TaqMan real-time fluorescent quantitative PCR probe and primer combination for identifying procambarus clarkia, kit and application of TaqMan real-time fluorescent quantitative PCR probe and primer combination

Abstract

The embodiment of the invention discloses a TaqMan real-time fluorescent quantitative PCR probe primer combination for identifying procambarus clarkii, a kit and application. Comprising a probe, an upstream primer and a downstream primer, the nucleotide sequence of the probe is 5 '-FAM-CTTACCTGTGTTGCA-MGB-3', the nucleotide sequence of the upstream primer is 5 '-GCTATTAATATACGAACAGGGATAACC-3', and the nucleotide sequence of the downstream primer is 5 '-CAAAAAAAGATATTTAGATTACGATCTG-3'. The TaqMan probe real-time fluorescent PCR probe and primer combination provided by the invention can accurately identify the target gene of the procambarus clarkii, improve the accuracy and sensitivity of detection, simplify the detection process, reduce the detection cost, and provide powerful technical support for disease prevention and control and scientific research in the procambarus clarkii breeding industry.

Description

Technical Field

[0001] The embodiments of the present invention relate to the field of biological detection technologies, and particularly to a probe primer combination, a kit and an application for identifying Procambarus clarkii TaqMan real-time fluorescence quantitative PCR. Background Art

[0002] Procambarus clarkii, also known as crayfish, is a crustacean widely distributed globally and of important economic value. Its meat is delicious and deeply loved by consumers, occupying an important position in the aquaculture industry. With the continuous expansion of the Procambarus clarkii breeding scale, the urgent need for accurate detection in aspects such as disease prevention and control, population monitoring, and quality identification is increasing.

[0003] Traditional Procambarus clarkii detection methods, such as morphological identification, mainly rely on professionals to judge based on their appearance characteristics. This method is highly subjective, has low accuracy, and it is difficult to accurately distinguish juveniles or species with similar morphologies. And the detection methods based on biochemical indicators are cumbersome to operate, time-consuming, and have limited sensitivity, unable to meet the requirements of rapid and efficient detection.

[0004] Molecular biology detection technologies have gradually become an important means for Procambarus clarkii detection. Among them, although the ordinary PCR technology can achieve the amplification of specific genes, it has disadvantages such as being easily contaminated and unable to perform quantitative analysis. The real-time fluorescence quantitative PCR technology has broad application prospects in the field of Procambarus clarkii detection due to its advantages of high sensitivity, strong specificity, and quantitative analysis. However, in the current real-time fluorescence quantitative PCR detection technologies for Procambarus clarkii, the specificity and amplification efficiency of the fluorescence primer combinations vary. Some primer combinations have weak specificity and are prone to non-specific amplification, resulting in inaccurate detection results; some primer combinations have low amplification efficiency and cannot meet the range requirements of 90%-110%, affecting the sensitivity and accuracy of the detection. Summary of the Invention

[0005] Therefore, the embodiments of the present invention provide a probe primer combination, a kit and an application for identifying Procambarus clarkii TaqMan real-time fluorescence quantitative PCR.

[0006] To achieve the above object, the embodiments of the present invention provide the following technical solutions:

[0007] According to the first aspect of the embodiments of the present invention, the present invention provides a probe primer combination for identifying Procambarus clarkii by TaqMan real-time fluorescence quantitative PCR, including a probe, an upstream primer, and a downstream primer. The nucleotide sequence of the probe is: 5'-FAM-CTTTACCTGTGTTGGCA-MGB-3', the nucleotide sequence of the upstream primer is 5'-GCTATTAATATACGAACAGTAGGGATAACC-3', and the nucleotide sequence of the downstream primer is 5'-CAAAAAAAGAAGTATTTAGATTACGATCTG-3'.

[0008] According to the second aspect of the embodiments of the present invention, the present invention provides a kit for identifying Procambarus clarkii by TaqMan real-time fluorescence quantitative PCR, including the probe primer combination as described above.

[0009] According to the third aspect of the embodiments of the present invention, the present invention provides the application of the probe primer combination as described above, or the kit as described above in the species identification of Procambarus clarkii.

[0010] According to the fourth aspect of the embodiments of the present invention, the present invention provides a method for identifying Procambarus clarkii species, and the method includes:

[0011] (1) Extract cDNA or genomic DNA of the sample to be tested;

[0012] (2) Perform TaqMan real-time fluorescence quantitative PCR reaction with the probe, upstream primer, and downstream primer as described above to obtain the Ct value and amplification curve;

[0013] (3) Detection result determination: If the Ct value ≤ 35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; when the Ct value > 35, repeat the sample. If there is no Ct value in the repeated result, it is negative, otherwise it is positive.

[0014] Further, the TaqMan real-time fluorescence quantitative PCR reaction system is: 10 μL of premixed reagent, 0.7 μL of upstream primer at 10 μM, 0.7 μL of downstream primer at 10 μM, 0.6 μL of TaqMan probe at 10 μM, 1 μL of DNA template, and supplemented with ddH2O to a total volume of 20 μL.

[0015] Further, the TaqMan real-time fluorescence quantitative PCR reaction conditions are: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, for 40 cycles.

[0016] The embodiments of the present invention have the following advantages:

[0017] The probe and primer combination of TaqMan probe real-time fluorescence PCR provided by the present invention can accurately identify the target gene of Procambarus clarkii, improve the accuracy and sensitivity of detection, simplify the detection process, reduce the detection cost, and provide strong technical support for disease prevention and control and scientific research in the Procambarus clarkii aquaculture industry. Description of the Drawings

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only exemplary, and for those of ordinary skill in the art, without creative efforts, other implementation drawings can also be obtained according to the provided drawings.

[0019] Figure 1 It is the amplification curve graph for specificity verification provided by the present invention;

[0020] Figure 2 It is the amplification curve graph of different copy numbers of the Pycnonotus xanthorrhous gene provided by the present invention;

[0021] Figure 3 It is the standard curve graph for the detection of Procambarus clarkii gene provided by the present invention. Specific Embodiments

[0022] The following specific embodiments illustrate the implementation manners of the present invention. Those familiar with this technology can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0023] Example 1 Design of Primers and Probes

[0024] By searching the NCBI database, downloading the mitochondrial sequences of the target species and related species, and using MEGA6 software for alignment analysis, the specific regions of the target species were selected to design primers and probes with Primer Express 3.0.1 software to ensure the detection specificity of the target species. The design and synthesis of primers and probes were completed by Beijing Tsingke Biotechnology Co., Ltd. The information of primers and probes is shown in Table 1 below.

[0025] Table 1

[0026]

[0027]

[0028] Example 2 Specificity Detection

[0029] Extract the DNA template of Procambarus clarkii as a positive sample, extract the DNA templates of Rhynchophorus ferrugineus, Trachemys scripta elegans, Lithobates catesbeianus, Pomacea canaliculata, Achatina fulica, Macrochelys temminckii, and Chelydra serpentina as negative samples, and use ddH2O to replace the nucleic acid in the system as a no-template control (NFC). Amplify using the upstream primer, downstream primer, and probe in Table 1, and verify the specificity of the primer and probe based on the Ct value. Each sample is measured 3 times repetitively. Extract the DNA template using a commercial kit.

[0030] The real-time fluorescence PCR reaction system is as follows: 10 μL of 2xT5 Fast qPCR Mix (Tsingke, TSE301), 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 1 μL of DNA template, and supplemented with ddH2O to a total volume of 20 μL.

[0031] The real-time fluorescence amplification program is as follows: pre-denaturation at 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles; collect fluorescence signals during annealing and extension (60°C).

[0032] The results are shown in Table 2 below and Figure 1 , the positive sample shows a typical S-shaped amplification curve (see Figure 1 "1" in Figure 1 ), while the other negative samples and the no-template control are all straight lines (see Figure 1 "2 - 9" in Figure 1 ), without fluorescence value increase. It shows that the primers and probes provided by the present invention can specifically detect the DNA of Procambarus clarkii.

[0033] Table 2

[0034]

[0035]

[0036] Example 3 Detection of Probe Amplification Efficiency

[0037] Clone the target product amplified in Example 2 into a vector (Tsingke pClone007 Versatile Simple Vector), and use the obtained plasmid for sequencing verification and then use it as a Procambarus clarkii standard plasmid for amplification efficiency detection. The nucleotide sequence of the Procambarus clarkii standard plasmid is as follows:

[0038] AGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT

[0039] TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC

[0040] GCAAAAAACGGAATAAGTGCGACACGGAAATGTTGAATACTCATTTTAG

[0041] CTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGT

[0042] GATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAAGT

[0043] CAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGTTCCGGCTCGTATGTT

[0044] GTGTCTATGGAAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA

[0045] AGTTTGACATCCTTCAGGTGGACTCAAGACTGCAATCGCGTGTCGCCCTT

[0046] GCTATTAATATACGAACAGTAGGGATAACCATGGATCGAATGCCGTTATTT

[0047] GTTTGATCAGTGTTTATTACTACTGTTTTATTATTATTATCTTTACCTGTGTT

[0048] GGCAGGAGCTATTACTATATTATTAACAGATCGTAATCTAAATACTTCTTTT

[0049] TTTGAAGGGCGACACGCGATTGCAGTGTAACACGAGTGATCCTGAGTTC

[0050] AGATCAACTGGCCGTCGTTTTACACAATCAAGTCGTGACTGGGAAAACC

[0051] CTGGCGCTCCAACTTAATCGCCTTGCAGCACTGGCTCACCTTCACGGGTG

[0052] GGCCTTTCTTCGGTAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCT

[0053] GCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTG

[0054] GTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGC

[0055] TTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTT

[0056] AGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGC

[0057] TAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACC

[0058] GGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCT

[0059] GAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACA

[0060] CCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCC

[0061] CGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAAC

[0062] AGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT

[0063] AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATG

[0064] CTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCAGAAAG

[0065] GCCCACCCGAAGGTGAGCCAGGTGATTACATTTGGGCCCTCATTACCAAT

[0066] GCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCA

[0067] TAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTA

[0068] CCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGG

[0069] CTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAG

[0070] AAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCG

[0071] GGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTG

[0072] CCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCA

[0073] TTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTT

[0074] GTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGT

[0075] AAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTC

[0076] TCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC

[0077] AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCC

[0078] CGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTG

[0079] CTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACC

[0080] GCTGTTGAGATCC (see SEQ ID NO:4).

[0081] The standard plasmid of Procambarus clarkii was serially diluted as a positive standard, and detected according to the real-time fluorescence PCR reaction system and amplification program in Example 2. Each dilution was repeated 3 times to obtain the probe gradient amplification curve ( Figure 2 in which, 1: dilution factor 10^3, 2: dilution factor 10^4, 3: dilution factor 10^5, 4: dilution factor 10^6, 4: dilution factor 10^7). The CT and copy number LOG values were fitted to obtain the standard curve equation ( Figure 3 ), and the detection R 2 reached 0.9999. The results showed that within the range of 3.62E+7 - 3.62E+3 copies / μL of the Procambarus clarkii gene, the CT and copy number LOG values showed a good linear relationship. According to the established standard curve, the amplification efficiency was calculated to be 95.4%. The detection data are shown in Table 3.

[0082] Table 3

[0083]

[0084] After diluting the plasmid by 10^7 times, the detection repeatability was good, and the probe detection efficiency was within the normal range (90% - 110%). The sensitivity of the primers and probes provided by the present invention reached the detection requirements.

[0085] Although the present invention has been described in detail above with general descriptions and specific examples, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

[0086]

[0087]

[0088]

Claims

1. A probe and primer combination for identifying Procambarus clarkii using TaqMan real-time fluorescence quantitative PCR, characterized in that: It includes a probe, an upstream primer and a downstream primer. The nucleotide sequence of the probe is: 5'-FAM-CTTTACCTGTGTTGGCA-MGB-3'. The nucleotide sequence of the upstream primer is 5'-GCTATTAATATACGAACAGTAGGGATAACC-3'. The nucleotide sequence of the downstream primer is 5'-CAAAAAAAGAAGTATTTAGATTACGATCTG-3'.

2. A kit for identifying TaqMan real-time fluorescence quantitative PCR of Procambarus clarkii, characterized in that, It includes the probe primer combination as described in claim 1.

3. Application of the probe primer combination described in claim 1, or the kit described in claim 2 in the identification of Procambarus clarkii species.

4. A method for identifying Procambarus clarkii species, characterized in that, The method includes: (1) Extracting cDNA or genomic DNA of the sample to be tested; (2) Performing TaqMan real-time fluorescence quantitative PCR reaction with the probe, upstream primer and downstream primer as in claim 1 to obtain the Ct value and amplification curve; (3) Determination of the test result: If the Ct value ≤ 35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; when the Ct value > 35, re-test the sample. If there is no Ct value in the re-test result, it is negative, otherwise it is positive.

5. The method for identifying Procambarus clarkii species according to claim 4, characterized in that The TaqMan real-time fluorescence quantitative PCR reaction system is: 10 μL of premixed reagent, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM TaqMan probe, 1 μL of DNA template, and supplemented with ddH2O to a total volume of 20 μL.

6. The method for identifying Procambarus clarkii species according to claim 4, characterized in that The TaqMan real-time fluorescence quantitative PCR reaction conditions are: pre-denaturation at 95°C for 2 min; 15 s at 95°C, 30 s at 60°C, for 40 cycles.

Images