Application of ARN2966 in treatment of UMOD gene mutant autosomal dominant hereditary renal tubular interstitial nephropathy

Abstract

The invention discloses an application of ARN2966 in the treatment of UMOD (Urban Molecular Orthodontic Disease) gene mutant autosomal dominant hereditary renal tubular interstitial nephropathy (ADTKD), and belongs to the field of biomedicine. The ARN2966 has the advantages that the ARN2966 can be used for the treatment of UMOD gene mutant autosomal dominant hereditary ADTKD, and the ARN2966 can be used for the treatment of UMOD gene mutant autosomal dominant hereditary ADTKD; the application comprises the application of the amyloid precursor protein (APP)-CD74 signal axis blocking agent in the preparation of the medicine for treating the hereditary tubulointerstitial nephropathy, and the application comprises the application of the amyloid precursor protein (APP)-CD74 signal axis blocking agent in the preparation of the medicine for treating the hereditary tubulointerstitial nephropathy. Compared with the prior art, the key effect of an APP-CD74 signal axis in ADTKD-Umod pathogenesis is disclosed for the first time, and ARN2966 provides a brand new intervention strategy for treatment of ADTKD-Umod through targeted regulation and control of the pathway. Compared with a broad-spectrum anti-inflammatory drug, the ARN2966 has high targeting specificity, and side effects caused by non-specific immunosuppression can be avoided. Although the ARN2966 does not enter a clinical research stage at present, due to the unique action mechanism and verified safety characteristics of the ARN2966, the ARN2966 has remarkable transformation medical value and clinical application prospect in the aspect of developing ADTKD-Umod targeted therapeutic drugs.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to the application of ARN2966 in the treatment of autosomal dominant tubulointerstitial kidney disease caused by UMOD gene mutation. Background Art

[0002] Autosomal Dominant Tubulointerstitial Kidney Disease (ADTKD) is a hereditary kidney disease caused by single gene mutations. Among them, the UMOD gene mutation type (ADTKD-UMOD) is the most common subtype. The gradually increasing infiltration of renal interstitial inflammatory cells is an important phenotype, but the specific mechanism is still unclear. At present, there is a lack of effective treatment for ADTKD-UMOD. Existing treatment options can only deal with the symptoms, lacking specific treatment means targeting the pathogenic mechanism of UMOD mutation.

[0003] Pro-inflammatory signals can be detected in ADTKD-Umod mice at 1 month of age, earlier than fibrosis formation and kidney damage. Previous studies have reported that the TNF-α blocker soluble recombinant fusion protein TNFR:Fc can effectively slow down the disease progression. However, this treatment has the following significant defects: (1) The treatment target is single, unable to comprehensively inhibit the abnormal activation of multiple key inflammatory factors (including IL-6, MCP-1, IL-1β, IL-18, and IL-1βp17, etc.) in ADTKD-Umod; (2) Long-term use has a risk of serious side effects, including an increased risk of opportunistic infections, inhibition of anti-tumor immune function, etc.; (3) The non-specific neutralization effect may affect the development of lymphoid organs because it simultaneously targets LT-α, which shares a receptor with TNF-α. Summary of the Invention

[0004] In view of the deficiencies of the prior art, the present invention proposes the application of ARN2966 in the treatment of autosomal dominant tubulointerstitial kidney disease caused by UMOD gene mutation.

[0005] The object of the present invention can be achieved by the following technical solutions:

[0006] The first aspect of the present invention relates to the application of an APP-CD74 signal axis blocker in the preparation of a drug for the treatment of hereditary tubulointerstitial kidney disease.

[0007] Optionally, the hereditary tubulointerstitial kidney disease is autosomal dominant tubulointerstitial kidney disease caused by Umod gene mutation.

[0008] Optionally, the Umod gene mutation is UMOD c.106C>T.

[0009] Optionally, the APP-CD74 signaling axis blocker includes one or more of an APP antibody, a CD74 antibody, and a reagent that inhibits the expression of the APP gene and CD74.

[0010] Optionally, the reagent that inhibits the expression of the APP gene includes: an APP post-transcriptional regulator (the small molecule drug ARN2966) and siRNA that knockdowns the APP gene, and the reagent that inhibits the expression of the CD74 gene includes siRNA that knockdowns the CD74 gene. The structural formula of ARN2966 is:

[0011]

[0012] Optionally, the treatment of autosomal dominant tubulointerstitial kidney disease (ADTKD)-Uromod includes reducing renal interstitial inflammation, renal function injury, and fibrosis.

[0013] Optionally, the treatment of ADTKD-Uromod includes alleviating macrophage pyroptosis.

[0014] Optionally, the drug dosage is 50 mg per kilogram of body weight.

[0015] Optionally, the nucleotide sequence of the siRNA that knockdowns the APP gene is: sense strand, 5′-GAGUUGAAGCCAUGCUCAA(SEQ ID NO.1)TT-3′; the nucleotide sequence of the siRNA that knockdowns the CD74 gene is: sense strand: 5′-CGUCCAAUGUCCAUGGAUA(SEQ ID NO.2)TT-3′. Among them, the TT in the sequence is the deoxythymidine overhang at the 3′ end of the siRNA.

[0016] In a second aspect of the present invention, there is provided a drug for treating autosomal dominant tubulointerstitial kidney disease (ADTKD)-Uromod, including an APP-CD74 signaling axis blocker, and the blocker includes a reagent that inhibits the expression of the APP gene and a reagent that inhibits the expression of CD74.

[0017] Advantages of the present invention:

[0018] The present invention for the first time reveals the key role of the APP-CD74 signaling axis in the pathogenesis of ADTKD-Umod. ARN2966 provides a new intervention strategy for the treatment of ADTKD-Umod by targeting and regulating this pathway. Compared with broad-spectrum anti-inflammatory drugs, ARN2966 has high target specificity and can avoid side effects caused by non-specific immunosuppression. Although ARN2966 has not yet entered the clinical research stage, its unique mechanism of action and verified safety characteristics make it have significant translational medicine value and clinical application prospects in the development of targeted therapeutic drugs for ADTKD-UMOD. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The present invention will be further described below in conjunction with the accompanying drawings.

[0020] Figure 1 Constructing Umod based on CRISPR / Cas9 technology in Example 1 of this application H36Y / + mice;

[0021] Figure 2 Umod in Example 1 of this application H36Y / + mouse model characterization;

[0022] Figure 3 Single-cell sequencing in Example 2 of this application indicates that macrophages exhibit a classical pyroptosis phenotype;

[0023] Figure 4 In vivo characterization of macrophage pyroptosis in Example 4 of this application;

[0024] Figure 5 mDCT in Example 4 of this application H36Y drives pyroptosis in J774a.1 cells;

[0025] Figure 6 Abnormal activation of the APP-CD74 signaling axis between tubules and macrophages in Example 4 of this application;

[0026] Figure 7 ARN2966 in Example 5 of this application can significantly reduce the App protein level in mDCT cells;

[0027] Figure 8 Blocking the APP-CD74 signaling axis in Example 5 of this application can reduce the level of pyroptosis;

[0028] Figure 9 ARN2966 in Example 5 of this application significantly improves the renal function and kidney damage of mutant mice. Detailed implementation manners

[0029] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0030] In some embodiments of the present invention, the key role and exploration process of the APP (amyloid precursor protein)-CD74 signaling axis in the pathogenesis of ADTKD-Umod are disclosed, including the following steps:

[0031] Example 1. Construction and verification of disease model

[0032] 1.1 As shown in Figure 1 , the CRISPR / Cas9 gene editing technology was used to introduce the H36Y point mutation (CAC→TAC) into exon 3 of the Umod gene (transcript UMOD-201, ENSMUST0000033263.5) in C57BL / 6 background mice. After verification by PCR and sequencing, it was mated with wild-type C57BL / 6J mice to establish a stably inherited UmodH36Y / + heterozygous model (F1 generation). Genotyping was performed using TaqMan SNP detection (primers: forward 5′-ctggggaggattcgctaaactctag-3′ (SEQ ID NO.3); reverse 5′-agcactcatccacatcagtgcag-3′ (SEQ ID NO.4)).

[0033] 1.2 Immunofluorescence of kidney tissue

[0034] Kidney tissue was fixed with 4% paraformaldehyde, embedded in paraffin, and 4-μm sections were prepared for H&E, PAS, and Masson trichrome staining. Immunofluorescence detection steps: After dewaxing the sections, antigen retrieval was performed with EDTA / citric acid, serum blocking was carried out, and the primary antibody (overnight at 4°C) and fluorescent secondary antibody (1 h at room temperature in the dark) were added in sequence. After nuclear staining with DAPI, the sections were sealed with glycerol and stored in the dark at 4°C.

[0035] 1.3 Western blot

[0036] After protein samples were lysed with RIPA, they were quantified by BCA method. Equal amounts of protein were electrophoresed by SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 5% skim milk for 1 hour, incubated with the primary antibody (overnight at 4°C) and HRP secondary antibody (1 hour at room temperature) in sequence, and the target protein was analyzed by ECL development after washing with TBST.

[0037] 1.4 Biochemical measurement

[0038] Blood samples (200 μL) were centrifuged at 3,000 revolutions per minute for 15 min at room temperature to separate serum, which was stored at -80°C. Serum creatinine levels were measured using an automatic biochemical analyzer (BS360S, Mindray Biomedical Electronics Co., Ltd., Shenzhen, China).

[0039] 1.5 tGFR measurement

[0040] The percutaneous GFR monitor (Medibeacon GmbH) was used to dynamically detect the clearance rate of FITC-myoglobin to evaluate renal function: the back hair was shaved 24 hours before the experiment; the monitoring device was fixed under isoflurane anesthesia, and FITC-myoglobin (7 mg / 100 g body weight) was injected into the tail vein, and the fluorescence clearance rate was continuously monitored for 60 minutes; the clearance rate data was collected and processed by a dedicated software (Sensor_ctrl_app.exe), and the GFR value was calculated.

[0041] The H36Y point mutation mice reproduced the patient's disease characteristics: impaired renal function ( Figure 2 A in Figure 2 ), the mutant Umod protein aggregated in the endoplasmic reticulum ( Figure 2 B in Figure 2 ), renal cyst formation (

[0042] [[ID=1,14]]C in

[0043] ), increased immature Umod protein in renal tissue and decreased Umod excretion in urine (

[0044] D in + / + ). H36Y / + Kidney samples from 3 mice were used to prepare single-cell suspensions, and GEMs were constructed using the 10x Genomics Chromium system. The cells were resuspended in PBS and sorted (16,000 cells / channel), and after lysis, RNA barcoded reverse transcription was performed. The amplified cDNA was quality inspected by Agilent 4200, and after library construction, sequencing was performed on the Illumina platform. Seurat 3.0 was used to analyze the data: after filtering low-quality cells, principal component dimensionality reduction and t-SNE / UMAP visualization were performed. Cell clusters were annotated based on differentially expressed genes, and the gene sets related to programmed cell death were from the Gene Ontology, KEGG, and FerrDb databases and the literature. To study the interactions between different clusters, the CellChat R package (v1.6.0) was used in this example, which is a widely used tool for analyzing cell-cell communication networks in snRNA-seq data. Figure 3 sc-RNA seq was performed on the kidneys of 24-week-old Umod H36Y / + mice and Umod Figure 3 mice, and cell clustering was performed based on marker genes ( H36Y / + A in Figure 3 ), the number (113 vs. 454) and proportion (1.13% vs. 2.81%) of renal macrophages in the UmodFigure 3 in D) of

[0045] Example 3. In vivo wet experiment verification

[0046] 3.1 Immunohistochemical staining

[0047] The renal tissue was fixed with 4% paraformaldehyde, paraffin-embedded and sectioned (4 μm). After dewaxing, hydration and citric acid antigen retrieval, endogenous peroxidase and non-specific sites were blocked (10% goat serum). Incubate with the primary antibody at 4°C overnight. After washing with PBS, add the HRP secondary antibody, develop color with DAB and counterstain with hematoxylin.

[0048] Umod H36Y / + Immunofluorescence staining of mouse renal tissue showed high expression of GSDMD and NLRP3 in F4 / 80+ macrophages ( Figure 4 in A) of Figure 4 In addition, the expression of pyroptosis-related factors (such as IL-18, GSDMD-N, NLRP3, Casp-1p20, etc.) in the mutant group was higher than that in the wild type ( Figure 4 in B) of

[0049] 3.2 CCK8 assay

[0050] The cytotoxic effect of ARN2966 on mDCT cells was detected by the CCK-8 method: 5×103 cells / well were seeded in 96-well plates. After culturing for 24 hours, wash with PBS and add CCK-8 reagent and incubate for 2 h. Measure the absorbance at 450 nm, and calculate the cell viability with the untreated group as the control.

[0051] 3.3 Flow cytometry and sorting

[0052] After collecting the cells, wash them twice with PBS, resuspend them in FACS buffer and stain with PI to evaluate the survival rate. Adjust the cell density to 10 5 / mL, incubate with Fc blocking antibody at room temperature for 20 minutes, and wash twice with PBS. Under light-proof conditions at 4°C, incubate with the fluorescent primary antibody and FITC secondary antibody for 30 minutes each, and wash twice with PBS after each incubation. Finally, resuspend the cells and analyze them using a Cytek Guava flow cytometer. The data was analyzed using FlowJo 10.8. For cell sorting, prepare a single-cell suspension and stain it according to the established protocol, and then sort it using a BD FACS Aria Fusion cell sorter (BD Biosciences). The sorted cells were collected in a sterile FBS-coated tube containing complete DMEM medium to maintain cell viability.

[0053] 3.4 Cellular immunofluorescence

[0054] Cells were seeded in confocal dishes, fixed with 4% paraformaldehyde for 15 minutes (room temperature), and blocked with 10% goat serum for 30 minutes. The primary antibody was incubated overnight at 4°C, and the cells were washed 3 times with PBS; the fluorescent secondary antibody was incubated for 1 hour in the dark (room temperature), and after washing 3 times with PBS, the cells were mounted with DAPI-glycerol.

[0055] 3.5 RNAi and Electroporation

[0056] The Neon transfection system (Thermo Fisher) was used to transfect mDCT cells (App siRNA) and J774a.1 cells (CD74 siRNA), respectively. Among them, App siRNA (forward strand: 5′-GAGUUGAAGCCAUGCUCAATT-3′), CD74 siRNA (forward strand: 5′-CGUCCAAUGUCCAUGGAUATT-3′). After digestion, the cells were resuspended in R buffer (5×106 cells / 100 μL containing 3 μg siRNA). The optimized electroporation parameters were set as follows: mDCT cells (3×10 ms, 1450 V), J774a.1 cells (1×20 ms, 1400 V). After transfection, the cells were cultured in complete medium for 48 hours and then collected for analysis. For co-culture experiments, the culture conditions of J774a.1 were preferably adapted.

[0057] 3.6 mDCT H36Y Construction of Stable Point Mutation Strains

[0058] The CRISPR-Cas9 technology was used to construct a Umod gene mutation model. The specific process included:

[0059] 1) Design a gRNA targeting exon 3 of Umod (sequence: CCGTGCAGGTGGCGTTGTTGTGG (SEQ ID NO.5));

[0060] 2) The Cas9 ribonucleoprotein complex and the single-stranded DNA template were introduced into mouse distal convoluted tubule (mDCT) cells by electroporation;

[0061] 3) After 72 hours, single-cell clones were screened;

[0062] 4) The mutation efficiency was verified by PCR and sequencing. Finally, single-site mutant clones (mDCT H36Y ) and their wild-type controls (mDCT WT ) were obtained, and all clones were cultured under the same conditions. Example 4. In vitro experiments to explore the induction of macrophage pyroptosis by mDCT H36Y Point Mutation and Its Mechanism

[0063] In vitro, the constructed mDCT H36Y point mutant stable cell line was directly co-cultured with macrophage J774a.1 for 48 h, and then macrophages were isolated by flow sorting for characterization ( Figure 5 A in). The results showed that compared with the wild type, J774a.1 cells co-cultured with mDCT H36Y showed increased levels of pro-inflammatory factors such as IL-6, TNF-α, MCP-1, and Pro IL-1β, and activation of the classical pyroptosis activation pathway NF-κB ( Figure 5 B in). In addition, macrophages co-cultured with mDCT H36Y showed a pyroptotic phenotype and increased expression of pyroptosis-related factors ( Figure 5 C in). In summary, the in vitro results showed that mDCT H36Y tubular cells could induce macrophage inflammatory activation and pyroptosis.

[0064] To explore the mechanism by which Umod mutant renal tubular cells cause macrophage pyroptosis, in this example, Cellchat analysis was performed using single-cell sequencing data. The results showed that the ligand-receptor pair communication signal between APP from mutant tubules and CD74 on macrophages was the most significant ( Figure 6 A in). Overall, the expression of APP and CD74 was upregulated in the renal tissues of Umod H36Y / + mice ( Figure 6 B in); single-cell transcriptomics confirmed that mutant LP / DCT cells highly expressed APP, while macrophages highly expressed CD74 ( Figure 6 C in). Tissue immunofluorescence further confirmed that the expression of CD74 on F4 / 80+ macrophages was increased ( Figure 6 D in), and the expression of APP on Umod+ tubular cells was increased ( Figure 6 E in). Multiplex immunofluorescence showed the phenomenon of CD74+ macrophages specifically surrounding APP+ tubular cells in the renal tissues of Umod H36Y / + mice ( Figure 6 F in).

[0065] Example 5. ARN2966 drug intervention study

[0066] 5.1 Cell intervention

[0067] In this example, ARN2966 (T7490, TargetMol, USA) was used to reduce macrophage pyroptosis. The ARN2966, C 12 H 12 N2O, and its structural formula is:

[0068]

[0069] To study the effect of inhibiting APP protein by ARN2966, mDCT cells were seeded into 6-well plates and allowed to adhere for 12 hours under standard culture conditions. Subsequently, the cells were treated with ARN2966 solution at different concentrations (0 μM, 10 μM, 20 μM, 40 μM, and 60 μM), which was dissolved in sterile dimethyl sulfoxide (DMSO), for 24 hours. After this intervention period, cell samples were collected to quantitatively evaluate the expression level of APP protein after treatment. The control group received an equal volume of sterile DMSO without ARN2966.

[0070] In vitro, ARN2966 dose-dependently reduced the level of APP protein on the surface of mDCT H36Y cells (A in Figure 7 ), and CCK8 indicated low cytotoxicity in the range of 0 - 40 μM ( Figure 7 B in Figure 7 ). Considering the intervention effect of ARN2966 and the drug safety evaluation, 20 μM was set as the cell intervention concentration. Flow cytometry showed that after intervention with 20 μM ARN2966, the surface app protein level of mDCT cells was significantly reduced (

[0071] To explore the effect of the APP-CD74 signaling axis on macrophage pyroptosis, the following interventions were adopted:

[0072] (1) Antibody blockade: In the co-culture system of mDCT H36Y and J774a.1, APP antibody (22C11, ThermoFisher Scientific, 14-9749-82) and CD74 antibody (LN2, Santa Cruz Biotechnology Inc., sc-6262) were added to block the APP-CD74 interaction;

[0073] (2) Drug inhibition: ARN2966 was used to reduce the APP expression level in mDCT cells;

[0074] (3) Gene silencing: The APP gene in mDCT cells and the CD74 gene in J774a.1 cells were knocked down separately or simultaneously. After culturing for 48 hours, J774a.1 cells were sorted by flow cytometry and pyroptosis-related indicators were detected.

[0075] The results showed that all intervention groups (antibody blockade, drug inhibition, gene silencing) significantly alleviated macrophage pyroptosis, as manifested by the downregulation of the expression of pyroptosis markers such as NLRP3, Mature IL-1β, Casp1 p20, and IL-18 ( Figure 8 A - B in Figure 8In B), it was further confirmed that the APP-CD74 interaction is a key regulatory mechanism for macrophage pyroptosis.

[0076] 5.2 In Vivo Intervention

[0077] To evaluate the effect of modulating the APP-CD74 signaling axis on interstitial inflammation and kidney outcomes, in this example, ARN2966 (T7490, TargetMol, USA) was used. This compound was formulated as a stock solution at 25 mg / mL in 60% PEG300, 30% absolute ethanol, and 10% Tween 80, and then diluted at a ratio of 1:4 in sterile PBS and intraperitoneally injected daily (50 mg / kg, n = 6) for 8 weeks, as shown in Figure 9 A. The corresponding solvent control group received an equal volume of normal saline (n = 6). All experimental groups showed similar baseline characteristics before intervention, including age, body weight, tGFR, and serum creatinine levels (p > 0.05). During the entire treatment period, the animals maintained normal body weight and physiological status (hair condition and motor activity). After 8 weeks of intervention in the mice, renal function was evaluated (tGFR), blood was collected, and kidney tissue samples were taken to systematically evaluate the therapeutic effects of DSF on renal function, the degree of renal interstitial inflammation activation, the degree of renal interstitial fibrosis, and cell pyroptosis.

[0078] The experimental results showed that after ARN2966 intervention, the renal function and pathological characteristics of Umod H36Y / + mice were significantly improved: (1) Renal function improvement: The tGFR increased and the serum creatinine level decreased in the ARN2966 intervention group ( Figure 9 C-D in); (2) Downregulation of renal tissue inflammation and pyroptosis indicators: As the expression of APP in renal tubules decreased, the expression of macrophage IL-18 decreased ( Figure 9 E in), and the levels of pyroptosis-related factors in renal tissue decreased ( Figure 9 F in); (3) Pathological improvement: Kidney sections showed that the infiltration of interstitial inflammatory cells and the degree of fibrosis in the ARN2966 group were significantly reduced. Western blot analysis further confirmed that the level of α-SMA related to renal fibrosis decreased significantly after ARN2966 treatment ( Figure 9 G in).

[0079] In summary, based on the CRISPR / Cas9 technology, the example of the present invention successfully constructed Umod H36YA point mutation mouse model that completely mimics the typical disease phenotypes of patients with ADTKD-Umod. Through single-cell transcriptome sequencing (scRNA-seq) and in vivo and in vitro functional verification, the molecular mechanism by which mutant renal tubular cells induce macrophage pyroptosis and drive renal interstitial injury by activating the APP-CD74 signaling axis was elucidated for the first time. Further intervention with the post-transcriptional regulator ARN2966 targeting APP showed that this small molecule drug could significantly inhibit the pyroptosis-related signaling pathway in the kidney tissues of mutant mice, reduce inflammatory cell infiltration, while improving renal function parameters and delaying disease progression. The present invention not only reveals a new pathogenic mechanism of ADTKD-Umod, but also provides a clinical transformation strategy targeting the APP-CD74 signaling axis, laying an experimental foundation for the treatment of this rare disease by drug repositioning.

[0080] In the description of this specification, the descriptions referring to terms such as "one embodiment", "example", "specific example", etc. mean that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in a suitable manner in any one or more embodiments or examples.

[0081] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments, and what is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed.

Claims

1. Use of an APP-CD74 signaling axis blocker in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy.

2. Use of the APP-CD74 signaling axis blocker according to claim 1 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The hereditary tubulointerstitial nephropathy is autosomal dominant hereditary tubulointerstitial nephropathy caused by Umod gene mutation.

3. Use of the APP-CD74 signal axis blocker according to claim 1 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The Umod gene mutation is Umod c.106C>T.

4. Use of the APP-CD74 signaling axis blocker according to claim 1 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The APP-CD74 signaling axis blocker includes one or more of an APP antibody, a CD74 antibody, and a reagent that inhibits the expression of the APP and CD74 genes.

5. Use of the APP-CD74 signaling axis blocker according to claim 4 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The reagent that inhibits the expression of the APP gene includes the small molecule drug ARN2966 and siRNA that knockdowns the APP gene. The reagent that inhibits the expression of the CD74 gene includes siRNA that knockdowns the CD74 gene. The structural formula of the ARN2966 is: 。 6. Use of the APP-CD74 signal axis blocker according to claim 1 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The treatment of hereditary tubulointerstitial nephropathy includes reducing renal interstitial inflammation, renal function damage, and fibrosis.

7. Use of the APP-CD74 signaling axis blocker according to claim 1 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The treatment of hereditary tubulointerstitial nephropathy includes alleviating macrophage pyroptosis.

8. Use of the APP-CD74 signal axis blocker according to claim 1 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The dosage of the medicament is 50 mg per kilogram of body weight.

9. Use of the APP-CD74 signal axis blocker according to claim 5 in the preparation of a medicament for treating hereditary tubulointerstitial nephropathy, characterized in that, The nucleotide sequence of the siRNA that knockdowns the APP gene is: sense strand, 5′-GAGUUGAAGCCAUGCUCAATT-3′; the nucleotide sequence of the siRNA that knockdowns the CD74 gene is: sense strand: 5′-CGUCCAAUGUCCAUGGAUATT-3′.

10. A drug for treating hereditary tubulointerstitial nephropathy, characterized in that, It includes an APP-CD74 signaling axis blocker, and the blocker includes a reagent that inhibits the expression of the APP gene and a reagent that inhibits the expression of CD74.

Images