (23) HA extracellular domain antigen containing the mutations of Flu688 shown in Table 3, combined

[0243] Suitably SEQ ID NO: 33, with or without a trimerization domain and His tag; · (24) HA extracellular domain antigen containing the mutations of Flu689 shown in Table 3, combined

[0244] Suitably SEQ ID NO: 34, with or without a trimerization domain and His tag; · (25) HA extracellular domain antigen containing the mutations of Flu690 shown in Table 3,

[0245] Suitably SEQ ID NO: 35, with or without a trimerization domain and His tag;

[0246] ● (26) HA extracellular domain antigen containing the mutations of Flu691 shown in Table 3, combined

[0247] Suitably SEQ ID NO: 36, with or without a trimerization domain and His tag; ● (27) HA extracellular domain antigen containing the mutations of Flu692 shown in Table 3, combined

[0248] Suitably SEQ ID NO: 37, with or without a trimerization domain and His tag; · (28) HA extracellular domain antigen containing the mutations of Flu693 shown in Table 3,

[0249] Suitably SEQ ID NO: 38, with or without a trimerization domain and His tag;

[0250] · (29) HA extracellular domain antigen containing the mutations of Flu695 shown in Table 3,

[0251] Suitably SEQ ID NO: 39, with or without a trimerization domain and His tag;

[0252] · (30) HA extracellular domain antigen containing the mutations of Flu696 shown in Table 3, combined

[0253] Suitably SEQ ID NO: 40, with or without a trimerization domain and His tag; · (31) HA extracellular domain antigen containing the mutations of Flu697 shown in Table 3, suitably SEQ ID NO: 41, with or without a trimerization domain and His tag;

[0254] ·(32) The extracellular domain antigen of HA containing the mutations of Flu707 shown in Table 3, suitably SEQ ID NO:42, with or without a trimerization domain and a His tag;

[0255] In a further embodiment, particularly for nucleic acid delivery, the HA antigen comprises the polypeptide sequences of SEQ ID NOs: 3-8 and 17-42 with or without a signal peptide, or a sequence having at least 85% or at least 87% or at least 90% identity, such as 95% or higher, such as 98% or higher, such as 99% or higher sequence identity with any one of the amino acid sequences of SEQ ID NOs: 3-8 and 17-42, with or without a signal peptide, and without a trimerization domain, without a His tag, and further comprises a transmembrane domain (which may be homologous or heterologous and optionally trimeric), and an optional cytoplasmic domain. In a specific embodiment for nucleic acid delivery, the HA antigen comprises a polypeptide sequence selected from (1) to (32) above with or without a signal peptide, and without a trimerization domain or a His tag, and further comprises a transmembrane domain (homologous or heterologous) and an optional cytoplasmic region. In an embodiment for nucleic acid delivery, the transmembrane domain may be the HA transmembrane domain, such as the transmembrane domain from the influenza strain from which the antigen is derived, i.e., a homologous transmembrane domain. The cytoplasmic domain may be the HA cytoplasmic domain, such as the cytoplasmic domain from the influenza strain from which the antigen is derived, i.e., a homologous cytoplasmic domain. The purpose of the transmembrane domain and the cytoplasmic domain is to function as membrane anchors for the HA antigen.

[0256] Particles / nanoparticles, such as ferritin nanoparticles

[0257] The influenza HA antigens described herein can be presented on the surface of nanoparticles in a strategy called nanoparticle formation. In one embodiment, the extracellular domain antigen of influenza HA is presented on the surface of self-assembling protein nanoparticles, suitably ferritin nanoparticles, such as more suitably insect or bacterial ferritin nanoparticles, such as most suitably Helicobacter pylori (H. pylori) ferritin nanoparticles (such as those nanoparticles disclosed in Corbett et al. 2019, WO2013 / 044203, WO2015 / 183969, and WO2018 / 045308). It is obvious that alternative protein nanoparticles known in the art can also be used, such as but not limited to lumazine and encapsulin, or other protein nanoparticles, including artificially constructed protein nanoparticles.

[0258] In a specific embodiment, the influenza virus HA extracellular domain is fused to a heterologous polypeptide, such as ferritin. When ferritin is expressed in a fusion with the HA antigen, it can serve as a trimerization domain for the formation and / or stabilization of the HA trimer. Suitably, the heterologous polypeptide (such as ferritin) and the influenza HA extracellular domain monomer are linked by a linker.

[0259] Granulation techniques are well known, and the fusion strategies described herein (such as ferritin fusions) are just one example. Other suitable examples include conjugation, which can be achieved chemically or by using other protein ligation methods, such as the Streptococcus pyogenes - derived system called SpyTag / SpyCatcher. Multicomponent granulation techniques can also be applied, where more than one, such as two or more different influenza antigens are displayed. Examples include fusions with heterologous polypeptides (such as insect ferritin), or combinations of different antigens in nanoparticles by chemical conjugation. Insect ferritin can be engineered to display two different trimeric antigens in a defined ratio and geometry.

[0260] In a further embodiment, the influenza virus HA extracellular domain is in the form of a rosette structure, such as those described in WO2017 / 149054. In a specific embodiment, for the purpose of forming rosette structures in vivo or in vitro, the influenza virus HA extracellular domain is fused to a hydrophobic signal, such as a transmembrane domain (which can be a homologous or heterologous transmembrane domain) and a heterologous trimerization domain.

[0261] Immunogenic fragment

[0262] The influenza HA extracellular domain antigens described herein also encompass immunogenic fragments comprising the mutated HA extracellular domain regions described herein. In one embodiment, the influenza HA extracellular domain is a polypeptide consisting of the influenza HA extracellular domain antigen described herein or an immunogenic fragment thereof containing the head and stem domains and one or more mutations (such as amino acid substitutions) described herein.

[0263] The immunogenic fragments of the influenza HA extracellular domain used in the present invention include influenza HA extracellular domain fragments capable of eliciting neutralizing antibodies against influenza virus and / or T - cell responses (such as CD4 or CD8 T - cell responses), such as consisting of, suitably, the T - cell response being a protective immune response (for example, partially or completely reducing the severity of one or more symptoms and / or the time that a subject experiences one or more symptoms after infection, reducing the likelihood of establishing an infection after challenge and / or slowing the progression of the disease (such as extending survival time)).

[0264] Suitably, the immunogenic fragment of the influenza HA extracellular domain comprises one or more epitopes from the full-length influenza HA stem or extracellular domain, such as one, two or three or more epitopes.

[0265] HA epitope

[0266] Certain epitopes on influenza HA are known to be neutralizing epitopes of influenza virus. These epitopes include the CR9114 stem epitope, the FI6 (such as FI6v3) stem epitope, the 5A7 stem epitope, the CR8033 epitope and the CR071 epitope (CR9114, CR8033 and CR071 are described in, for example, Dreyfus et al. Science, 2012, 337(6100):1343 - 8; FI6 is described in, for example, Corti et al. Science, 2011, 333(6044):850 - 6; and 5A7 is described in Yagusi et al. PLOS Pathogens, 2013, 9(2):e1003150).

[0267] In one embodiment, the CR9114 epitope is present in the influenza HA antigen described herein. In another embodiment, the FI6 (such as FI6v3) epitope is present in the influenza HA antigen described herein. In another embodiment, both the CR9114 and FI6 (such as FI6v3) epitopes are present in the HA antigen. When the epitope is present in the recombinant HA antigen, this means that mAbs against these epitopes can bind to the recombinant antigen in a suitable assay.

[0268] Recombinant HA antigen

[0269] The recombinant HA antigen comprises one or more nucleic acids derived from, or encoded by, an artificially constructed nucleic acid. For example, the nucleic acid can comprise, or be encoded by, a cloned nucleic acid formed by ligating heterologous nucleic acids.

[0270] The recombinant HA antigen comprises the hemagglutinin-derived sequences HA1 and HA2 of the extracellular domain and may comprise other non-hemagglutinin-derived sequences, such as one or more linker sequences, each of which may be a flexible linker sequence, or a cleavage site such as a furin cleavage site. The linker sequence may be present, for example, between the HA1 region and the HA2 region of the recombinant HA. The linker sequence may facilitate the independent folding of the HA domains. The linker sequence may be an amino acid sequence synthesized as part of a recombinant fusion protein. Linkers (especially short linkers) may be present between the extracellular domain and the trimerization domain, and / or between the trimerization domain and the His tag (if present). In other embodiments, chemical linkers are used to join subsequences produced synthetically or recombinantly. Such flexible linkers are known to those skilled in the art. A cleavage site (such as a furin cleavage site) may be present between the HA1 region and the HA2 region of the HA. The furin cleavage site may be used to allow activation, for example, by vector technology. This may enhance antigen representation and immunogenicity.

[0271] The recombinant HA antigen may further comprise a polypeptide subsequence from a protein unrelated to hemagglutinin, either in addition to or as an alternative to the linker, such as a sequence having an affinity for a known antibody, to facilitate affinity purification and / or detection. Such domains that facilitate detection and purification include, but are not limited to, metal chelating peptides that allow purification on immobilized metal, such as polyhistidine tracts and histidine-tryptophan modules, and protein A domains that allow purification on immobilized immunoglobulin. Examples include heterologous fusion sequences encoding gD tags, AviTags, c-Myc epitopes, polyhistidine tags, fluorescent proteins (such as GFP), β-galactosidase proteins, or glutathione S-transferases, or any other sequence that can be used to detect or purify the fusion protein expressed in or on cells. Preferred other polypeptide sequences are polyhistidine tags, such as tetrahistidine tags or hexahistidine tags or octahistidine tags or decahistidine tags, especially hexahistidine tags. Inclusion of a cleavable linker sequence between the purification domain (such as a polyhistidine tag) and the HA antigen may help facilitate purification. For example, an enzyme cleavage site (such as a TEV cleavage site or a thrombin cleavage site) may be included between this other polypeptide and the remainder of the recombinant HA sequence.

[0272] A cleavable linker sequence (e.g., an enzyme cleavage site such as a TEV cleavage site or a thrombin cleavage site) can alternatively or additionally be included between the trimerization domain and the remainder of the recombinant HA sequence. This can allow for the removal of the trimerization domain in the final recombinant HA. Thus, the recombinant HA described herein can comprise, consist essentially of, or consist of (in order) the extracellular domain of HA, a heterologous trimerization domain, a purification tag (e.g., a polyhistidine tag), and an optional cleavable linker sequence located i) between the purification tag and the remainder of the recombinant HA and / or ii) between the trimerization domain and the HA extracellular domain.

[0273] In some embodiments, the His tag and an optional trimerization domain (e.g., foldon or GCN4) (if present) are cleaved after protein expression and thus are not present in the final HA antigen.

[0274] For example, the recombinant HA antigen described herein can comprise, consist essentially of, or consist of i) an amino acid sequence containing the extracellular domain of HA, and ii) the heterologous trimerization domain (foldon) in SEQ ID NO:9 or a derivative thereof that retains the ability to induce trimer formation of the recombinant HA monomer. Specifically, the recombinant HA extracellular domain antigen can comprise, consist essentially of, or consist of a sequence having at least 80% identity, such as 90% or higher, such as 95% or higher, such as 98% or higher, such as 99% or higher sequence identity with the amino acid sequence of any one of SEQ ID NO:3, 4, 5, 6, 7, or 8 (more suitably SEQ ID NO:3 or 6). The amino acid sequences of SEQ ID NO:3-8 each contain a foldon sequence and a polyHis tag, one or both of which are optionally removed to provide the final HA antigen. Alternatively, the recombinant HA extracellular domain antigen can comprise, consist essentially of, or consist of a sequence having at least 80% identity, such as 90% or higher, such as 95% or higher, such as 98% or higher, such as 99% or higher sequence identity with the amino acid sequence of any one of SEQ ID NO:17 to 42 (more suitably SEQ ID NO:19, 21, 26, 34, or 42). The amino acid sequences of SEQ ID NO:17-42 each contain a foldon sequence and a polyHis tag, one or both of which are optionally removed to provide the final HA antigen.

[0275] For example, the recombinant HA antigen described herein can comprise i) an amino acid sequence comprising the HA antigen, and ii) a heterotrimerization domain, such as foldon shown in SEQ ID NO:9 or a derivative thereof that retains the ability to induce trimer formation of the recombinant HA monomer. Specifically, the recombinant HA extracellular domain antigen can comprise any one of, or consist of, the amino acid sequences shown in SEQ ID NOs: 3 to 8 and 17 to 42. These sequences all contain foldon, which is optionally removed to provide the final HA antigen.

[0276] The recombinant HA antigen described herein presented in nanoparticles can comprise, for example, i) an amino acid sequence comprising the HA extracellular domain antigen, such as any of the amino acid sequences shown in SEQ ID NOs: 3 to 8 and 17 to 42, minus foldon; and optionally ii) a heterologous polypeptide capable of forming nanoparticles, such as ferritin. In one embodiment, the recombinant HA antigen is the extracellular domain antigen described herein fused to Helicobacter pylori ferritin.

[0277] The recombinant HA antigen described herein delivered as a nucleic acid (such as mRNA) can comprise i) an amino acid sequence comprising the HA extracellular domain antigen, and optionally ii) a transmembrane domain (homologous, i.e., derived from the same influenza strain, or heterologous, i.e., derived from another influenza strain or another source, and optionally trimeric), such that once the antigen is expressed, the antigen is membrane-anchored; or a heterologous polypeptide capable of forming nanoparticles (such as ferritin), such that once the antigen is expressed, it is presented on the surface of the nanoparticles.

[0278] A polynucleotide encoding the HA antigen

[0279] The polynucleotide construct encoding the recombinant HA antigen can comprise a signal sequence. Generally, the signal sequence is suitable for the host cell in which the recombinant HA is expressed. In one embodiment, a wild-type signal peptide sequence is used. In another embodiment, a heterologous signal peptide sequence is used.

[0280] Thus, the polynucleotide encoding the recombinant influenza HA antigen described herein may comprise sequences encoding the HA extracellular domain, a heterotrimerization domain (e.g., foldon), a purification tag (e.g., polyhistidine tag), and a signal peptide (e.g., SEQ ID NO:10 or 43), in the following order: signal peptide (e.g., SEQ ID NO:10 or 43), HA extracellular domain, heterotrimerization domain (e.g., foldon), purification tag (e.g., polyhistidine tag). In another embodiment, the polynucleotide encoding the recombinant HA antigen described herein comprises sequences encoding (in order): signal peptide (e.g., SEQ ID NO:10 or 43), HA extracellular domain, a cleavable linker sequence (e.g., TEV cleavage site), heterotrimerization domain (e.g., foldon), and purification tag (e.g., polyhistidine tag).

[0281] The polynucleotide sequence encoding the recombinant influenza HA antigen may comprise i) a polynucleotide sequence encoding the HA extracellular domain and ii) SEQ ID NO:9 encoding foldon or a derivative of foldon that retains the ability to induce the recombinant HA monomers expressed to form trimers.

[0282] In a specific embodiment, the polynucleotide sequence encoding the recombinant HA antigen described herein comprises a sequence encoding a polypeptide of any one of SEQ ID NOs: 3 to 8 or 17 to 42, such as a polynucleotide sequence of SEQ ID NOs: 11 to 16 or 44 to 69, or consists of the same.

[0283] In another embodiment, the polynucleotide sequence encoding the recombinant influenza HA antigen comprises sequences encoding the extracellular domain and the transmembrane domain. In one embodiment, the transmembrane domain is the native influenza HA transmembrane or a functional derivative that anchors the antigen to the membrane. In one embodiment, the polynucleotide sequence is formulated for delivery as a nucleic acid vaccine.

[0284] In another embodiment, the polynucleotide sequence encoding the recombinant influenza HA antigen comprises a sequence encoding the extracellular domain and a sequence encoding a polypeptide capable of forming nanoparticles. In one embodiment, the polypeptide capable of forming nanoparticles is ferritin. In one embodiment, the polynucleotide sequence is formulated for delivery as a nucleic acid vaccine.

[0285] Nucleic acid-based vaccines are contemplated herein for any of the influenza HA antigens described. The nucleic acid can be, for example, RNA (i.e., an RNA-based vaccine or mRNA delivery platform) or DNA (i.e., a DNA-based vaccine, such as a plasmid DNA vaccine), including viral vectors. The sequence of the nucleic acid molecule can be modified, for example to increase the efficiency of nucleic acid expression or replication, or to provide additional stability or resistance to degradation, or to reduce reactogenicity or activation of the interferon pathway that affects antigen expression.

[0286] Messenger RNA (mRNA) can direct the cellular machinery of a subject to produce a protein. As used herein, the term mRNA includes conventional mRNA or mRNA analogs, such as those mRNA or mRNA analogs containing a modified backbone or modified bases (e.g., pseudouridine, etc.). The mRNA may or may not have a 5' cap. The mRNA can encode more than one antigen. For example, an mRNA encoding an HA antigen as described herein can encode only the HA antigen, or it can encode a second HA antigen or an additional protein. In the case of encoding an additional protein, the mRNA can be polycistronic.

[0287] The mRNA can be non-replicating, or it can be replicating, also referred to as self-amplifying. Self-amplifying mRNA molecules can be alphavirus-derived mRNA replicons. mRNA amplification can also be achieved by providing a combination of a non-replicating mRNA encoding an antigen and a separate mRNA encoding a replication mechanism.

[0288] Self-replicating RNA molecules are well known in the art and can be produced by using replication elements derived from, for example, alphaviruses and replacing the structural viral proteins with a nucleotide sequence encoding a protein of interest.

[0289] The mRNA can also be codon-optimized. In some embodiments, the mRNA can be codon-optimized for expression in human cells.

[0290] A series of vector systems have been described that encapsulate or complex the mRNA in order to facilitate mRNA delivery and subsequent expression of the encoded antigen compared to non-encapsulated or non-complexed mRNA. The present invention can utilize any suitable vector system. Specific vector systems include lipid nanoparticles (LNPs), which are non-viral liposome particles that can encapsulate mRNA; cationic nanoemulsion (CNE) delivery systems, where cationic oil-in-water emulsions can be used to deliver mRNA to the interior of cells; and lipid-coated iron oxide nanoparticles (LION), which are capable of delivering mRNA into cells and can be assisted by applying an external magnetic field after administration to a subject. In one embodiment, an mRNA encoding an HA antigen as described herein is encapsulated or complexed in a vector system selected from LNPs, CNE, and LION.

[0291] Trimerization domain

[0292] A suitable trimerization domain is a domain that induces the formation of trimers from recombinant HA antigen monomers and increases stability. Suitably, the trimerization domain is or is derived from the native trimerization domain "foldon" of T4 phage fibritin. A foldon sequence that forms a β-helical structure at the C-terminus of the fibritin domain of T4 phage can be used. For example, the trimerization domain can comprise the foldon amino acid sequence shown in SEQ ID NO:9 or a derivative of this sequence that retains the ability to induce trimer formation from recombinant monomers, or consist thereof.

[0293] Another suitable trimerization domain is the leucine zipper trimerization motif derived from the yeast transcriptional activator GCN4. Further suitable trimerization domains include chloramphenicol acetyltransferase (CAT). The trimerization domain is located at the C-terminus of the HA extracellular domain, i.e., at the stem end of HA. Further trimerization domains include human-derived trimerization domains such as Trimer-Tag, or HIV-derived trimerization domains. Generally, the trimerization domain is fused to the HA sequence via a short linker region. The region between the trimerization domain and the HA sequence can comprise a cleavable linker sequence, so that the HA sequence can be separated from the trimerization domain at a later stage. Thus, the HA sequence can optionally be linked via a linker sequence to a heterologous sequence (e.g., in order), which heterologous sequence comprises a protease cleavage site, a trimerization domain, and a purification tag (such as a histidine tag to aid purification). Such heterologous trimerization domains can be linked to the HA sequence by techniques known in the art, such as molecular cloning.

[0294] Preparation of Recombinant HA Antigen

[0295] Generating influenza vaccines using recombinant DNA technology offers several advantages. These advantages include potentially avoiding the steps of adaptation and passage of infectious virus in eggs, and generating a higher degree of purified protein under safer and more tightly controlled conditions. In addition, there is no need to include a virus inactivation step. Any suitable cloning and expression system can be used for the recombinant production of recombinant HA antigen.

[0296] The nucleotide sequences encoding the recombinant HA antigens of the present invention can be synthesized and / or cloned and expressed according to techniques well known to those skilled in the art. See, for example, Sambrook et al., Molecular Cloning, A Laboratory Manual, Vols. 1-3, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989). In some embodiments, the polynucleotide sequences will be codon-optimized for a particular recipient host cell using standard methods. For example, the DNA construct encoding the hemagglutinin sequence can be codon-optimized for expression in other hosts such as bacterial, mammalian or insect cells. Suitable host cells can include bacterial cells such as E. coli; fungal cells such as yeast; insect cells such as Drosophila S2, Spodoptera Sf9, Sf00+ or Hi-5; and animal cells such as CHO.

[0297] Suitably, the HA antigens described herein are expressed in eukaryotic cells such as mammalian cells, e.g., human cells such as HEK293T cells, non-human mammalian cells such as CHO cells, or insect cells, optionally further comprising purifying / isolating the recombinant HA from the cells.

[0298] The hemagglutinin sequences can be generated by standard recombinant methods known in the art such as polymerase chain reaction (PCR) or reverse transcriptase PCR, reverse engineering, or DNA can be synthesized. For PCR, primers can be prepared using the hemagglutinin nucleotide sequences available in public databases.

[0299] Sequence identity

[0300] Sequence identity with respect to a sequence is defined herein as the percentage of amino acid residues in a candidate sequence that are identical to the reference amino acid sequence after aligning the sequences and introducing gaps (if necessary) to achieve the maximum percentage sequence identity, and without considering any conservative substitutions as part of the sequence identity.

[0301] Sequence identity can be determined by standard methods commonly used to compare the similarity of amino acid positions in two polypeptides. Using a computer program such as BLAST or FASTA or MUSCLE or CLUSTALO, the two polypeptides are aligned to best match their respective amino acids (along the full length of one or both sequences, or along a predetermined portion of one or both sequences). The program provides a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 (standard scoring matrix; see Dayhoff et al. (1978) A model of evolutionary change in proteins, Atlas of Protein Sequence and Structure, vol. 5, supp. 3) can be used in combination with the computer program. For example, the percent identity can then be calculated as: the total number of identical matches multiplied by 100, then divided by the sum of the length of the longer sequence within the match span and the number of gaps introduced into the shorter sequence to align the two sequences (e.g., divided by the length of the alignment).

[0302] Influenza strain

[0303] The "type" of influenza virus refers to influenza A, influenza B, or influenza C. Designating a virus as a particular type is related to sequence differences in the corresponding M1 (matrix) protein or NP (nucleoprotein). Influenza A viruses are further divided into Group 1 and Group 2. These groups are also referred to as clades and are further divided into subtypes, which refers to classifying viruses based on the sequence of the viral HA protein. Examples of currently commonly recognized subtypes are H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and H18. Among them, the Group 1 influenza A subtypes are H1, H2, H5, H6, H8, H9, H11, H12, H13, H16, H17, and H18. The Group 2 influenza A subtypes are H3, H4, H7, H10, H14, and H15. Finally, the term "strain" refers to viruses that differ from each other within a subtype by minor genetic variations in the genome.

[0304] The HA extracellular domain sequence of the recombinant HA antigen described herein can be from any influenza A subtype, such as H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, H18. In one embodiment, the HA sequence of the HA antigen is from a strain selected from Group 1 influenza A subtypes (including H1, H2, H5, H6, H8, H9, H11, H12, H13, H16, H17, and H18). In a specific embodiment, the HA sequence is from an H1 strain derived from the human population, such as Bri18. In a further embodiment, the HA sequence of the HA antigen is from a strain selected from Group 2 influenza subtypes (including H3, H4, H7, H10, H14, and H15).

[0305] In one embodiment, the HA sequence is from a naturally occurring HA derived from a non-pandemic strain. In one embodiment, the HA sequence is from a naturally occurring HA derived from an influenza virus in circulation or a strain recommended by the WHO for seasonal influenza vaccines. For example, the influenza virus in circulation or vaccine-recommended can be a seasonal influenza virus strain identified by the WHO as being in circulation or vaccine-recommended, or a seasonal strain identified by the WHO as being in circulation or vaccine-recommended in a previous season. In one embodiment, the HA sequence is from a strain identified by the WHO as having the potential to cause an epidemic in a subsequent influenza season. In one embodiment, the HA sequence is from a strain that is a novel influenza virus strain against which the vast majority of the human population has no immunity. In one embodiment, the HA extracellular domain sequence is from a strain that has the potential to cause a pandemic. Typically, the WHO identifies and publishes such strains.

[0306] Additional antigen

[0307] The present invention can relate to multiple antigen components, for example, with the aim of eliciting a broad immune response against influenza viruses. Thus, there can be more than one antigen, there can be more than one polynucleotide encoding an antigen, there can be a polynucleotide encoding more than one antigen, or there can be a mixture of (one or more) antigens and (one or more) polynucleotides encoding (one or more) antigens. There can also be polysaccharides, such as polysaccharide conjugates.

[0308] The term "antigen" refers to a polypeptide capable of eliciting an immune response. Suitably, the antigen comprises at least one B or T cell epitope. The elicited immune response can be an antigen-specific B cell response that produces neutralizing antibodies. The elicited immune response can be an antigen-specific T cell response, which can be a systemic and / or local response. The antigen-specific T cell response can include a CD4+ T cell response, such as a response involving CD4+ T cells that express a variety of cytokines (e.g., IFNγ, TNFα, and / or IL2). Alternatively or additionally, the antigen-specific T cell response includes a CD8+ T cell response, such as a response involving CD8+ T cells that express a variety of cytokines (e.g., IFNγ, TNFα, and / or IL2).

[0309] Vaccine Delivery

[0310] It is evident that the recombinant HA antigen described herein can be delivered in any suitable vaccine delivery format, such as in the form of a protein or in the form of a nucleic acid, including nucleic acid delivery platforms such as DNA (including, for example, viral delivery platforms such as adenovirus) or RNA (including, for example, mRNA), which are optionally formulated in a vector system. Suitable delivery systems include viral vectors such as adenoviral vectors. In any case, the delivery format will include a pharmaceutically acceptable diluent or carrier. Optionally, one or more adjuvants can be used.

[0311] Immunogenic Composition

[0312] In one aspect, the present invention provides an immunogenic composition comprising an influenza HA antigen or polynucleotide as described herein and a pharmaceutically acceptable carrier.

[0313] In one embodiment, the immunogenic composition comprising the HA antigen as described herein further comprises an adjuvant. Preferably, the adjuvant is an oil-in-water emulsion adjuvant. Oil-in-water emulsion adjuvants are well known in the art and are described in more detail below.

[0314] In one embodiment, the immunogenic composition comprising an HA polynucleotide encoding the HA antigen as described herein further comprises a polynucleotide vector or delivery system.

[0315] In one embodiment, the immunogenic composition is monovalent, i.e., contains an influenza HA antigen or polynucleotide encoding the same from only one influenza A strain. In an alternative embodiment, the composition is multivalent, i.e., contains influenza virus antigens from multiple strains. For example, the composition can be bivalent, trivalent or tetravalent, and can contain, for example, two or three seasonal strains and the recombinant HA antigen described herein. For example, the composition can contain the antigen or polynucleotide described herein, and an additional influenza A strain antigen or polynucleotide and optionally one or two influenza B strain antigens or polynucleotides.

[0316] In one embodiment, the immunogenic composition is an improved seasonal influenza vaccine, wherein the HA antigen is capable of inducing an immune response against at least one other influenza strain from the same or a different subtype (e.g., influenza A strain hemagglutinin subtype). In a further embodiment, the immunogenic composition is capable of inducing an immune response against two or three or four or more different strains, including one or more strains from each of two different subtypes (such as H1 and H3). In one embodiment, the immunogenic composition contains an HA antigen from H1 that is capable of inducing an immune response against one or more other H1 strains. In one embodiment, the immunogenic composition contains an HA antigen from H1 that is capable of inducing a heterosubtypic immune response against one or more Group 1 subtypes (such as H2, H5 or H9). In one embodiment, the immunogenic composition contains an HA antigen from H1 that is capable of inducing a heterosubtypic immune response against one or more Group 2 subtypes (such as H10).

[0317] In one embodiment, the present invention provides an immunogenic composition comprising (i) a trimeric form of an influenza HA extracellular domain antigen comprising a stabilizing mutation in one or more of the coiled-coil regions described herein; and (ii) a squalene-based adjuvant.

[0318] Adjuvant

[0319] In one embodiment, the immunogenic composition of the present invention contains an adjuvant. Specifically, the adjuvant can be an emulsion, such as an oil-in-water emulsion. Optionally, other immunostimulants can be present in the oil-in-water emulsion. In a specific embodiment, the oil-in-water emulsion contains a metabolizable non-toxic oil, such as squalene or squalane, optionally containing tocopherol, such as tocopherol, especially α-tocopherol, and an emulsifier (or surfactant), such as the non-ionic surfactant polyoxyethylene sorbitan monooleate (TWEEN-80 TM or polysorbate 80 TM ). A mixture of surfactants can be used, such as polyoxyethylene sorbitan monooleate / sorbitan trioleate (SPAN 85TM ) a mixture, or a polyoxyethylene sorbitan monooleate / triisooctylphenyl polyoxyethylene ethanol (TRITON X-100 TM ) mixture.

[0320] In one aspect, the oil-in-water emulsion has one of the following compositions:

[0321] - 0.5 to 11 mg of squalene, 0.05% to 5% of polyoxyethylene sorbitan monooleate (TWEEN-80 TM or POLYSORBATE 80 TM ) and optionally 2% to 12%

[0322] α-tocopherol; or

[0323] - approximately 5% squalene, approximately 0.5% polyoxyethylene sorbitan monooleate (TWEEN-80 TM or POLYSORBATE80 TM ) and approximately 0.5% sorbitan trioleate (SPAN 85 TM ). This adjuvant is called MF59.

[0324] The squalene emulsion adjuvant is described in more detail below.

[0325] Alternative adjuvants that can be used include immunologically active saponin fractions (such as QS21) derived from the bark of Quillaja Saponaria Molina presented in the form of liposomes and lipopolysaccharides (such as 3D-MPL), optionally further comprising a sterol (cholesterol). In one embodiment, the adjuvant comprises, or consists of, a saponin (such as QS21) presented in the form of liposomes, a lipid A derivative (such as 3D-MPL), and a sterol (such as cholesterol). The liposomes suitably contain neutral lipids, for example, phosphatidylcholine, dioleoyl phosphatidylcholine (DOPC), or dilauroyl phosphatidylcholine. The liposomes may also contain charged lipids, which increase the stability of the liposome-QS21 structure of liposomes composed of saturated lipids. An example of such an adjuvant is AS01, which comprises 3D-MPL and QS21 in a quenched form with cholesterol and can be prepared as described in WO96 / 33739. The AS01B or AS01E forms of this adjuvant can be used. The AS01 B adjuvant comprises liposomes, which in turn comprise dioleoyl phosphatidylcholine (DOPC), cholesterol, and 3D-MPL (in an amount of approximately 1000 mg DOPC, 250 mg cholesterol, and 50 mg 3D-MPL per vaccine dose), QS21 (50 mg / dose), phosphate NaCl buffer, and water, with a volume of 0.5 ml.

[0326] The AS01E adjuvant contains the same components as AS01B, but at a lower concentration, approximately 500 mg of DOPC, 125 mg of cholesterol, 25 mg of 3D-MPL, 25 mg of QS21, phosphate-buffered saline, and water, with a volume of 0.5 ml.

[0327] In one embodiment, the influenza HA extracellular domain antigen is physically associated with an adjuvant (such as a liposome of AS01 or an emulsion containing a squalene adjuvant such as AS03).

[0328] Squalene emulsion adjuvant

[0329] As used herein, the term "squalene emulsion adjuvant" refers to an oil-in-water emulsion adjuvant containing squalene.

[0330] Squalene is a branched unsaturated terpene compound ([(CH3)2C[=CHCH2CH2C(CH3)]2=CHCH2-]2; C30H50; 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexaene; CAS Registry No. 7683-64-9). Squalene is readily available from commercial sources or can be obtained by methods known in the art. Squalene exhibits good biocompatibility and is readily metabolized.

[0331] The squalene emulsion adjuvant can contain one or more tocopherols, suitably where the weight ratio of squalene to tocopherol is 20 or less (i.e., 20 weight units of squalene or less per weight unit of tocopherol, or in other words, at least 1 weight unit of tocopherol per 20 weight units of squalene).

[0332] Any one of α, β, γ, δ, ε, and / or ξ-tocopherol can be used, but α-tocopherol (also referred to herein as alpha-tocopherol) is typically used. Both D-α-tocopherol and D / L-α-tocopherol can be used. Tocopherols are readily available from commercial sources or can be obtained by methods known in the art. In some embodiments, the squalene emulsion adjuvant contains α-tocopherol, especially D / L-α-tocopherol.

[0333] Squalene emulsion adjuvants will generally have submicron droplet sizes. Droplet sizes less than 200nm are beneficial because they can promote sterilization by filtration. There is evidence that droplet sizes in the range of 80 to 200nm are of particular interest for reasons of efficacy, manufacturing consistency and stability (Klucker, 2012; Shah, 2014; Shah, 2015; Shah, 2019). Suitably, the average droplet size of the squalene emulsion adjuvant is less than 1um, especially less than 500nm, and in particular less than 200nm. Suitably, the average droplet size of the squalene emulsion adjuvant is at least 50nm, especially at least 80nm, especially at least 100nm, such as at least 120nm. The average droplet size of the squalene emulsion adjuvant can be 50 to 200nm, such as 80 to 200nm, especially 120 to 180nm, especially 140 to 180nm, such as about 160nm.

[0334] Uniformity of droplet size is desirable. A polydispersity index (PdI) greater than 0.7 indicates that the sample has a very broad size distribution, while a reported value of 0 means that there is no size variation, although values less than 0.05 are rarely observed. Suitably, the polydispersity of the squalene emulsion adjuvant is 0.5 or less, especially 0.3 or less, such as 0.2 or less.

[0335] As used herein, droplet size refers to the average diameter of the oil droplets in the emulsion and can be determined in a variety of ways, such as using dynamic light scattering and / or single particle optical sensing techniques, using an Accusizer available from Particle Sizing Systems (Santa Barbara, USA). TM and Nicomp TM Series instruments, Zetasizer from Malvern Instruments (UK) TMDetermination is carried out using an instrument or apparatus of the Particle Size Distribution Analyzer from Horiba (Kyoto, Japan). See Light Scattering from Polymer Solutions and Nanoparticle Dispersions Schartl, 2007. Dynamic light scattering (DLS) is the preferred method for determining droplet size. The preferred method for defining the average droplet diameter is the Z-average, i.e., the intensity-weighted average hydrodynamic size of the droplet ensemble measured by DLS. The Z-average is derived from the cumulant analysis of the measured correlation curve, where a single particle size (droplet diameter) is assumed and a single exponential fit is applied to the autocorrelation function. Thus, the average droplet size mentioned herein should be regarded as the intensity-weighted average and ideally the Z-average. The PdI value is readily provided by the same instrument that measures the average diameter.

[0336] To maintain a stable submicron emulsion, generally one or more emulsifiers (i.e., surfactants) are required. Surfactants can be classified according to their "HLB" (Griffin hydrophilic / lipophilic balance), where an HLB in the range of 1 - 10 generally means that the surfactant is more soluble in oil than in water, while an HLB in the range of 10 - 20 means that the surfactant is more soluble in water than in oil. For many surfactants of interest, the HLB value is readily available or can be determined experimentally. For example, the HLB of polysorbate 80 is 15.0, while the HLB of TPGS is 13 to 13.2. The HLB of sorbitan trioleate is 1.8. When mixing two or more surfactants, the resulting HLB of the mixture is usually calculated by a weighted average. For example, the HLB of a 70 / 30 wt% mixture of polysorbate 80 and TPGS is (15.0 x 0.70) + (13 x 0.30), i.e., 14.4. The HLB of a 70 / 30 wt% mixture of polysorbate 80 and sorbitan trioleate is (15.0 x 0.70) + (1.8 x 0.30), i.e., 11.04.

[0337] The surfactant will generally be metabolizable (biodegradable) and biocompatible and suitable for use as a drug. Surfactants can include ionic (cationic, anionic or zwitterionic) and / or non-ionic surfactants. It is generally desirable to use only non-ionic surfactants, e.g., due to their independence from pH. Thus, the present invention can use surfactants including, but not limited to:

[0338] - Polyoxyethylene sorbitan esters surfactants (commonly known as Tween or polysorbates), such as polysorbate 20 and polysorbate 80, especially polysorbate 80;

[0339] - Copolymers of ethylene oxide (EO), propylene oxide (PO) and / or butylene oxide (BO), sold under the trade names DOWFAX TM , Pluronic TM (e.g., grades F68, F127 or L121) or Synperonic TM such as linear EO / PO block copolymers, e.g., poloxamer 407, poloxamer 401 and poloxamer 188;

[0340] - Octoxynol, where the number of repeating ethoxy (oxy-1,2-ethanediyl) groups can vary, with octoxynol-9 being of particular interest

[0341] (Triton X-100 or tert-octylphenoxypolyethoxyethanol);

[0342] - (Octylphenoxy)polyethoxyethanol (IGEPAL CA-630 / NP-40);

[0343] - Phospholipids, such as phosphatidylcholine (lecithin);

[0344] - Polyoxyethylene fatty ethers derived from lauryl, cetyl, stearyl and oleyl groups (referred to as Brij surfactants), such as polyoxyethylene 4 lauryl ether (Brij 30, Emulgen 104P), polyoxyethylene-9-lauryl ether and polyoxyethylene 12 cetyl / stearyl ether (EumulginTM B1, cetereth-12 or polyoxyethylene cetostearyl ether);

[0345] - Sorbitan esters (commonly known as Span), such as sorbitan trioleate (Span 85), sorbitan monooleate (Span 80) and sorbitan monolaurate (Span 20);

[0346] - Or tocopherol derivative surfactants, such as α-tocopherol-polyethylene glycol succinate (TPGS).

[0347] Many examples of pharmaceutically acceptable surfactants are known in the art, see, for example, Handbook of Pharmaceutical Excipients, 6th Edition, 2009. Methods for the selection and optimization of surfactants used in squalene emulsion adjuvants are described in Klucker, 2012. Generally, the HLB of the surfactant component is between 10 and 18, such as between 12 and 17, especially 13 to 16. This can generally be achieved using a single surfactant or, in some embodiments, a mixture of surfactants. Surfactants of particular interest include: poloxamer 401, poloxamer 188, polysorbate 80, sorbitan trioleate, sorbitan monooleate, and polyoxyethylene 12 cetyl / stearyl ether, used alone, in combination with each other, or in combination with other surfactants. Of particular interest are polysorbate 80, sorbitan trioleate, sorbitan monooleate, and polyoxyethylene 12 cetyl / stearyl ether, used alone or in combination with each other. A particular surfactant of interest is polysorbate 80. A particular surfactant combination of interest is polysorbate 80 and sorbitan trioleate. A further surfactant combination of interest is sorbitan monooleate and polyoxyethylene cetylstearyl ether.

[0348] In certain embodiments, the squalene emulsion adjuvant comprises one surfactant, such as polysorbate 80. In some embodiments, the squalene emulsion adjuvant comprises two surfactants, such as polysorbate 80 and sorbitan trioleate or sorbitan monooleate and polyoxyethylene 12 cetyl / stearyl ether. In other embodiments, the squalene emulsion adjuvant comprises three or more surfactants, such as three surfactants.

[0349] If tocopherol is present, the weight ratio of squalene to tocopherol can be 20 or less, such as 10 or less. Suitably, the weight ratio of squalene to tocopherol is 0.1 or greater. Generally, the weight ratio of squalene to tocopherol is from 0.1 to 10, especially from 0.2 to 5, particularly from 0.3 to 3, such as from 0.4 to 2. Suitably, the weight ratio of squalene to tocopherol is from 0.72 to 1.136, especially from 0.8 to 1, particularly from 0.85 to 0.95, such as 0.9.

[0350] If a surfactant is present, the weight ratio of squalene to surfactant is generally from 0.73 to 6.6, especially from 1 to 5, particularly from 1.2 to 4. Suitably, the weight ratio of squalene to surfactant is from 1.71 to 2.8, especially from 2 to 2.4, particularly from 2.1 to 2.3, such as 2.2.

[0351] The amount of squalene in a single dose (such as a human dose) of the squalene emulsion adjuvant is usually at least 1.2 mg. Generally, the amount of squalene in a single dose (such as a human dose) of the squalene emulsion adjuvant is 50 mg or less. The amount of squalene in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 1.2 to 20 mg, particularly 1.2 to 15 mg. The amount of squalene in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 1.2 to 2 mg, 2 to 4 mg, 4 to 8 mg, or 8 to 12.1 mg. For example, the amount of squalene in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 1.21 to 1.52 mg, 2.43 to 3.03 mg, 4.87 to 6.05 mg, or 9.75 to 12.1 mg.

[0352] If there is tocopherol, the amount of tocopherol in a single dose (such as a human dose) of the squalene emulsion adjuvant is usually at least 1.3 mg. Generally, the amount of tocopherol in a single dose (such as a human dose) of the squalene emulsion adjuvant is 55 mg or less. The amount of tocopherol in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 1.3 to 22 mg, particularly 1.3 to 16.6 mg. The amount of tocopherol in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 1.3 to 2 mg, 2 to 4 mg, 4 to 8 mg, or 8 to 13.6 mg. For example, the amount of tocopherol in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 1.33 to 1.69 mg, 2.66 to 3.39 mg, 5.32 to 6.77 mg, or 10.65 to 13.53 mg.

[0353] If there is a surfactant, the amount of surfactant in a single dose (such as a human dose) of the squalene emulsion adjuvant is usually at least 0.4 mg. Generally, the amount of surfactant in a single dose (such as a human dose) of the squalene emulsion adjuvant is 18 mg or less. The amount of surfactant in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 0.4 to 9.5 mg, particularly 0.4 to 7 mg. The amount of surfactant in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 0.4 to 1 mg, 1 to 2 mg, 2 to 4 mg, or 4 to 7 mg. For example, the amount of surfactant in a single dose (such as a human dose) of the squalene emulsion adjuvant can be 0.54 to 0.71 mg, 1.08 to 1.42 mg, 2.16 to 2.84 mg, or 4.32 to 5.68 mg.

[0354] In certain embodiments, the squalene emulsion adjuvant can consist essentially of squalene, a surfactant, and water. In certain other embodiments, the squalene emulsion adjuvant can consist essentially of squalene, tocopherol, a surfactant, and water. The squalene emulsion adjuvant can contain additional components, such as buffers and / or tonicity regulators, e.g., modified phosphate buffered saline (disodium phosphate, potassium dihydrogen phosphate, sodium chloride, and potassium chloride), depending on the desired final presentation and vaccination strategy, as desired or required.

[0355] High pressure homogenization (HPH or microfluidization) can be applied to produce a squalene emulsion adjuvant containing tocopherol, which exhibits uniform small droplet size and long-term stability (see EP0868918 and WO2006 / 100109). Briefly, an oil phase consisting of squalene and tocopherol can be formulated under a nitrogen atmosphere. The aqueous phase is prepared separately and typically consists of water for injection or phosphate buffered saline and polysorbate 80. Before homogenization and microfluidization, the oil phase and the aqueous phase are combined, for example, at a ratio of 1:9 (volume of oil phase to volume of aqueous phase), for example, by a single pass through an in-line homogenizer and three passes through a microfluidizer (at about 15,000 psi). Then, the resulting emulsion can be sterile filtered, for example, through two columns of 0.5 / 0.2 um filters in series (i.e., 0.5 / 0.2 / 0.5 / 0.2), see WO2011 / 154444. The operation is ideally carried out under an inert atmosphere (e.g., nitrogen). Positive pressure can be applied, see WO2011 / 154443.

[0356] International Patent Application WO2020160080 and Lodaya R et al.: J Control Release (2019) 316:12 - 21 describe a squalene emulsion adjuvant containing tocopherol and its manufacture as a self-emulsifying adjuvant system (SEAS).

[0357] Vaccination regimens, administration, and potency criteria

[0358] Suitably, the immunogenic compositions described herein are in most cases a standard 0.5 ml injectable dose and contain 15 μg or less of the hemagglutinin antigen component from an influenza virus strain, as measured by single radial immunodiffusion (SRD) (J.M. Wood et al.: J. Biol. Stand. 5 (1977) 237-247; J.M. Wood et al., J. Biol. Stand. 9 (1981) 317-330). Suitably, the vaccine dose volume will be from 0.25 ml to 1 ml, particularly a standard 0.5 ml or 0.7 ml vaccine dose volume. The dose volume will routinely be adjusted slightly according to the HA concentration in the original bulk sample and according to the route of administration, with smaller doses being given by the intranasal or intradermal route. The immunogenic compositions for use according to the invention can contain a low amount of HA antigen, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 μg HA per influenza virus strain or not more than 15 μg HA per strain. The low amount of HA can be as low as practicable, provided that it allows the formulation of a vaccine meeting international (e.g. EU or FDA) potency standards. Suitable low amounts of HA are from 1 to 7.5 μg HA per influenza virus strain, suitably from 3.5 to 5 μg per influenza virus strain, such as 3.75 or 3.8 μg HA per influenza virus strain, typically about 5 μg HA per influenza virus strain. Another suitable amount of HA is from 0.1 to 5 μg HA per influenza virus strain, suitably from 1.0 to 2 μg HA per influenza virus strain, such as 1.9 μg HA per influenza virus strain.

[0359] The influenza medicaments (such as immunogenic compositions) described herein suitably meet certain international vaccine standards. Standards are applied internationally to measure the potency of influenza vaccines.

[0360] Serological variables are evaluated according to the standards of the European Medicines Agency for Human Medicinal Products (CHMP / BWP / 214 / 96, Committee for Proprietary Medicinal Products (CPMP)) or updated standards.

[0361] Methods for establishing a strong and long-lasting immunity generally include repeated immunization, i.e. boosting the immune response by administering one or more further doses. Such further administrations can be carried out with the same immunogenic composition (homologous boosting) or with a different immunogenic composition (heterologous boosting). The invention can be applied as part of a homologous or heterologous prime / boost regimen, as one of the primary immunizations or booster immunizations.

[0362] Thus, the administration of the recombinant HA antigen can be part of a multi-dose administration regimen. For example, the recombinant HA antigen can be provided as a primary dose in a multi-dose regimen, particularly a two-dose or three-dose regimen, especially a two-dose regimen. The recombinant HA antigen can be provided as a booster dose in a multi-dose regimen, particularly a two-dose or three-dose regimen, such as a two-dose regimen.

[0363] The primary dose and the booster dose can be homologous or heterologous. Thus, the recombinant HA antigen can be provided as the primary dose and (one or more) booster doses in a homologous multi-dose regimen, particularly a two-dose or three-dose regimen, especially a two-dose regimen. Alternatively, the recombinant HA antigen can be provided as the primary dose or a booster dose in a heterologous multi-dose regimen, particularly a two-dose or three-dose regimen, especially a two-dose regimen, and the (one or more) booster doses can be different (e.g., different HA antigens; or alternative antigen presentation formats, such as protein or virus-vectored antigens (with or without adjuvant)).

[0364] The time between doses can be from two weeks to six months, such as from three weeks to three months. Periodic long-term booster doses can also be provided, such as once every 2 to 10 years.

[0365] Method of treatment

[0366] In a further embodiment, the immunogenic composition comprising the HA antigen or polynucleotide is for medical use, such as for prophylaxis or vaccination against influenza, for example administered to a person at risk of influenza infection (e.g., a subject).

[0367] In yet a further embodiment, the immunogenic composition comprising the antigen or polynucleotide is for preventing influenza caused by a subtype different from the hemagglutinin subtype on which the HA antigen is based. For example, the HA antigen from H1 can be used to prevent influenza caused by non-H1 influenza A viruses, such as from group 1 subtypes like H2, H5 or H9, or vice versa.

[0368] In a further aspect, the present invention provides a method for preventing and / or treating influenza disease, which comprises administering a recombinant HA antigen or an immunogenic composition as described herein to a person in need, for example administered to a person at risk of influenza infection (e.g., a subject), such as an elderly person (50 years or older, especially 65 years or older).

[0369] In one embodiment of the above method or use, each dose is administered with less than 15 mg, such as 3.75 to 10 mg of HA.

[0370] In one aspect, the present invention provides the recombinant HA antigen described herein for use in a vaccination regimen for the prevention of influenza at a dose of less than 10 mg, or less than 8 mg, or 1 - 7.5 mg, or 1 - 5 mg of recombinant HA, wherein the hemagglutinin sequence is from or derived from an influenza strain identified by an international organization (such as the WHO) that monitors influenza virus outbreaks and is associated with an outbreak or has the potential to be associated with a future outbreak.

[0371] Route of administration

[0372] The compositions of the present invention can be administered by any suitable delivery route, such as intradermal, mucosal (e.g., intranasal), oral, intramuscular (IM) or subcutaneous. Other delivery routes are well known in the art.

[0373] The intramuscular delivery route is particularly suitable for immunogenic compositions, especially for adjuvanted immunogenic compositions. The composition can be present in a single-dose container or, alternatively, in a multi-dose container. In such cases, an antimicrobial preservative, such as thimerosal, can be present to prevent contamination during use. A suitably present concentration of thimerosal is 5 μg / 0.5 ml dose (i.e., 10 μg / ml) or 10 μg / 0.5 ml dose (i.e., 20 μg / ml). A suitable IM delivery device, such as a needleless liquid jet injection device, for example, the Biojector 2000 (Bioject, Portland, OR), can be used. Alternatively, a pen-type syringe device (such as those used for home delivery of epinephrine) can be used to allow self-administration of the vaccine. The use of such delivery devices may be particularly suitable for large-scale immunization campaigns.

[0374] Intradermal delivery is another suitable route. Any suitable device can be used for intradermal delivery, such as a short needle device. Such devices are well known in the art. Intradermal vaccines can also be administered by a device that limits the length of effective needle penetration into the skin (such as the devices described in WO99 / 34850 and EP1092444, which are incorporated herein by reference) and their functional equivalents. Also suitable are jet injection devices that deliver a liquid vaccine to the dermis by a liquid jet syringe or by a needle that pierces the stratum corneum and generates a jet that reaches the dermis. Also suitable is a ballistic powder / particle delivery device that uses compressed gas to accelerate a vaccine in powder form through the outer layer of the skin to the dermis. Additionally, a conventional syringe can be used for the traditional mantoux method of intradermal administration.

[0375] Another suitable route of administration is the subcutaneous route. Any suitable device can be used for subcutaneous delivery, such as a conventional needle. Suitably, a needleless jet injector service is used. Such devices are well known in the art. Suitably, the device is pre-filled with a liquid vaccine formulation.

[0376] Alternatively, the vaccine is administered intranasally. Generally, the vaccine is administered locally to the nasopharyngeal region, suitably without inhalation into the lungs. It is desirable to use an intranasal delivery device that delivers the vaccine formulation to the nasopharyngeal region without entering or substantially entering the lungs.

[0377] A suitable device for intranasal administration of the vaccine according to the invention is a spray device. Suitable commercially available nasal spray devices include Accuspray TM (Becton Dickinson). Nebulizers produce a very fine spray that is easily inhaled into the lungs and thus cannot effectively reach the nasal mucosa. Therefore, nebulizers are not preferred.

[0378] Suitable spray devices for intranasal use are devices whose performance is not dependent on the pressure applied by the user. These devices are called pressure threshold devices. The liquid is released from the nozzle only when a threshold pressure is applied. These devices make it easier to achieve a spray with regular droplet sizes. Pressure threshold devices suitable for the present invention are known in the art and are described, for example, in WO 91 / 13281 and EP 311 863B and EP 516 636 (incorporated herein by reference). Such devices are commercially available from Pfeiffer GmbH and are described in Bommer, R. Pharmaceutical Technology Europe, September 1999.

[0379] Alternatively, epidermal or transdermal vaccination routes are also contemplated herein.

[0380] Sequence

[0381] SEQ ID NO:1 is the full-length HA sequence from an A / Brisbane / 02 / 2018 (H1N1)pdm09-like virus (H1 Bri18 , also known as Bri18).

[0382] MKAILVVLLYTFTTANADTLCIGYHANNSTDTVDTVLEKNVTVTHSVNLLEDKHNGKLCKLGGVAPLHLGKCNIAGWILGNPECESLSTARSWSYIVETSNSDNGTCYPGDFINYEELREQLSSVSSFERFEIFPKTSSWPNHDSNKGVTAACPHAGAKSFYKNLIWLVKKGNSYPKLNQTYINDKGKEVLVLWGIHHPPTTADQQSLYQNADAYVFVGTSRYSKKFKPEIATRPKVRDQEGRMNYYWTLVEPGDKITFEATGNLVVPRYAFTMERNAGSGIIISDTPVHDCNTTCQTAEGAINTSLPFQNVHPVTIGKCPKYVKSTKLRLATGLRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADLKSTQNAIDKITNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDIWTYNAELLVLLENERTLDYHDSNVKNLYEKVRNQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSEEAKLNREKIDGVKLESTRIYQILAIYSTVASSLVLVVSLGAISFWMCSNGSLQCRICI

[0383] SEQ ID NO:2 Full-length HA sequence from A / Darwin / 9 / 2021 H3N2 (also known as Darw21)

[0384] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVELKSGYKDWILWISFAMSCFLLCIALLGFIMWACQKGNIRCNICI

[0385] SEQ ID NO: 3 - 8 show the (one or more) mutations in bold compared to the H1 Brisbane 18 WT sequence:

[0386] SEQ ID NO: 3 Mut10

[0387]

[0388]

[0389] SEQ ID NO:9 Foldon sequence GYIPEAPRDGQAYVRKDGEWVLLSTFL

[0390] SEQ ID NO: 10 Bri 18 signal peptide

[0391] MKAILVVLLYTFTTANA

[0392] SEQ ID NO: 11-16 show the nucleotide sequences encoding the amino acid sequences of SEQ ID NO: 3-8

[0393] SEQ ID NO: 11 Mut10

[0394]

[0395] SEQ ID NO:12 Mut17

[0396]

[0397] SEQ ID NO:13 Mut18

[0398] ATGAAGGCTATTCTGGTCGTGCTGCTGTACACCTTCACCACAGCCAACGCCGATACACTGTGTATCGGCTACCACGCCAACAACAGCACCGATACAGTCGATACCGTGCTGGAGAAGAACGTGACCGTCACCCATTCCGTGAATCTGCTGGAGGACAAGCACAATGGCAAGCTGTGCAAGCTGGGCGGAGTGGCCCCTCTGCATCTGGGCAAGTGTAATATCGCCGGATGGATTCTGGGAAACCCCGAGTGTGAATCTCTGTCCACCGCTAGAAGCTGGTCCTACATTGTGGAGACCTCCAATTCCGACAATGGCACATGCTACCCCGGCGATTTTATCAACTACGAGGAGCTGAGAGAACAACTGAGCAGCGTCTCCTCCTTTGAGAGATTCGAGATCTTTCCCAAGACCAGCAGCTGGCCCAATCACGATTCCAACAAGGGAGTCACCGCTGCTTGCCCCCACGCTGGCGCTAAGTCCTTTTACAAGAACCTCATTTGGCTCGTGAAGAAGGGCAACTCCTATCCCAAGCTGAATCAAACATATATCAACGACAAGGGCAAGGAAGTCCTCGTGCTGTGGGGAATCCACCACCCTCCTACAACAGCCGACCAACAGTCTCTGTATCAGAACGCCGACGCCTATGTGTTCGTGGGAACCTCTAGGTACTCCAAGAAGTTCAAGCCCGAGATTGCTACAAGGCCCAAGGTGAGAGACCAAGAGGGAAGAATGAATTACTACTGGACACTGGTGGAGCCCGGCGATAAGATCACC

[0399] TTCGAAGCCACCGGCAACCTCGTGGTGCCTAGGTACGCCTTCACCATGGAGAGAAACGCTGGCAGCGGCATCATCATCTCCGACAC

[0400] ACCCGTGCATGACTGCAACACAACATGCCAAACAGCCGAGGGCGCCATTAACACCTCCCTCCCCTTTCAGAACGTGCACCCCGTGA

[0401] CAATCGGCAAGTGCCCCAAGTACGTGAAATCCACAAAGCTGAGGCTGGCCACCGGACTGAGAAATGTGCCCAGCATCCAGTCTAGG

[0402] GGACTGTTTGGAGCTATCGCCGGCTTCATTGAAGGCGGCTGGACCGGAATGGTGGACGGATGGTACGGCTACCACCACCAGAATGA

[0403] ACAAGGCTCCGGATACGCTGCTGATCTGAAGAGCACCCAAAACGCCATTGACAAGATCACCAACAAGGTCAACTCCGTCATCGAGA

[0404] AGATGAACACCCAGTTTACCGCCGTGGGCAAGGAATTTAACCACCTCGAGAAAAGGATCGAGAACCTCAACAAAAAGGTCGACGAC

[0405] GGCTTTCTCGACATTTGGACCTACAACGCCGAGCTGCTGGTGCTGCTCGAGAATGAGAGAACACTGGACTACCACGACTCCAATGT

[0406] CATCAATCTGTATGAGAAGGTGAGGAACCAGCTCAAGAACAACGCTAAGGAGATCGGAAACGGCTGCTTCGAGTTTTATCACAAGT

[0407] GCGATAACACATGCATGGAGTCCGTGAAAAACGGCACATACGACTATCCCAAGTACTCCGAAGAGGCTAAGCTCAATAGAGAGAAG

[0408] ATCGATGGCGTCGGCAGCGAGAATCTCTATTTCCAAGGCGGCAGCAAGGGCTATATCCCCGAGGCCCCTAGAGATGGCCAAGCCTA

[0409] TGTGAGGAAGGACGGCGAATGGGTGCTGCTGAGCACCTTCCTCGGCCATCACCATCACCACCACTGATGA

[0410] SEQ ID NO:14 Mut23

[0411] ATGAAAGCCATTCTGGTGGTGCTGCTGTACACCTTTACCACCGCCAATGCCGATACACTGTGCATCGGCTACCACGCCAATAACTC

[0412] CACCGACACCGTGGACACAGTGCTGGAGAAGAACGTGACCGTGACACACAGCGTGAACCTCCTCGAGGACAAGCACAACGGAAAGC

[0413] TGTGCAAGCTCGGCGGAGTGGCCCCTCTGCATCTGGGAAAGTGTAACATTGCCGGCTGGATTCTGGGAAACCCCGAGTGTGAATCT

[0414] CTGAGCACCGCTAGAAGCTGGAGCTACATTGTGGAGACCAGCAACAGCGACAACGGAACATGCTACCCCGGCGACTTTATCAATTA

[0415] CGAGGAACTGAGGGAGCAGCTGTCCTCCGTGAGCTCCTTTGAGAGGTTCGAGATCTTTCCCAAGACCAGCAGCTGGCCCAATCACG

[0416] ACTCCAACAAAGGAGTGACCGCTGCTTGCCCTCACGCCGGCGCTAAGAGCTTCTACAAAAACCTCATCTGGCTGGTGAAGAAGGGC

[0417] AACTCCTACCCCAAGCTGAACCAAACCTACATCAATGACAAAGGCAAGGAGGTCCTCGTGCTCTGGGGAATCCACCACCCTCCCAC

[0418] AACCGCTGACCAACAGAGCCTCTACCAGAACGCTGACGCCTATGTCTTTGTGGGAACCTCTAGGTACTCCAAGAAGTTCAAGCCCG

[0419] AGATTGCTACAAGGCCCAAGGTGAGAGACCAAGAGGGAAGAATGAATTACTACTGGACACTCGTGGAGCCCGGCGACAAAATCACC

[0420] TTCGAAGCCACCGGCAACCTCGTGGTCCCCAGATACGCCTTCACCATGGAGAGGAACGCTGGCTCCGGCATCATCATTAGCGACAC

[0421] ACCCGTGCACGACTGCAATACAACATGCCAAACAGCTGAGGGCGCCATCAATACCTCTCTGCCCTTTCAGAACGTGCACCCCGTGA

[0422] CAATCGGCAAATGCCCTAGGTACGTGAAGAGCACCAAGCTCAGACTCGCCACCGGACTGAGGAACGTGCCCTCCATCCAGTCTAGG

[0423] GGACTGTTTGGAGCCATTGCCGGCTTTATTGAGGGCGGCTGGACCGGAATGGTGGACGGATGGTACGGCTACCACCACCAGAATGA

[0424] ACAAGGCTCCGGATACGCCGCTGATCTGAAGAGCACACAGAATGCCATTGATAAGATTACCAACATGGTGAACAGCGTGATCGAGA

[0425] AGATGAACACCCAGTTCACCGCCGTCGGCAAGGAATTTAACCACCTCGAGAAAAGGATCGAGAACCTCAACAAAAAGGTCGACGAC

[0426] GGCTTCCTCGACATTGACACCTACAACGCTGAGCTGCTGGTGCTGCTGCTGAATGAGAGAACACTGGACTACCACGATAGCAATGT

[0427] CAAGAATCTGTATGAAAAGGTGAGAAACCAACTGAAGAACAACGCCAAGGAGATCGGAAACGGCTGCTTCGAGTTTTATCACAAGT

[0428] GCGATAACACATGCATGGAGTCCGTGAAAAACGGCACCTACGACTATCCCAAGTACTCCGAGGAGGCTAAGCTCAATAGAGAAAAG

[0429] ATCGACGGCGTCGGAAGCGAAAACCTCTACTTTCAAGGCGGCAGCAAGGGCTATATCCCCGAGGCTCCTAGAGATGGACAAGCCTA

[0430] TGTGAGGAAGGACGGCGAATGGGTCCTCCTCAGCACCTTTCTGGGACACCACCACCATCACCACTGATGA

[0431] SEQ ID NO:15 Mut24

[0432] ATGAAGGCTATTCTGGTCGTGCTGCTCTACACCTTTACCACCGCCAATGCCGATACACTGTGCATCGGCTATCACGCCAACAACAG

[0433] CACCGATACCGTCGACACCGTGCTGGAGAAGAACGTGACCGTCACACACAGCGTGAATCTGCTGGAGGACAAGCACAATGGCAAGC

[0434] TGTGCAAGCTGGGCGGAGTGGCCCCTCTGCATCTGGGCAAGTGTAATATTGCCGGATGGATTCTGGGCAACCCCGAGTGCGAGTCT

[0435] CTGAGCACCGCTAGAAGCTGGAGCTACATTGTGGAGACCAGCAACTCCGACAATGGCACATGCTACCCCGGCGATTTTATCAACTA

[0436] CGAGGAACTGAGGGAGCAGCTCAGCTCCGTCTCCAGCTTCGAGAGATTCGAAATCTTCCCCAAGACATCCAGCTGGCCCAACCATG

[0437] ACTCCAACAAGGGAGTGACAGCTGCTTGCCCTCACGCTGGCGCCAAAAGCTTCTACAAGAACCTCATTTGGCTGGTGAAGAAGGGC

[0438] AACTCCTATCCCAAGCTGAATCAAACATATATCAACGACAAGGGCAAGGAAGTGCTGGTGCTGTGGGGCATTCACCACCCTCCCAC

[0439] CACCGCTGATCAGCAGAGCCTCTACCAGAATGCCGACGCCTATGTGTTTGTGGGAACCTCTAGGTACTCCAAGAAGTTCAAGCCCG

[0440] AGATCGCCACAAGGCCCAAGGTGAGAGACCAAGAGGGAAGAATGAACTACTACTGGACACTGGTGGAGCCCGGCGATAAGATTACC

[0441] TTCGAGGCCACCGGCAATCTGGTCGTCCCCAGATATGCCTTCACCATGGAGAGAAACGCCGGCAGCGGAATCATTATCTCCGACAC

[0442] CCCCGTGCACGATTGCAACACCACATGCCAGACCGCCGAGGGCGCCATCAACACAAGCCTCCCTTTTCAGAACGTGCACCCCGTGA

[0443] CAATCGGCAAGTGTCCTAGGTACGTCAAGAGCACCAAGCTCAGACTGGCCACCGGACTGAGGAACGTGCCCTCCATCCAGTCTAGG

[0444] GGACTGTTTGGAGCCATTGCCGGCTTTATTGAGGGAGGATGGACCGGCATGGTCGATGGCTGGTACGGCTACCACCATCAGAATGA

[0445] ACAAGGCTCCGGATACGCTGCCGACCTCAAGAGCACACAGAATGCCATCGACAAGATCACAAATAAAGTCAACAGCGTGATCGAGA

[0446] AGATGAACACCCAGTTTACCGCCGTCGGCAAAGAGTTCAACCACCTCGAGAAGAGGATCGAGAACCTCAACAAGAAGGTGGACGAC

[0447] GGCTTTCTGGATATCGACACCTATCTGGCTGAGCTGCTGGTGCTGCTCGAGAATCAGTGGACACTGCTGTATCATGATTCCAACGT

[0448] CAAGAATCTGTACGAGAAGGTGAGAAACCAACTGAAGAACAACGCCAAGGAGATCGGAAACGGCTGCTTCGAGTTTTACCACAAGT

[0449] GCGATAATACATGCATGGAGAGCGTCAAGAACGGCACCTACGACTATCCCAAGTACTCCGAAGAGGCTAAGCTCAATAGAGAAAAG

[0450] ATCGACGGCGTCGGCAGCGAGAATCTCTATTTCCAAGGCGGCTCCAAGGGCTATATTCCCGAGGCTCCTAGAGACGGACAAGCCTA

[0451] TGTGAGGAAGGATGGCGAATGGGTGCTCCTCTCCACATTCCTCGGACACCACCATCACCACCACTGATGA

[0452] SEQ ID NO:16 Mut27

[0453] ATGAAGGCTATTCTGGTCGTCCTCCTCTACACCTTCACCACCGCTAATGCCGACACACTGTGCATCGGCTACCATGCCAACAACAG

[0454] CACCGATACAGTGGACACCGTGCTGGAGAAAAACGTGACCGTCACACACAGCGTGAATCTGCTGGAGGACAAGCACAATGGCAAGC

[0455] TGTGCAAGCTGGGCGGAGTGGCCCCTCTGCATCTCGGCAAGTGTAACATCGCTGGATGGATTCTGGGCAATCCCGAGTGCGAGTCT

[0456] CTGAGCACAGCTAGAAGCTGGAGCTACATTGTGGAGACCAGCAACAGCGACAACGGCACATGTTACCCCGGAGACTTCATCAATTA

[0457] CGAGGAGCTGAGAGAACAGCTCAGCTCCGTGTCCAGCTTTGAGAGATTCGAGATCTTCCCCAAGACCTCCAGCTGGCCCAACCACG

[0458] ACAGCAATAAGGGAGTGACCGCTGCTTGTCCCCACGCTGGCGCCAAGAGCTTCTACAAAAACCTCATCTGGCTGGTGAAGAAGGGC

[0459] AACTCCTACCCCAAACTCAACCAGACCTATATTAACGATAAAGGAAAGGAAGTGCTGGTGCTCTGGGGCATCCACCACCCTCCCAC

[0460]

[0461] SEQ ID NO: 17 - 42 show HA polypeptide antigens containing (one or more) mutations compared to the H1 Brisbane 18 WT sequence

[0462] SEQ ID NO: 17

[0463] >Flu622

[0464] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALMNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0465] SEQ ID NO: 18

[0466] >Flu629

[0467] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNMLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0468] SEQ ID NO:19

[0469] >Flu632

[0470] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGILNFLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0471] SEQ ID NO:20

[0472] >Flu638

[0473] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGVLNILIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALMNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0474] SEQ ID NO:21

[0475] >Flu639

[0476] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEPEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0477] SEQ ID NO:22

[0478] >Flu643

[0479] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYIAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0480] SEQ ID NO:23

[0481] >Flu650

[0482] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGFFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQLTIALTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0483] SEQ ID NO:24

[0484] >Flu672

[0485] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFMKTMKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0486] SEQ ID NO:25

[0487] >Flu679

[0488] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0489] SEQ ID NO:26

[0490] >Flu680

[0491] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0492] SEQ ID NO:27

[0493] >Flu681MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALMNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0494] SEQ ID NO:28

[0495] >Flu682MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGVLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0496] SEQ ID NO:29

[0497] >Flu683

[0498] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGVLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0499] SEQ ID NO:30

[0500] >Flu685MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGMLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALVNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0501] SEQ ID NO:31

[0502] >Flu686

[0503] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGMLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0504] SEQ ID NO:32

[0505] >Flu687

[0506] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGMLNLLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0507] SEQ ID NO:33

[0508] >Flu688MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNMLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0509] SEQ ID NO:34

[0510] >Flu689MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNFLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0511] SEQ ID NO:35

[0512] >Flu690

[0513] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNFLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0514] SEQ ID NO:36

[0515] >Flu691

[0516] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGILNFLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0517] SEQ ID NO:37

[0518] >Flu692

[0519] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNILIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0520] SEQ ID NO:38

[0521] >Flu693

[0522] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGLLNILIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0523] SEQ ID NO:39

[0524] >Flu695MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGVLNILIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALLNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0525] SEQ ID NO:40

[0526] >Flu696

[0527] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGVLNILIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALINQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0528] SEQ ID NO:41

[0529] >Flu697

[0530] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGVLNILIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLDSYNAELLVALMNQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0531] SEQ ID NO:42

[0532] >Flu707

[0533] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEPEGRVQDLEKYVEDTKIDLDSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0534] SEQ ID NO:43 Darw21 signal peptide

[0535] MKTIIALSNILCLVFA

[0536] SEQ ID NO:44 - 69 show the nucleotide sequences encoding the amino acid sequences of SEQ ID NO:17 - 42

[0537] SEQ ID NO:44

[0538] >Flu622

[0539]

[0540] SEQ ID NO:45

[0541] >Flu629

[0542]

[0543] SEQ ID NO:46

[0544] >Flu632

[0545]

[0546] SEQ ID NO:47

[0547] >Flu638

[0548]

[0549] SEQ ID NO:48

[0550] >Flu639

[0551]

[0552] SEQ ID NO:49

[0553] >Flu643

[0554]

[0555] SEQ ID NO:50

[0556] >Flu650

[0557]

[0558] SEQ ID NO:51

[0559] >Flu672

[0560]

[0561] SEQ ID NO:52

[0562] >Flu679

[0563]

[0564] SEQ ID NO:53

[0565] >Flu680

[0566]

[0567] SEQ ID NO:54

[0568] >Flu681

[0569]

[0570] SEQ ID NO:55

[0571] >Flu682

[0572]

[0573] SEQ ID NO:56

[0574] >Flu683

[0575]

[0576] SEQ ID NO:57

[0577] >Flu685

[0578]

[0579] SEQ ID NO:58

[0580] >Flu686

[0581]

[0582] SEQ ID NO:59

[0583] >Flu687

[0584]

[0585] SEQ ID NO:60

[0586] >Flu688

[0587]

[0588] SEQ ID NO:61

[0589] >Flu689

[0590]

[0591] SEQ ID NO:62

[0592] >Flu690

[0593]

[0594] SEQ ID NO:63

[0595] >Flu691

[0596]

[0597] SEQ ID NO:64

[0598] >Flu692

[0599]

[0600] SEQ ID NO:65

[0601] >Flu693

[0602]

[0603] SEQ ID NO:66

[0604] >Flu695

[0605]

[0606] SEQ ID NO:67

[0607] >Flu696

[0608]

[0609] SEQ ID NO:68

[0610] >Flu697ATGAAGACCATCATCGCCCTGAGCAACATCCTGTGCCTGGTGTTTGCTCAGAAGATCCCCGGCAACGACAACAGCACCGCCACCCT

[0611]

[0612] SEQ ID NO:69

[0613] >Flu707

[0614]

[0615] SEQ ID NO:70

[0616] H1 WT foldon sequence: signal sequence–HA–TEV cleavage site–foldon–His tag

[0617]

[0618]

[0619] H3 WT foldon sequence: signal sequence–HA–TEV cleavage site–foldon–His tag

[0620] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVGSENLYFQGGSKGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

[0621] SEQ ID NO:72

[0622] Figure 2 The HA extracellular domain sequence shown from Bri18

[0623] MKAILVVLLYTFTTANADTLCIGYHANNSTDTVDTVLEKNVTVTHSVNLLEDKHNGKLCKLGGVAPLHLGKCNIAGWILGNPECESLSTARSWSYIVETSNSDNGTCYPGDFINYEELREQLSSVSSFERFEIFPKTSSWPNHDSNKGVTAACPHAGAKSFYKNLIWLVKKGNSYPKLNQTYINDKGKEVLVLWGIHHPPTTADQQSLYQNADAYVFVGTSRYSKKFKPEIATRPKVRDQEGRMNYYWTLVEPGDKITFEATGNLVVPRYAFTMERNAGSGIIISDTPVHDCNTTCQTAEGAINTSLPFQNVHPVTIGKCPKYVKSTKLRLATGLRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADLKSTQNAIDKITNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDIWTYNAELLVLLENERTLDYHDSNVKNLYEKVRNQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSEEAKLNREKIDGV

[0624] SEQ ID NO:73

[0625] Figure 2 The HA extracellular domain sequence from Darw21 as shown

[0626] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICDSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGV

[0627] Example

[0628] Example 1 - Design and construction of the HA construct of the influenza A virus strain

[0629] (a) Influenza A virus strain H1 (Group 1)

[0630] Recombinant expressed H1 hemagglutinin has been shown to be sub - optimal and difficult to maintain its trimeric conformation. To attempt to reduce the risk of losing the trimeric conformation of the extracellular domain and improve both manufacturability and antigenic properties, the three - dimensional modeled structure of A / Brisbane / 02 / 2018 (H1N1) HA was thoroughly analyzed using MOE to identify potentially interesting positions in HA2 and helix B of HA1 (see Figure 1 , Figure 2 and Figure 3 ) and their surrounding environments to introduce mutations to improve trimeric conformation stability.

[0631] Using the three - dimensional modeled structure of the HA of the A / Brisbane / 02 / 2018 (H1N1) strain, several positions were identified for mutation to attempt to stabilize the trimeric conformation:

[0632] Positions 450, 453, 460, 464, and 467, where mutations to hydrophobic residues can promote hydrophobic repulsion and favor trimer formation, and the resulting trimeric coiled-coil structure is stabilized by these hydrophobic interactions.

[0633] Positions such as 322, 436, and 438, where mutations to polar charged residues can favor protomer interactions.

[0634] Positions 395 and 447 in HA2 helix A and HA2 helix B, respectively, can be targeted by either hydrophobic enhancement or cavity filling / hydrogen bond introduction to improve HA1 / HA2 interaction.

[0635] These mutations are introduced individually as single amino acid substitutions or in combination to have potential additive effects. Combinations of mutations used in extracellular domain constructs are shown in Tables 1 and 2.

[0636] (b) Influenza A H3 strain (Group 2)

[0637] The three-dimensional modeled structure of A / Darwin / 9 / 2021 H3N2 HA was thoroughly analyzed using MOE to identify positions of potential interest in HA2 and HA1 helix B (see Figure 2 Figure 3 Figure 4 ) and their surrounding environments for introducing mutations to improve trimer conformational stability.

[0638] Using the three-dimensional modeled structure of A / Darwin / 9 / 2021 H3N2 strain HA, several positions were identified for mutating in an attempt to stabilize the trimer conformation:

[0639] Positions 347, 440, 451, 454, 455, and 468, where mutations to hydrophobic residues can promote hydrophobic repulsion and favor trimer formation, and the resulting trimeric coiled-coil structure is stabilized by these hydrophobic interactions.

[0640] Position 418 at the end of the inter-helical loop connecting helices A and B, for which mutation to proline can prevent post-fusion conformation formation through the steric hindrance introduced by the specific side chain of proline.

[0641] Positions 369, 399, and 448 (the first in HA2 helix A and the last two in HA2 helix B) can be targeted by either hydrophobic enhancement or cavity filling / hydrogen bond introduction to improve HA1 / HA2 interaction.

[0642] Position such as 437, where mutations to polar and charged residues can favor protomer interactions.

[0643] ​​These mutations were introduced individually as single amino acid substitutions or in combination to have potential additive effects. The combinations of mutations used in the extracellular domain constructs are shown in Table 3.

[0644] Example 2 - Cloning, Protein Expression, and Purification

[0645] Cloning

[0646] The gene was codon-optimized for human protein expression, synthesized by GENEWIZ, and cloned into the pmaxCloning TM vector (Lonza, catalog number VDC-1040) using the EcoRI / NotI restriction endonuclease sites. The pmaxCloning TM vector backbone contains the cytomegalovirus immediate early promoter (PCMV IE) for protein expression, a chimeric intron for enhanced gene expression, and a pUC origin of replication for propagation in E. coli. The bacterial promoter (P) provides expression of the kanamycin resistance gene in E. coli. The multiple cloning site (MCS) is located between the CMV promoter and the SV40 polyadenylation signal (SV40 poly A).

[0647] Each construct contains a sequence encoding the extracellular domain of influenza hemagglutinin (HA) of SEQ ID NO:1 or 2, with mutations including those shown in Table 1, Table 2, or Table 3. All constructs are fused at the C-terminus to a TEV cleavage site, followed by a foldon, followed by a 6xHis tag (except for mut10, which does not have a TEV cleavage site).

[0648] Expression

[0649] Expi293F TM cells (ThermoFisher, catalog number A14528) were used for recombinant protein expression. Cell culture and transfection were performed according to the manufacturer's instructions. Small-scale cultures (3 mL cultures in 24-well deep plates) were used for screening of candidates, while medium-scale cultures (125 mL) were used for the selected lead candidates.

[0650] One day before transfection, the cell density and viability were evaluated using a TC20 TM automated cell counter (Bio-Rad). The cells were seeded in fresh pre-warmed Expi293 TM expression medium (ThermoFisher, catalog number A1435102) at a density of 2·10 6 cells / mL and cultured at 110 rpm in a 37 °C humidified 8% CO2 incubator. On the day of transfection, the cell density and viability (viability ≥ 95%) were evaluated, and fresh pre-warmed Expi293 TMThe expression medium was used to dilute the cells to a final density of 3·10 6 cells / mL. Transfection was performed using the ExpiFectamine TM 293 Transfection Kit (Thermofisher, cat. no. A14524) containing a transfection enhancer and ExpiFectamine 293 transfection reagent. Briefly, plasmid DNA and transfection reagent were diluted separately in OptiMEM medium (Thermofisher, cat. no. 31985062) and incubated at RT for 5 min (1 μg plasmid DNA was used per 1 mL of cell culture). Then the two mixtures were combined and incubated at RT for another 20 min. Then the ExpiFectamine TM 293 / plasmid DNA complex solution was carefully added to the cells. The cells were cultured at 110 rmp in a 37 °C humidified 8% CO2 incubator. On day 1 post-transfection (18 - 22 h post-transfection), ExpiFectamine TM 293 transfection enhancers 1 and 2 were added. On day 4 post-transfection, the cells were harvested by centrifugation at 5000 xg for 10 min at 4 °C. The cell pellet was discarded and Complete TM Protease Inhibitor Cocktail (Roche, cat. no. 11697498001) was added to the supernatant. Protein expression was checked by SDS-PAGE and Western blotting before purification (data not shown).

[0651] Purification

[0652] Purification of HTP expression (2.5 mL cultures in 24-deep well format) was performed by adding 200 μL of Nickel Sepharose Excel (GE) slurry pre-equilibrated in buffer A (20 mM Bicine, 500 mM NaCl, 20 mM imidazole, pH 8.3) and 0.2 mM 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF) (Sigma) and 20 mM Bicine pH 8.3. After shaking overnight at 900 rmp, the samples were transferred to a 96DW Thompson filter plate and washed 3 times with 1 mL of buffer A under negative pressure. Proteins were eluted by centrifugation (for 10 minutes at 800 g) with 2 x 110 μL of buffer B (20 mM Bicine, 500 mM NaCl, 500 mM imidazole, pH 8.3), desalted by PD multitrap G-25 and analyzed by SDS-PAGE.

[0653] Purification of medium-scale expression (125 mL culture) was performed by gravity flow column packed with 3 mL Nickel Sepharose Excel (GE) pre-equilibrated in buffer A (20 mM Bicine, 500 mM NaCl, 20 mM imidazole, pH 8.3). After sample loading, the resin was washed with 15 CV of buffer A and the protein was eluted with 4 CV of buffer B (20 mM Bicine, 500 mM NaCl, 500 mM imidazole, pH 8.3). The protein was then concentrated at 4 °C using Vivaspin 20 with a cut-off of 10 KDa at 3000 g. The concentrated sample was loaded onto a Superdex 200 increase 10 / 300 (GE) or Superdex 200 16 / 600 (GE) equilibrated in buffer C (20 mM bicine, 150 mM NaCl, pH 8.3) at a flow rate of 0.75 ml / min. The fractions corresponding to the protein of interest were pooled, filtered through 0.22 μM, and stored at -80 °C.

[0654] Protein concentration was determined by RCDC assay (Biorad), while purity was determined by SDS-PAGE.

[0655] Characterization

[0656] UPLC - Ultra Performance Liquid Chromatography

[0657] The stability of the trimeric assembly of semi-purified HA constructs from high-throughput screening (HTS) experiments was evaluated by HPLC-SEC-UV. Briefly, 10 μl of each preparation was injected at 0.3 ml / min onto a 4.6 x 150 mm BEH column (Acquity) with a pore size of 200 A. UV at 280 nm was recorded during a 10-minute run. During the experiment, the column was maintained at 30 °C while the samples were kept at 8 °C. The elution time of the HA peak was compared to a calibration standard (Waters BEH200 SEC Protein Standard Mix, reference number Waters 186006518). Based on the retention time, the peak areas in the predefined elution regions of aggregates, oligomers, trimers, and monomers were recorded respectively.

[0658] BLI - Biolayer Interferometry

[0659] The Octet Red instrument (Pall-ForteBio, Menlo Park, USA) was used for all IgG binding measurements. All measurements were performed in 1x Kinetics Buffer (KB) (Pall-ForteBio, Menlo Park, USA). Mutant proteins were prepared by diluting the protein solution to a concentration of 263 nM in KB 1x and immobilized on Ni-NTA sensor tips for 180 s. Unbound ligands were washed by incubating the sensor tips in buffer solution for 60 s. Binding was monitored for 300 s while dipping the sensor tips into KB solutions of FI6v3 or CR9114 (4000 nM–62.5 nM). Dissociation was monitored for 60 s while dipping the sensor tips into 1x KB buffer.

[0660] Differential scanning fluorimetry

[0661] Between 20 °C and 95 °C, the thermal unfolding of 0.5 mg / ml HA was monitored by the fluorescence of endogenous Trp (in a NanoDSF NT-Plex instrument (Nanotemper Technologies, Munich, Germany), at 330 and 350 nm, using 290 nm excitation) or added Sypro Orange (in a LightCycler 480, Roche, Basel, Switzerland, at 640 nm, using 498 nm emission). The temperature was increased at rates of 1 °C / min and 0.3 °C / s, respectively. The fluorescence intensity (SYPRO) or the intensity ratio at 330 and 350 nm (Trp) was used to calculate the change for each temperature increase and qualitatively evaluate the position of the major transition.

[0662] Differential scanning calorimetry (DSC)

[0663] In a MicroCal PAEQ-n automated DSC (Malvern Panalytical, France), the unfolding of 0.4 mg / ml HA was traced at 5 °C intervals between 20 °C and 95 °C. The data were analyzed in the integrated software to determine the melting temperature.

[0664] AUC

[0665] Sedimentation velocity analytical ultracentrifugation (SV-AUC) was performed to determine the molecular weight and stoichiometry of the protein by measuring the rate at which the molecules move through the buffer in response to the centrifugal force.

[0666] SV-AUC was performed using a Beckman-Coulter Optima AUC analytical ultracentrifuge with an AN-60Ti rotor, and the protein was at 0.5 mg / mL and frozen at -80 °C before the experiment. The selected rotor speed for the run was 20,000 rpm, the temperature was maintained at 20 °C, and the absorption spectrum at 280 nm was recorded every minute.

[0667] The protein specific density and solvent density were calculated by using the software SEDNTERP 1 (Sedimentation Interpretation Program version 1.11). The data set was analyzed using the continuous size distribution c(s) model with the Sedfit 15.01b program.

[0668] Circular dichroism spectroscopy

[0669] Far-UV CD spectra were acquired on a Chirascan spectrometer at a concentration of 0.2 mg / ml of the HA candidate in 4 mM Bicine pH 8.3 and 30 mM NaCl. Spectra were acquired between 190 and 260 nm using a cell with a path length of 0.5 mm and a bandwidth of 1 nm. The temperature was maintained at 25 °C. Thermal melting up to 95 °C was achieved by raising the temperature by 1 degree per minute, holding that temperature for 2 min, and then acquiring spectra after every 5-degree increase.

[0670] Results of the extracellular domain construct of Example 3-A / Brisbane / 02 / 2018 (H1N1)

[0671] Table 4

[0672]

[0673]

[0674] n.d. Not determined

[0675] n.o. Not observed

[0676] * Abnormal elution volume suspected to be caused by non-specific interaction with the column

[0677] ** Polydisperse

[0678] *** Except for Mut24 $ In all cases, KD was similar to the control except for a 100-fold decrease in affinity

[0679] **** Convoluted peaks

[0680] 3m– trimer

[0681] mo– monomer

[0682] The first batch of constructs based on Bri18 HA were designed, prepared, and evaluated according to the previous embodiments. A total of 33 extracellular domain constructs were investigated (see Table 2). For the 6 lead constructs (see Table 1), the readings from the characterization studies described in Example 2 are shown here. The readings were combined to produce a summary view of the data in Table 4. AUC and DSF were performed after TEV cleavage. Experiments were performed in the presence of the trimerization domain unless otherwise stated.

[0683] As confirmed by AUC, all constructs except Mut27 remained in the trimeric form. The abnormal elution by UPLC was attributed to non-specific interaction with the BEH column matrix. Consistent with this, Mut27 showed a reduced response to antibody recognition. Mut18 and Mut24 also showed poor antibody recognition. Mut10, Mut17, and Mut23 retained antibody recognition and improved trimer stability. Three unfolding events were observed by nanoDSF upon HA unfolding. By comparison with the foldon stability alone (not shown), the highest melting temperature (at about 80 °C) was attributed to the dissociation of the foldon. It is speculated that Tm1 in Table 4 represents the unfolding of the HA head (based on its disappearance due to acidification), while it is speculated that Tm2 represents the unfolding of the stem. Tm1 and Tm2 were increased by at least 2 °C in all three mutants, indicating overall stabilization of the HA trimer due to the mutations. When the foldon was cleaved from the control and Mut10, Mut17, and Mut23, the mutants showed an increased trimer population as determined by AUC and an improved thermal stability as determined by nanoDSF compared to the control (not shown).

[0684] Results of Example 4 - A / Darwin / 9 / 2021 H3N2 extracellular domain constructs

[0685] High-throughput screening of the Darw21 constructs:

[0686] The constructs were characterized with the following readings:

[0687] - Productivity: The amount of purified protein was measured by a colorimetric method (expressed in mg / L).

[0688] Previous analyses have shown that higher productivity is generally associated with more stable folding.

[0689] We used this parameter as a selection criterion for the full extracellular domain constructs.

[0690] - UPLC-SEC: To distinguish the soluble forms of the protein (monomer, trimer, higher oligomers, or soluble aggregates). Each form is shown as a (partial) in the elution profile

[0691] Separate peaks.

[0692] -BLI: A biosensor technology used to quantify the binding of structure-specific immune tools to immobilized mutants. Here, the CR9114 and FI3v6 monoclonal antibodies were used to probe the stem region of the protein. As the antibody ligand binds to the immobilized HA protein mutants, this binding was recorded as an increase in the thickness (expressed in nm) of the sensing surface. In previous experiments, we observed an increase in the binding to more stable HA trimers.

[0693] -Differential scanning fluorimetry: A protein folding fingerprint technique used to confirm protein folding stability by measuring the unfolding temperature (Tm, expressed in °C) compared to the reference Darw21 sequence. This reading is used to ensure that the mutation pattern does not disrupt protein folding. The reading is based on intrinsic protein fluorescence or by tracking the change in fluorescence of an externally added hydrophobic SYPRO Orange probe.

[0694] -Differential scanning calorimetry: A protein folding fingerprint technique used to confirm protein folding stability by measuring the unfolding temperature (Tm, expressed in °C) compared to the reference Darw21 sequence. The heat capacity reading is used to ensure that the mutation pattern does not disrupt protein folding.

[0695] -Circular dichroism spectroscopy: A protein folding fingerprint technique used to confirm the structure and stability of protein folding by measuring the secondary structure composition and its denaturation compared to the reference Darw21 sequence. This reading is used to ensure that the mutation pattern does not alter protein folding.

[0696] The expression, purification, oligomeric state (by UPLC), and antigenic characteristics of 135 constructs were analyzed by identifying the CR9114 and FI3v6 antibodies. Twenty-six constructs that produced HA trimers were selected for in-depth characterization, which had strong antibody-binding ability at or above the level of the Darwin21 control or had significantly improved affinity.

[0697] After selecting 26 candidates, medium-scale expression and purification were carried out to confirm the productivity of each selected candidate and to provide more protein material for characterization purposes. At medium scale, the following characterization assays were performed:

[0698] -UPLC was used to evaluate the trimer conformation after foldon cleavage. This reading provides an analysis of the intrinsic oligomeric state of the HA trimer.

[0699] - NanoDSF (measuring changes in intrinsic fluorescence) and DSF (measuring changes in fluorescence of exogenously added SYPRO Orange) were used to evaluate the stability of the trimer after foldon cleavage to assess the intrinsic stability of the HA trimer. In addition to the previous experiments, DSC (measuring changes in heat capacity) and CD spectroscopy (measuring changes in secondary structure) were performed on the top candidate constructs to help attribute the unfolding to specific domains of the HA trimer.

[0700] - BLI was repeated on the foldon-containing samples using CR9114 and FI6v3 as probes

[0701] to determine the conformation of the stem region of the construct relative to the reference.

[0702] The results are shown in Table 5. Overall, the nanoDSF and DSF measurements showed a major transition at equivalent melting temperatures. Compared to the control, five candidates increased the melting temperature by 2 °C to 5 °C: Flu632, Flu639, Flu643, Flu691, and Flu689. All of these, except Flu639 and Flu643, increased the affinity for FI6v3 by approximately 10-fold or more. Several other candidates increased the FI6v3 affinity by 5-fold or less without increasing the melting temperature.

[0703] The stability and antibody affinity of the 5 top candidate constructs were further analyzed. Additionally, Flu690, which had the highest increase in FI6v3 affinity (approximately 100-fold), which increased the CR9114 affinity (10-fold) but was not thermostabilized, and Flu687, which increased the affinity for FI6v3 by 5-fold and did not increase the CR9114 affinity or melting temperature, were analyzed.

[0704] When the unfolding of the H3 Darwin 21 control was followed by Trp fluorescence, a single transition was shown. In contrast, when the unfolding was followed by SyproOrange, which binds to exposed hydrophobic residues, and differential scanning calorimetry, two transitions were observed. Thermal unfolding followed by circular dichroism spectroscopy also indicated two transitions due to a two-step unfolding of the helical content. However, the β-sheet structure unfolded in a single cooperative transition.

[0705] Flu632 and Flu691 showed spectra similar to the control in fluorescence and calorimetry, but the melting temperature of each transition shifted 5 °C to higher temperatures, indicating a stabilized trimeric helix. Two transitions of the helix and sheet contents were observed, indicating strong cooperativity in the unfolding of the entire structure but potentially suggesting a heterogeneous population. The same features were observed for Flu689 except that the mutation only resulted in a 2 °C increase in the melting transition, and this was also the only stabilized construct that showed an increased affinity for CR9114 (by approximately 10-fold).

[0706] Differential scanning fluorimetry measured by Trp or SyproOrange and thermal unfolding followed by circular dichroism spectroscopy showed that Flu639 and Flu643 increased the stability of the helical and sheet segments in the structure and increased the cooperativity of unfolding, such that only one transition was observed at a melting temperature 5 °C higher than the control. These data are consistent with a homogeneous stabilized HA trimer, but these constructs did not show an affinity for antibodies higher than the control.

[0707] Table 5

[0708]

[0709] * Flu constructs with at least a 10-fold increase in the KD value for FI6v3 were selected for further characterization

[0710] ** Unfolding pattern based on integrated data from calorimetry, nanoDSF, DSF, and secondary structure determined by circular dichroism spectroscopy

[0711] Example 5 - Transfection and purification of Mut10 hemagglutinin extracellular domain and Fab FI6v3

[0712] In 500 mL Expi293F TMPlasmids encoding the extracellular domain of Mut10 hemagglutinin (HA) or the FI6v3 Fab domain were transiently expressed in GnTI cells (ThermoFisher Scientific), each engineered to have a C-terminal hexahistidine tag. Five days after transfection, the culture supernatant containing Mut10HA was harvested and filtered using a 0.22 μm filter, then purified by nickel affinity chromatography on an AKTA Avant system. The culture supernatant was loaded onto a HisTrap column (Cytiva Life Sciences) previously equilibrated in a buffer consisting of 25 mM HEPES pH 7.5, 150 mM NaCl. The captured protein was eluted in a step gradient manner with an elution buffer consisting of 150 mM NaCl, 500 mM imidazole in 25 mM HEPES buffer, pH 7.5. The step gradient was as follows: starting from 4% elution buffer for 5 column volumes, followed by a gradient of 4 - 25% elution buffer for 5 column volumes, 25% step elution buffer for 5 column volumes, 25% - 50% gradient for 5 column volumes, 50% elution buffer for 5 column volumes, 50% - 100% elution buffer gradient for 5 column volumes, and finally 100% step elution for 5 column volumes. The protein eluted in 4% and 18% elution buffer, corresponding to 20 mM and 90 mM imidazole respectively. The fractions eluted in 4% and 18% imidazole were collected and concentrated to 1 mL using a 10 kDa Amicon UltraCentrifugal Concentrator filtration unit (EMD Millipore), then filtered on a 0.22 μm filter and loaded onto a HiLoad 16 / 600 Superdex200pg column (Cytiva Life Sciences) pre-equilibrated with the equilibrium buffer at 1 ml / min. The chromatogram showed two peaks, where the first peak eluted between 40 - 50 mL, while the second larger peak eluted between 55 - 68 mL. The peak fractions were analyzed by SDS-PAGE to assess purity and identify the target protein, showing that the target protein eluted between 55 - 69 mL of the second peak and was determined to be >95% pure. The fractions were collected and stored in the equilibrium buffer at -80 °C until further use.

[0713] For the FI6v3 Fab, 5 days after transfection, the culture supernatant was harvested and filtered using a 0.22 μm filter, and then purified on an AKTA Avant system by nickel affinity chromatography. The culture supernatant was loaded onto a HisTrap column (Cytiva Life Sciences) equilibrated in a buffer composed of 25 mM HEPES pH 7.5 and 150 mM NaCl. The captured protein was eluted in a step gradient manner with an elution buffer composed of 25 mM HEPES pH 7.5, 150 mM NaCl, and 500 mM imidazole. The step gradient was performed in a similar manner as above but with slight modifications. The step gradient was carried out as follows: starting from 4% step elution buffer for 5 column volumes, followed by a gradient of 4 - 25% elution buffer for 5 column volumes, 25% step elution buffer for 5 column volumes, a gradient of 25% - 100% for 5 column volumes, and finally 100% step elution buffer for 5 column volumes. The protein was eluted in 4% and 6% - 22% elution buffer, which corresponded to 20 mM and 30 - 110 mM imidazole, respectively. The fractions eluted in 4% and 6% - 22% imidazole were collected and concentrated to 1 mL using a 10 kDa Amicon Ultra Centrifugal Concentrator filtration unit (EMD Millipore), then filtered on a 0.22 μm filter, and loaded onto a HiLoad 16 / 600 Superdex 200 pg column (Cytiva Life Sciences) pre-equilibrated with a buffer composed of 25 mM HEPES pH 7.5 and 150 mM NaCl at 1 ml / min. The chromatogram showed two peaks, where the first peak eluted between 46 - 70 mL and the other larger peak eluted between 91 - 114 mL. The peak fractions were analyzed by SDS-PAGE to assess purity and identify the target protein, which showed that the target protein eluted between 91 - 114 mL of the second peak and was determined to be >95% pure. The fractions were collected and stored in the equilibration buffer at -80 °C until further use.

[0714] Crystallization of the Mut10:FI6v3 complex

[0715] Two proteins were concentrated to 10 mg / ml using a 10 kDa Amicon Ultra Centrifugal Concentrator filter unit (EMD Millipore). Mut10 and FI6v3 Fab were mixed at a 1:1.2 molar ratio and incubated overnight at 4 °C to ensure complex formation. High-throughput crystal screening was performed in a 96-well sitting-drop plate (Art Robbins Instruments) with a 1:1 protein-buffer ratio using a Gryphon Robotics Instrument (Art Robbins Instruments). The crystal screening was incubated at 20 °C in a Formulatrix Rock Imager 1000 (Formulatrix), and the droplets were imaged according to a Fibonacci schedule (i.e., 0, 1, 2, 3, 5 days, etc.). Several crystal hits were obtained, and the conditional hits are listed in Table 6. The crystals were harvested, cryoprotected with 20% ethylene glycol, flash-frozen in liquid nitrogen, and shipped to the Advanced Photon Source at Argonne National Labs for data collection. The best diffracting crystals were found to be from a condition containing 10% w / v 2-propanol, 0.1 M HEPES pH 7.5, and 20% w / v PEG4000 (crystals appeared after 8 days and grew to full size on day 13). The diffraction data were processed using HKL2000, resulting in a resolution of 2.9 Å and a space group of I213.

[0716] Molecular replacement and refinement

[0717] The structures of the extracellular domain of influenza A virus H1 A / Michigan / 45 / 2015 (PDB ID 7KNA) and the heavy and light chains of the F16v3 antibody (PDB ID 3ZTJ) were modified using PHENIX Sculptor and used as search models for molecular replacement of the extracellular domain of Mut10HA and F16v3 Fab in PHENIX Phaser [1-3]. One molecule of the Mut10:F16v3 Fab complex was found to occupy the asymmetric unit, and symmetry was applied to generalize the expected HA trimer bound by three copies of the FI6v3 Fab ( Figure 1 ). PHENIX Refinement and Coot were used to refine the model through iterative rounds of refinement [4-6]. Final validation was performed using MOLPROBITY, and the statistics are shown in Table 6 [7].

[0718] Structural analysis and comparison of the Mut10:F16v3 complex

[0719] The structure of Mut10 contains a single K395M mutation buried between two α-helices of residues 382 - 402 and 419 - 470 of the HA2 polypeptide chain, resulting in the replacement of the positively charged lysine residue with the uncharged non-polar methionine. Despite this mutation, the structure shows that the binding of F16v3 remains conserved at this epitope. The superposition of a single HA protomer from Mut10 with a single HA protomer from H1 HA (PDB ID 3ZTN) gives an RMSD of 0.52 over 399 Cα atoms, confirming the nearly identical structural conservation between these two structures.

[0720] Table 6: Crystallization condition hits for the Mut10:F16v3 complex.

[0721]

[0722]

[0723] Table 7. Data collection and refinement statistics.

[0724]

[0725]

[0726] *Statistics for the highest resolution shell are shown in parentheses.

[0727] References for Example 5:

[0728] 1. Bunkóczi, G. and R. J. Read. "Improvement of molecular-replacement models with sculptor." Acta Crystallogr D Biol Crystallogr 67 (2011): 303 - 12.

[0729] 2. Adams, P. D., P. V. Afonine, G. Bunkóczi, V. B. Chen, I. W. Davis, N. Echols, J. J. Headd, L. W. Hung, G. J. Kapral, R. W. Grosse-Kunstleve et al., "Phenix: A comprehensive python-based system for macromolecular structure solution." Acta Crystallogr D Biol Crystallogr 66 (2010): 213 - 21.

[0730] 3. Liebschner, D., P. V. Afonine, M. L. Baker, G. Bunkóczi, V. B. Chen, T. I. Croll, B. Hintze, L. W. Hung, S. Jain, A. J. McCoy et al., "Macromolecular structure determination using x-rays, neutrons and electrons: Recent developments in phenix." Acta Crystallogr D Struct Biol 75 (2019): 861 - 77.

[0731] 4. Afonine, P. V., B. K. Poon, R. J. Read, O. V. Sobolev, T. C. Terwilliger, A. Urzhumtsev and P. D. Adams. "Real-space refinement in phenix for cryo-em and crystallography." Acta Crystallogr D Struct Biol 74 (2018): 531 - 44.

[0732] 5. Emsley, P., B. Lohkamp, W. G. Scott and K. Cowtan. "Features and development of coot." Acta Crystallogr D Biol Crystallogr 66 (2010): 486 - 501.

[0733] 6. Emsley, P. and M. Crispin. "Structural analysis of glycoproteins: Building n-linked glycans with coot." Acta Crystallogr D Struct Biol 74 (2018): 256 - 63.

[0734] 7. Williams, C.J., J.J. Headd, N.W. Moriarty, M.G. Prisant, L.L. Videau, L.N. Deis, V. Verma, D.A. Keedy, B.J. Hintze, V.B. Chen et al., "Molprobity: More and better reference data for improved all-atom structure validation." Protein Sci 27 (2018): 293 - 315.

[0735] Example 6 - Mouse Immunogenicity Study

[0736] Study A

[0737] At the beginning The immunogenicity of a trimeric protein of the full extracellular domain of influenza HA containing foldon and based on the A / Brisbane / 02 / 2018 H1 sequence was evaluated in naïve CB6F1 mice. Female CB6F1 mice were immunized intramuscularly twice, 28 days apart, with the following:

[0738] (a) Mut10, 0.2 μg / dose, containing AS03A adjuvant, -1 / 10 human dose (HD);

[0739] A total of 20 animals were used for this group (divided into 2 independent studies)

[0740] (b) Mut23, 0.2 μg / dose, containing AS03A adjuvant, -1 / 10 human dose (HD);

[0741] A total of 20 animals were used for this group (divided into 2 independent studies)

[0742] (c) QIV 2019 / 2020 (a commercially available quadrivalent influenza vaccine from GlaxoSmithKline (GSK), containing inactivated and split influenza virions of the strains A / Brisbane / 02 / 2018 H1N1,

[0743] A / Kansas / 14 / 2017 H3N2, B / Colorado / 06 / 2017 (B / Victoria)

[0744] and B / Phuket / 3073 / 2013 (B / Yamagata)), 2.66 μg / strain / dose, without adjuvant; A total of 8 animals were used for this group (divided into 2 independent studies)

[0745] (d) QIV 2019 / 2020, 0.27 μg / dose / strain, containing AS03A adjuvant, -1 / 10 human dose (HD); a total of 8 animals were used for this group (divided into 2 independent studies)

[0746] (e) NaCl as a placebo control group; a total of 4 animals were used for this group (divided into 2 independent studies)

[0747] Due to volume limitations, as highlighted on each figure, some assays were performed on pooled serum samples rather than on individual serum samples.

[0748] Spleen and serum samples were collected on day 42 (corresponding to 14 days after the second immunization) and analyzed using the assay protocol described in Example 7, as described in Examples 8 to 13.

[0749] Study B

[0750] Another study was conducted to evaluate the immunogenicity of the influenza HA full extracellular domain construct in primed CB6F1 mice. Female CB6F1 mice were primed intranasally with whole inactivated influenza virus A / California / 7 / 2009 H1N1 on day 0 and immunized intramuscularly on days 28 and 56 with the following:

[0751] (a) Mut10, 0.2 μg / dose, containing AS03A adjuvant, -1 / 10 human dose (HD);

[0752] A total of 20 animals were used for this group

[0753] (b) Mut23, 0.2 μg / dose, containing AS03A adjuvant, -1 / 10 human dose (HD);

[0754] A total of 20 animals were used for this group

[0755] (c) QIV 2019 / 2020 (a commercially available quadrivalent influenza vaccine from GSK, containing inactivated split influenza virions of the strains A / Brisbane / 02 / 2018 H1N1, A / Kansas / 14 / 2017 H3N2, B / Colorado / 06 / 2017 (B / Victoria) and B / Phuket / 3073 / 2013

[0756] (B / Yamagata)), 2.66 μg / dose / strain, without adjuvant; a total of 8 animals were used for this group

[0757] (d) QIV 2019 / 2020, 0.27 μg / strain / dose, containing AS03A adjuvant, -1 / 10 human dose (HD); a total of 8 animals were used for this group

[0758] (e) PBS as a control group that had been initiated but not immunized; a total of 4 animals were used for this group

[0759] (f) NaCl as a placebo control group (not pre-immunized); a total of 4 animals were used for this group

[0760] Spleen and serum samples were collected on day 70 (corresponding to 14 days after the second immunization), and analyzed using the assay protocol described in Example 7 as described in Examples 8 to 13.

[0761] Example 7 assay protocol

[0762] IgG serological ELISA

[0763] For the antigen being tested (50 μl / well), mouse IgG antibodies were quantified by ELISA using whole influenza virus or split influenza virus or recombinant HA (stalk protein only) diluted to concentrations of 0.5, 1, or 4 μg / ml in PBS as the coating antigen, and adsorbed overnight at 4 °C in 96-well microtiter plates (Maxisorb Immunoplate Nunc 439454). The plates were then incubated at 37 °C for 1 hour with 100 μl / well of PBS + 10% milk (saturation buffer). Twelve two-fold dilutions of the serum (diluted in PBS + 1% BSA + 0.1% Tween 20, further referred to as dilution buffer) were added to the coated plates (50 μl / well) and incubated at 37 °C for 90 minutes. The plates were then washed four times with PBS + 0.1% Tween 20. Peroxidase-conjugated goat anti-mouse IgG (Jackson 115-035-003) diluted 1 / 250 in dilution buffer was added to each well (50 μl / well) and incubated at 37 °C for 1 hour. After another washing step, the plates were incubated at RT with OPDA substrate (Sigma P4664) for 20 minutes. The reaction was stopped with 2N H2SO4, and the optical density was read at 490 - 620 nm. The titer was expressed as the ELISA 50% endpoint titer corresponding to the sample dilution, corresponding to an optical density of 1.5 (50% of the high plateau). In cases where no binding activity was detected, an arbitrary titer corresponding to half of the first serum dilution (1:100), i.e., 50, was assigned to the corresponding sample.

[0764] Hemagglutination inhibition assay (HI)

[0765] The principle of the HAI assay is based on the ability of specific anti-influenza antibodies to inhibit the agglutination of red blood cells (RBCs) caused by the influenza virus hemagglutinin (HA). First, sera were treated with receptor-destroying enzyme (Sigma cat. no. C-8772) at a concentration of 2% (incubated at 37 °C for 18 h) to remove non-specific inhibitors, heat-inactivated at 56 °C for 30 min, and treated with 5% chicken RBCs (incubated at +4 °C for 1 h). After pretreatment, two-fold dilutions of the decanted sera were incubated with 4 hemagglutination units of whole influenza virus for 30 min at RT. Then, 0.5% chicken RBCs were added, and hemagglutination inhibition was scored. The titer was expressed as the reciprocal of the highest serum dilution that completely inhibited hemagglutination. Since the first dilution of the sera was 1:20, a titer of 10 was used for samples below the limit of detection.

[0766] FACS-based in vitro influenza neutralization assay

[0767] One day before testing, MDCK cells were seeded in 96-well cell culture plates (Nunc catalog number 167008) at a density of 30,000 cells / well. Before testing, the serum was pretreated with receptor-destroying enzyme (Sigma catalog number C-8772) at a concentration of 2% (incubated at 37 °C for 18 h) to remove non-specific inhibitors and heat-inactivated at 56 °C for 30 min. The following infectious medium was used for the neutralization assay: Ultra-MDCK medium (BioWhittaker catalog number BE12-749Q) supplemented with 1% penicillin-streptomycin (Invitrogen catalog number 15140-122) and 2 μg / ml TPCK-treated trypsin (Sigma catalog number T1426). Four-fold serial dilutions of the serum were prepared in duplicate in 96-well plates. The serum dilutions were mixed with an equal volume of influenza virus diluted in the infectious medium to achieve an MOI of 0.2 (corresponding to 6000 TCID50 / well) for the H1N1 strain or an MOI of 0.033 (corresponding to approximately 1000 TCID50 / well) for the H5N1 strain. The plates were incubated at 35 °C for 2 h. Six wells were used as virus-only controls, while two wells were used as cell-only controls. After incubation, the medium was removed from the cell-containing plates, and the serum-virus mixture was transferred to these plates. After a centrifugation step (performed at 2000 rpm for 1 h), the contents of the plates were removed and replaced with 200 μl of fresh medium. The plates were incubated at 35 °C, 5% CO2 for 16 h. After incubation, the presence of the virus was detected using the following fluorescence staining procedure. The cells were washed with PBS and treated with trypsin to allow detachment. The action of trypsin was blocked by adding PBS + 1% FBS. The cells were harvested in a V-bottom plate for staining. After a washing step with PBS + 1% FBS, the cells were fixed with Cytofix / cytoperm reagent (BD catalog number 51-2090KZ) at 4 °C for 20 min. After a washing step with Permwash buffer (BD catalog number 51-2091KZ), the infected cells were stained with FITC-labeled anti-influenza A nucleoprotein monoclonal antibody (Thermofisher catalog number MA1-7322) at 4 °C for 30 min. After a washing step with Permwash buffer, the cells were resuspended in PBS and the plates were analyzed by flow cytometry using a BD Fortessa flow cytometer and FlowJo software. The percentage of neutralization for each well was determined based on the virus-only control (considered 0% neutralization). The 50% neutralization titer for each sample was calculated using linear regression methods. Since the lowest dilution of the serum was 1:50, a titer of 17 was used for samples below the limit of detection.

[0768] Antibody-dependent cell-mediated cytotoxicity (ADCC) reporter gene bioassay (Promega)

[0769] To determine ADCC functionality, a mouse FcgRIII kit from Promega was used, with the following protocol. Serial dilutions of serum were prepared in 96-well plates. Target cells (Expi293 cells internally transfected to express the hemagglutinin stalk antigen from the A / Michigan / 45 / 2015 H1N1 strain) were added to each well (24,000 cells / well). Effector cells (Jurkat cells from the kit, transfected with an enzyme pathway that induces bioluminescence when activated by an antigen-antibody-FcgRIII complex) were also added to each well (60,000 cells / well), and the mixture was incubated at 37 °C for 6 hours. Then, after the Bio-Glow substrate (provided in the kit) had been added, luciferase activity was measured using a luminometer. Results were expressed as the area under the curve (AUC).

[0770] Intracellular cytokine staining (ICS)

[0771] Spleen cells collected 14 days after secondary immunization were used to evaluate influenza-specific T cell responses by ICS. Spleen cells were restimulated in vitro (for 6 hours) with a 15-mer pool covering the influenza H1 stem sequence (based on the A / Michigan / 45 / 2015 H1N1 sequence). Isolation of splenic T lymphocytes: Spleens were collected and placed in Roswell Park Memorial Institute 1640 medium supplemented with glutamine, penicillin / streptomycin, sodium pyruvate, non-essential amino acids, and 2-mercaptoethanol. Cell suspensions were prepared from each spleen using a tissue grinder. The spleen cell suspension was filtered twice (through a 100-μm cell strainer). The filter was rinsed with 35 mL (first wash) or 12 mL (second wash) of PBS EDTA 2 mM. After centrifugation (at 335 g for 10 min at RT), the cells were resuspended in complete medium (Roswell Park Memorial Institute 1640 medium supplemented with glutamine, penicillin / streptomycin, sodium pyruvate, non-essential amino acids, 2-mercaptoethanol, and 5% heat-inactivated fetal bovine serum, further referred to as complete medium). In vitro stimulation: Fresh spleen cells were plated in round-bottom 96-well plates, approximately 1 million cells per well. The cells were then stimulated with 1 μg / ml anti-CD28 (clone 37.51) and anti-CD49d (clone 9C10 (MFR4.B)) for 6 hours (at 37 °C, 5% CO2), with or without a 15-mer overlapping peptide pool covering the influenza H1 stem sequence (based on the A / Michigan / 45 / 2015 H1N1 sequence) at 1 μg / ml. After stimulation at 37 °C for 2 hours, Brefeldin A diluted 1 / 1000 in complete medium was added at 37 °C for an additional 4 hours. The plates were then transferred to 4 °C overnight. Staining of spleen cells: Cells were stained and analyzed using a 6-color ICS assay. The cells were transferred to a V-bottom 96-well plate and centrifuged at 189 g for 5 min at 4 °C. After a wash step with 250 μl PBS 1% fetal bovine serum, the cells were resuspended in 50 μl flow buffer (PBS 1X, 1% fetal bovine serum) containing anti-CD16 / 32 (clone 2.4G2) diluted 1 / 50 at 4 °C for 10 min. Then, 50 μl flow buffer containing anti-CD4-V450 (clone RM4-5) diluted 1 / 200 and anti-CD8-PerCp-Cy5.5 (clone 53-6.7) antibody (diluted 1 / 100) as well as Live / dead-PO (1 / 1000) was added at 4 °C for 30 min. The cells were centrifuged (at 189 g for 5 min at 4 °C) and washed with 200 μl flow buffer. Spleen cells were fixed and permeabilized by adding 200 μl Cytofix / Cytoperm solution at 4 °C for 20 min.Centrifuge the cells (5 min at 500 g at 4 °C) and wash with 200 μl of Perm / Wash buffer. After an additional centrifugation step (5 min at 500 g at 4 °C), the cells are stained for 1 h at 4 °C in 50 μl of Perm / Wash buffer with anti-IL2-FITC (clone JES6-5H4, diluted 1 / 400), anti-IFNγ-APC (clone XMG1.2, diluted 1 / 200) and anti-TNFα-PE (clone MP6-XT22, diluted 1 / 700) antibodies. The panel of cytokines was selected based on the Th1 profile and pro-inflammatory cytokines known to be induced by the AS01 adjuvant system. The cells are washed twice with Perm / Wash buffer and resuspended in 220 μl of PBS. The stained cells are analyzed by flow cytometry using a BD Fortessa flow cytometer and FlowJo software. All antibodies and buffers for ICS are from BD Biosciences.

[0772] Example 8 - At 14 days after dose 2, HA mut 10 and HA mut 23 induced a functional HI antibody response against homologous and post-pandemic heterologous H1N1 strains

[0773] The HI responses of naïve mouse models (Study A) and pre-immunized mouse models (Study B) induced by HA mut 10 and HA mut 23 against homologous (A / Brisbane / 2 / 2018) and post-pandemic heterologous (A / Michigan / 45 / 2015 and anti-A / California / 7 / 2009) H1N1 strains measured at 14 days after the second immunization are shown in Figure 7. Individual titers are shown together with the geometric mean titer (GMT) and 95% confidence interval (95CI).

[0774] Conclusion:

[0775] In addition to inducing a homologous HI response (against A / Brisbane / 2 / 2018), administration of HA mut 10 and HA mut 23 induced cross-reactive anti-HA responses in naïve animals (Study A) and pre-immunized animals (Study B) against post-pandemic heterologous (A / Michigan / 45 / 2015 and anti-A / California / 7 / 2009) H1N1 strains. When evaluated in the pre-immunized model (Study B), the variability of the HI responses induced by HA mut 10 and HA mut 23 was greatly reduced. The HI titers measured for HA mut 10 and HA mut 23 were comparable (naïve and pre-immunized animals) or lower (naïve animals) compared to QIV (±AS03).

[0776] Example 9 - 14 days after dose 2, HA mut 10 and HA mut 23 induce anti-HA stem-binding and functional antibody responses and neutralizing antibody responses against postpandemic heterologous H1N1 strains

[0777] To characterize the induced antibody responses, anti-H1 stem-binding antibodies in naïve animals were measured by ELISA 14 days after the secondary immunization. Results from Study A are shown in Figure 8. Pooled serum titers are shown together with the geometric mean titer (GMT) and 95% confidence interval (95CI).

[0778] ADCC activity against the A / Michigan / 45 / 2015 stem was measured by the Promega ADCC reporter gene bioassay 14 days after the secondary immunization. Results from Study A are shown in Figure 8. Pooled serum AUC (area under the curve) values are shown together with the median.

[0779] Neutralizing antibodies against the A / Singapore / GP1908 / 2015 H1N1 and A / California / 7 / 2009 H1N1 strains were measured in Study A and Study B 14 days after the secondary immunization. Results from this assay are shown in Figure 8. Individual titers are shown together with the geometric mean titer (GMT) and 95% confidence interval (95CI).

[0780] Conclusion:

[0781] Since the HI antibody response is directed only against the head of the HA molecule, an anti-stem ELISA was performed to determine whether HA mut 10 and HA mut 23 could also induce stem-specific antibodies. The stem-only HA used was expressed on nanoparticles to ensure antigen stability while avoiding the use of foldon, the presence of which might lead to detection of non-influenza but foldon-specific Ab responses.

[0782] The levels of stem-specific antibody titers detected in naïve mice immunized with HA mut 10 and HA mut 23 were significantly higher compared to those induced by animals immunized with QIV. In addition, the anti-stem antibodies induced by HA mut 23 showed functional ADCC titers compared to the antibodies induced by QIV.

[0783] In both naïve and pre-immunized animals, HA mut 10 and 23 also induced neutralizing antibodies, the levels of which were comparable or slightly higher compared to animals immunized with adjuvanted QIV or QIV without adjuvant.

[0784] In summary, these data highlight the ability of HA mut 10 and / or 23 to induce stem - specific and head - specific antibody responses against heterologous H1 strains, with functional ability comparable to or stronger than QIV.

[0785] Example 10 - At 14 days after dose 2, HA mut 10 and HA mut 23 induced very low H1 stem - specific CD4 T cells, but no CD8 T cell response

[0786] At 14 days after the secondary immunization, anti - H1 stem - specific CD4 and CD8 T cells were measured in the naïve mouse model (Study A) and pre - immunized mouse model (Study B). The results from Study A and Study B are shown in Figure 9. The frequencies of H1 stem - specific CD4 or CD8 T cells expressing IFNγ and / or IL2 and / or TNFα are shown together with the median.

[0787] Conclusion:

[0788] Low percentages of H1 stem (A / Michigan / 45 / 2015) - specific CD4 T cells expressing IFNγ and / or IL2 and / or TNFα were detected in both the naïve mouse model (Study A) and pre - immunized mouse model (Study B), but no induction of CD8 T cells was detected in any of the models.

[0789] Example 11 - At 14 days after dose 2, HA mut 10 and HA mut 23 induced broad heterologous and heterosubtypic HA - binding antibody responses against pre - pandemic heterologous H1N1 and heterosubtypic (H2N2, H5N1, and H9N2) strains

[0790] At 14 days after the secondary immunization, anti - HA IgG - binding antibodies induced by HA mut 10 and HA mut 23 against pre - pandemic heterologous H1N1 and heterosubtypic (H2N2, H5N1, and H9N2) strains in the naïve (Study A) mouse model, as measured by ELISA, are shown in Figure 10. Pooled serum ( Figure 10A 、 Figure 10C 、 Figure 10D ) and individual ( Figure 10B ) titers are shown together with the geometric mean titer (GMT) and 95% confidence interval (95CI).

[0791] Conclusion:

[0792] High levels of cross - reactive IgG antibody titers against the pre - pandemic H1N1 strain (A / New Caledonia / 20 / 99) and against the heterosubtypic H9N2 strain (A / Hong Kong / 1073 / 99) were detected in the naïve mice immunized with HA mut 10 and HA mut 23 (Figure 10). Cross - binding antibodies against the heterosubtypic H5N1 strain (A / Vietnam / 1194 / 2004 H5N1) and H2N2 strain (A / Singapore / 1 / 57 H2N2) were also detected, although at lower levels. Since whole virus was used as the coating antigen, the antibody responses measured in the animals immunized with QIV were not specific for the HA antigen but also included responses against all other split influenza components. Thus, comparison with mice immunized with QIV was not relevant in this assay.

[0793] Example 12 - Cross - reactive functional antibody responses of HA mut 10 and HA mut 23 against a heterosubtypic (H5N1) strain 14 days after dose 2

[0794] As measured 14 days after the secondary immunization, the HI responses induced by HA mut 10 and HA mut 23 against the pre - pandemic heterologous H1N1 and heterosubtypic (H2N2, H5N1, and H9N2) strains in the naïve mouse model (Study A) and the pre - immunized mouse model (Study B) are shown in Figure 11. The combined serum titer values are shown together with the geometric mean titer (GMT) and 95% confidence interval (95CI).

[0795] Neutralizing antibodies against anti - A / Vietnam / 1194 / 2004 H5N1 were measured 14 days after the secondary immunization in Study A and Study B, and the results from this assay are shown in Figure 12. The values are geometric mean titer (GMT) and 95% confidence interval (95CI).

[0796] Conclusion:

[0797] Contrary to the cross - reactive IgG responses observed, at 14 days after dose 2, HA mut 10 and / 23 did not induce HI responses against the pre - pandemic heterologous H1N1 strain (A / New Caledonia / 20 / 99) and against the heterosubtypic H9N2 strain (A / Hong Kong / 1073 / 99), heterosubtypic H5N1 strain (A / Vietnam / 1194 / 2004 H5N1), and H2N2 strain (A / Singapore / 1 / 57 H2N2).

[0798] However, although the neutralizing antibodies were higher in the pre-immunized model compared to the naïve model, the levels of neutralizing antibodies induced by HA mut 10 and 23 in naïve and pre-immunized animals were comparable or slightly higher compared to animals immunized with adjuvanted QIV or non-adjuvanted QIV, respectively.

[0799] Since the HI reaction is directed only against the head of the HA molecule, these data suggest the induction of a stem-based cross-functional antibody response against heterosubtypic strains from group A1.

[0800] Example 13 - At 14 days after dose 2, HA mut 10 and HA mut 23 induced a limited cross-reactive antibody response against group A2 (H3N2, H10 stem) or B lineage (B / Yam and B / Vic) strains

[0801] At 14 days after the secondary immunization, anti-HA IgG binding antibodies induced by HA mut 10 and HA mut 23 against group A2 (H3N2, H10 stem) or B lineage (B / Yam and B / Vic) strains in the naïve (Study A) mouse model measured by ELISA are shown in Figure 13. Individual titers are shown together with the geometric mean titer (GMT) and 95% confidence interval (95CI).

[0802] Conclusion:

[0803] Although no cross-reactive IgG antibody titers against the H3N2 strain (A / Hong Kong / 2671 / 2019 H3N2) were detected, low levels of cross-reactive anti-stem IgG against H10 (A / Jianxi-Donghu / 346 / 2013 stem) were detected. This highlights the ability of HA mut 10 and / or 23 to induce group A2 cross-reactive antibodies against the HA stem portion at comparable or higher levels compared to the QIV group. No cross-reactive antibodies against the tested B strains were detected. Since inactivated influenza virus was used as the coating antigen (except in the evaluation of the H10 stem), the antibody response measured in animals immunized with QIV is not specific for the HA antigen but also includes responses against all other inactivated influenza components. Therefore, the comparison with mice immunized with QIV is not relevant in this assay.

Claims

1. An immunogenic composition comprising a trimeric form of a recombinant influenza A virus hemagglutinin (HA) antigen and a pharmaceutically acceptable carrier, said antigen comprising the extracellular domain of HA without a transmembrane domain or a cytoplasmic domain, wherein the extracellular domain comprises: (i) a globular head domain; and (ii) a stalk domain having a coiled-coil region, which comprises one or more mutations in the coiled-coil region that individually or together stabilize the HA extracellular domain in a pre-fusion trimeric form; and wherein the recombinant HA optionally comprises a heterologous trimerization domain.

2. The immunogenic composition according to claim 1, wherein the recombinant HA has one or more amino acid substitutions in the coiled-coil region compared to the wild type.

3. The immunogenic composition according to claim 1 or 2, wherein the coiled-coil region of the stalk domain comprising one or more amino acid substitutions is from the following amino acid positions: (a) 317 to 472 of H1, such as 322 to 467; or (b) 342 to 473 of H2, such as 347 to 468; or an equivalent range of the coiled-coil region of other influenza A virus strains or subtypes.

4. The immunogenic composition according to claims 1 to 3, wherein the recombinant HA has one or more amino acid substitutions at one or more positions selected from the following: (a) positions 322, 395, 431, 432, 436, 438, 439, 447, 449, 450, 453, 460, 464 and 467 of HA group A1 subtypes such as H1; or (b) positions 347, 396, 399, 418, 428, 437, 440, 448, 451, 454, 465 and 468 of group A2 subtypes such as H3.

5. The immunogenic composition according to claims 1 to 4, wherein there are one or more amino acid substitutions at one or more positions selected from positions 395, 436 and 447 of the H1 subtype or positions 396, 437 and 448 of the H3 subtype or equivalent positions of other influenza A subtypes.

6. The immunogenic composition according to claims 1 to 5, wherein the recombinant HA contains an R at position 422 of H1, or an R at position 423 of H3.

7. The immunogenic composition according to claims 1 to 6, wherein the recombinant HA has at least one stabilizing amino acid substitution selected from the following: for the H1 subtype, K322R, K395M, G431C, F432C, W436D, Y438D, N439L, E447L, E449Q, R450W, D453L, K460I, E464F and R467M, or for the H3 subtype, I347F, K396L / I / V / M, R399L / M / F / I / L, V418P, W437D, N440I, E448M / I / L / M / V, H451L, D454A, E465M and K468M.

8. The immunogenic composition according to any one of claims 1 to 7, wherein said one or more amino acid substitutions comprise an amino acid substitution at positions 395 / 396 such as K395 / 396L / I / V / M, or consist of the same.

9. The immunogenic composition according to claim 8, wherein said recombinant HA additionally comprises an amino acid substitution at positions 436 / 437 such as W436 / 437D, and / or an amino acid substitution at positions 447 / 448 such as E447 / 448M / I / L / M / V.

10. The immunogenic composition according to any one of claims 1 to 9, wherein said recombinant HA has an amino acid sequence having at least 85% or at least 87% or at least 90% identity to an amino acid sequence selected from SEQ ID NOs: 3 - 8 and 17 - 42, with or without a signal sequence.

11. The immunogenic composition according to any one of claims 1 to 10, wherein said HA comprises a foldon.

12. The immunogenic composition according to any one of claims 1 to 11, wherein said extracellular domain of HA comprises the entire HA1 region and the entire HA2 region, without a transmembrane domain and a cytoplasmic domain.

13. The immunogenic composition according to any one of claims 1 to 12, wherein said stalk domain (1) is covalently linked to a heterotrimerization domain; or (2) is covalently linked to a carrier protein or a nanoparticle; or (3) is not covalently linked to another amino acid molecule.

14. An immunogenic composition comprising an isolated polynucleotide such as DNA or mRNA encoding the recombinant HA antigen of the immunogenic composition according to any one of claims 1 to 13, and a pharmaceutically acceptable carrier.

15. The immunogenic composition according to claim 14, wherein said polynucleotide is in a nucleic acid delivery platform.

16. The immunogenic composition according to claim 14 or 15, wherein said HA antigen comprises a transmembrane region such as the HA transmembrane region, with or without an HA cytoplasmic region.

17. A method for preparing the immunogenic composition according to any one of claims 1 to 13, said method comprising: (i) expressing said recombinant HA antigen in a eukaryotic cell from a polynucleotide sequence encoding an HA antigen fused to a heterotrimerization domain such as foldon; (ii) purifying the recombinant HA trimer from the cell supernatant; (iii) removing said heterotrimerization domain; (iv) combining said recombinant HA trimer with a pharmaceutically acceptable carrier.

18. A method for preparing an immunogenic composition comprising an extracellular domain of HA containing one or more mutations that individually or jointly stabilize the extracellular domain of HA in a pre - trimeric fusion form in a coiled - coil region, said method comprising: (i) expressing said recombinant HA antigen from a polynucleotide sequence encoding the recombinant HA antigen, with or without a heterotrimerization domain; (ii) purifying the trimeric recombinant HA from the cell supernatant; (iii) optionally, if said heterotrimerization domain is present, removing it; (iv) combining said recombinant HA trimer with a pharmaceutically acceptable carrier.

Citation Information

Patent Citations

  • Device for dispersing a fluid

    EP0311863A2

  • Dispenser for media

    EP0516636A1

  • Vaccines

    EP0868918A2

  • Intradermal delivery device including a needle assembly

    EP1092444A1

  • Dispenser for media

    WO1991013281A1