Bifunctional fusion protein targeting CCR5 and gp41 and application of bifunctional fusion protein in preparation of medicine for resisting human immunodeficiency virus

Abstract

The invention relates to a bifunctional fusion protein targeting CCR5 and gp41 and application of the bifunctional fusion protein in preparation of drugs for resisting human immunodeficiency viruses, and belongs to the technical field of biological medicines. The invention provides a bifunctional fusion protein simultaneously targeting CCR5 and gp41. The bifunctional fusion protein comprises: a fusion protein obtained by connecting a polypeptide 2P23 to an N end and / or a C end of a light chain and / or a heavy chain of an antibody PRO 140 or a PRO 140 mutant through a connecting peptide; or the fusion protein is obtained by connecting a label to the N end and / or the C end of the fusion protein. The novel bifunctional fusion protein constructed by the invention not only overcomes the limitation that a PRO 140 prototype antibody is ineffective to a CXCR4 trophile strain, but also significantly improves the inhibitory activity and broad spectrum to a CCR5 trophile strain, and also has a higher drug resistance barrier.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to a bifunctional fusion protein targeting CCR5 and gp41 and its application in the preparation of drugs for anti-human immunodeficiency virus. Background Art

[0002] Acquired Immune Deficiency Syndrome (AIDS), which is continuously caused by the infection of Human Immunodeficiency Virus (HIV), is an infectious disease that seriously endangers human health and social stability. Data from the Joint United Nations Programme on HIV / AIDS (UNAIDS) shows that more than 88 million people have been infected with HIV globally, and approximately half of the infected people have died from AIDS-related diseases. Despite the active response of the international community, so far, there is neither an effective vaccine nor a drug that can completely cure the infection. Currently, clinical treatment mainly relies on highly active antiretroviral therapy (HAART) that combines multiple drugs. However, this therapy cannot eliminate the viral reservoir. Once the drug is stopped, the virus in the patient's body quickly rebounds. Moreover, the drug resistance, adverse reactions, and high treatment costs caused by long-term drug use also impose a heavy burden on patients and countries. Therefore, curing or functionally curing AIDS still faces huge challenges and problems.

[0003] HIV infection of target cells is a multi-step and multi-link complex process, which mainly includes the sequential binding of gp120 to the target cell receptor CD4 and the co-receptor CCR5 or CXCR4, and then the fusion of the viral membrane and the cell membrane is initiated by gp41 to complete the process of the virus entering the host cell. Among them, entry is the first step of virus infection and also a key link for people to attempt to inhibit virus replication. HIV entry inhibitors can block the virus from entering host cells at an early stage, which is equivalent to "keeping the enemy out of the country". From the perspective of blocking reinfection of progeny viruses, HIV entry inhibitors can reduce or interfere with the establishment and maintenance of the viral reservoir. However, the mechanisms of action of existing antiretroviral drugs mainly target enzymes with different functions during virus replication, including nucleoside (NRTIs) and non-nucleoside (NNRTIs) reverse transcriptase inhibitors, integrase strand transfer inhibitors (INSTs), and protease inhibitors (PIs). Currently, only 5 HIV entry inhibitors are on the market globally, including the CD4 adhesion inhibitor ibalizumab, the chemokine CCR5 receptor inhibitor maraviroc, the inhibitor fostemsavir targeting the viral envelope glycoprotein gp120, and the fusion inhibitors enfuvirtide and albuvirtide targeting the fusion protein gp41. So far, multiple cured AIDS patients have been reported worldwide, all of whom achieved a cure effect by transplanting stem cells carrying one or two CCR5 / Δ32 mutant genes. Although this revolutionary technology can cure or functionally cure some HIV patients, it cannot be widely promoted and applied clinically due to the extremely lack of donors and safety issues. The success of this technology indicates that CCR5 is a key therapeutic target. Despite the great efforts made by researchers in the past few decades, maraviroc remains the only clinically approved anti-HIV drug targeting CCR5. Currently, many efforts are dedicated to developing anti-CCR5 monoclonal antibodies, such as PRO 140 (Leronlimab), HGS004, and RoAb13. Among them, PRO 140 is a humanized monoclonal antibody that can bind to CCR5 without affecting its downstream signaling pathway. PRO 140 was granted "fast track" for clinical development by the US Food and Drug Administration (FDA) in 2006, and its antiretroviral activity has been evaluated in multiple clinical studies, but it has not been successfully developed so far. Like other approved HIV entry inhibitors, PRO 140 also has problems such as drug resistance and / or viral strain tropism selectivity. It can only inhibit CCR5-tropic HIV-1 virus strains and is ineffective against CXCR4-tropic HIV-1 virus strains.

[0004] AIDS is mainly caused by HIV, which is divided into two types: HIV-1 and HIV-2. HIV-1 is more common, highly infectious, and widely distributed. 95% of infections are caused by HIV-1. HIV-2 is mainly distributed in African regions, showing a local epidemic trend. HIV-1 has a high degree of variability and has generated many subtypes and recombinant viruses during evolution. Among them, subtypes A, B, and C of HIV-1 are the main viruses causing the global AIDS epidemic, while in China, the main ones are A / E and B / C recombinant viruses. In recent years, significant progress has been made in the systematic research on the three-dimensional structure analysis and molecular interaction mechanism of HIV-1 envelope glycoproteins and host cell surface molecules. At the same time, the membrane fusion functional domain targeting modification strategy guided by structural bioinformatics has been continuously innovated. These breakthroughs have established a theoretical basis and technical reserve for the development of highly effective candidate drugs targeting the virus invasion stage. The inventor team is committed to developing potent HIV fusion inhibitors and has successively designed inhibitors such as CP32M, MT-SC23, HP23, MT-C34, MT-T2635, and 2P23 based on the M-T hook structure, as well as inhibitors such as LP-11, LP-19, LP-40, LP-46, LP-51, LP-52, LP-80, LP-83, LP-97, and LP-98 based on lipopeptides. Among them, 2P23 is a short polypeptide containing only 23 amino acid residues, which has extremely strong target sequence binding ability and a higher genetic drug resistance barrier, and can effectively inhibit HIV-1, HIV-2, SIV, and T20 drug-resistant virus strains. Its lipopeptide derivative LP-19 has strong antiviral activity both in vitro and in vivo. Due to the high mutation characteristics of HIV, in order to improve the broad-spectrum effectiveness of anti-HIV drugs, bispecific or multispecific inhibitors targeting different targets in the HIV entry step have been widely developed. Based on this strategy, the inventor team previously linked the polypeptide 2P23 with the ibalizumab single-chain antibody to construct a bifunctional inhibitor 2P23-iMab that targets both the viral gp41 and the cellular CD4 receptor; linked the polypeptide 2P23 with the PRO 140 single-chain antibody to construct bifunctional inhibitors 2P23-PRO140 and 2P23-PRO140-Fc that target both the viral gp41 and the cellular CCR5 co-receptor. These bispecific inhibitors based on single-chain antibodies showed better biological activities than single-target inhibitors, but had serious deficiencies in in vivo stability and very low drug-likeness. The present invention aims to create a dual-target HIV inhibitor with both strong activity and high stability. Summary of the Invention

[0005] In view of the defects existing in the above-mentioned prior art, in order to solve the problems of drug resistance, virus strain tropism selectivity, and low in vivo stability of existing HIV entry inhibitors, the object of the present invention is to design and provide a bifunctional fusion protein that can simultaneously target CCR5 and gp41. The novel bifunctional fusion protein provided by the present invention is designed according to the mechanism of HIV invading target cells and has potent and broad-spectrum antiviral activity.

[0006] To achieve the above object, the present invention adopts the following technical solutions: On the one hand, the present invention provides a bifunctional fusion protein that simultaneously targets CCR5 and gp41, and the bifunctional fusion protein comprises: (1) A fusion protein obtained by connecting polypeptide 2P23 to the N-terminus and / or C-terminus of the light chain and / or heavy chain of antibody PRO 140 or a PRO 140 mutant through a linker peptide; Or (2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the fusion protein in (1) above.

[0007] For the bifunctional fusion protein that simultaneously targets CCR5 and gp41, the amino acid sequence of the polypeptide 2P23 is as shown in SEQ ID NO.1; The HIV monoclonal antibody PRO 140 consists of four polypeptide chains connected by disulfide bonds (two light chains and two heavy chains), and the amino acid sequence of the light chain of the antibody PRO 140 is as shown in SEQ ID NO.3; The amino acid sequence of the heavy chain of the antibody PRO 140 is as shown in SEQ ID NO.5.

[0008] For the bifunctional fusion protein that simultaneously targets CCR5 and gp41, the amino acid sequence of the linker peptide is (GGGGS) n , where n represents the number of repetitions of GGGGS, and n takes values of 1, 2, 3, 4, 5 or 6.

[0009] For the bifunctional fusion protein that simultaneously targets CCR5 and gp41, the PRO 140 mutant consists of four polypeptide chains connected by disulfide bonds (two light chains and two heavy chains containing M428L and N434S mutations), and the PRO 140 mutant is obtained by generating M428L and N434S mutations in the Fc segment of the PRO 140 heavy chain; The amino acid sequence of the light chain of the PRO 140 mutant is as shown in SEQ ID NO.3; The amino acid sequence of the heavy chain of the PRO 140 mutant is as shown in SEQ ID NO.7.

[0010] The described bifunctional fusion protein that simultaneously targets CCR5 and gp41, the tag is a His tag, and its amino acid sequence is as shown in SEQ ID NO.11. Optionally, the tag can be located at the C-terminus or N-terminus of the light chain of the fusion protein in (1). The function of this tag is to facilitate the purification and detection of the fusion protein.

[0011] The described bifunctional fusion protein that simultaneously targets CCR5 and gp41, the signal peptide is an IgG3 signal peptide, and its amino acid sequence is as shown in SEQ ID NO.9; optionally, the signal peptide sequence is located at the N-terminus of the light chain and heavy chain of the fusion protein in (1) / (2); Preferably, the above bifunctional fusion protein is 2P23 linked to the N-terminus of the light chain of antibody PRO 140 or a PRO 140 mutant through a linker peptide; Example: The above bifunctional fusion protein is 2P23-PRO140L, specifically 2P23 is linked to the N-terminus of the light chain of antibody PRO 140 through (GGGGS)3; Example: The above bifunctional fusion protein is m2P23-PRO140L, specifically 2P23 is linked to the N-terminus of the light chain of the PRO 140 mutant through (GGGGS)3; Example: The above bifunctional fusion protein is 2P23-1-PRO140L, specifically 2P23 is linked to the N-terminus of the light chain of antibody PRO 140 through (GGGGS)1; Example: The above bifunctional fusion protein is 2P23-6-PRO140L, specifically 2P23 is linked to the N-terminus of the light chain of antibody PRO 140 through (GGGGS)6; Preferably, the above bifunctional fusion protein is 2P23 linked to the N-terminus of the heavy chain of antibody PRO 140 or a PRO 140 mutant through a linker peptide; Example: The above bifunctional fusion protein is 2P23-PRO140H, specifically 2P23 is linked to the N-terminus of the heavy chain of antibody PRO 140 through (GGGGS)3.

[0012] Preferably, the above bifunctional fusion protein is 2P23 linked to the N-terminus of the light chain and the N-terminus of the heavy chain of antibody PRO 140 or a PRO140 mutant respectively through a linker peptide; Example: The above bifunctional fusion protein is 2P23-PRO140HL, specifically 2P23 is linked to the N-terminus of the light chain and the N-terminus of the heavy chain of antibody PRO 140 through (GGGGS)3 respectively.

[0013] Preferably, the above bifunctional fusion protein is 2P23 linked to the C-terminus of the light chain of antibody PRO 140 or a PRO 140 mutant through a linker peptide; Example: The above-mentioned bifunctional fusion protein is PRO140L-2P23. Specifically, 2P23 is linked to the C-terminus of the light chain of antibody PRO140 via (GGGGS)2; Preferably, the above-mentioned bifunctional fusion protein is that 2P23 is linked to the C-terminus of the heavy chain of antibody PRO140 or a PRO140 mutant via a linker peptide; Example: The above-mentioned bifunctional fusion protein is PRO140H-2P23. Specifically, 2P23 is linked to the C-terminus of the heavy chain of antibody PRO140 via (GGGGS)2; Preferably, the above-mentioned bifunctional fusion protein is that 2P23 is respectively linked to the C-terminus of the light chain and the C-terminus of the heavy chain of antibody PRO140 or a PRO140 mutant via a linker peptide; Example: The above-mentioned bifunctional fusion protein is PRO140HL-2P23. Specifically, 2P23 is respectively linked to the C-terminus of the light chain and the C-terminus of the heavy chain of antibody PRO140 via (GGGGS)2; Example: The above-mentioned bifunctional fusion protein is mPRO140HL-2P23. Specifically, 2P23 is respectively linked to the C-terminus of the light chain and the C-terminus of the heavy chain of a PRO140 mutant via (GGGGS)2; Preferably, the above-mentioned bifunctional fusion protein is that 2P23 is respectively linked to the N-terminus of the light chain and the C-terminus of the heavy chain of antibody PRO140 or a PRO140 mutant via a linker peptide; Example: The above-mentioned bifunctional fusion protein is 2P23-PRO140-2P23. Specifically, 2P23 is linked to the N-terminus of the light chain of antibody PRO140 via (GGGGS)3 and is linked to the C-terminus of the heavy chain of antibody PRO140 via (GGGGS)2.

[0014] In a second aspect, the present invention provides a nucleic acid molecule encoding the bifunctional fusion protein according to any one of the above. The nucleic acid molecule can be a DNA molecule or an RNA molecule, which encodes the recombinant bifunctional fusion protein as described in the first aspect of the present invention and comprises the following elements: 2P23 nucleic acid sequence, PRO140 light chain and heavy chain or PRO140 mutant light chain and heavy chain nucleic acid sequences, linker peptide nucleic acid sequence.

[0015] Preferably, the 2P23 nucleic acid sequence is the DNA sequence shown in SEQ ID NO.2, the PRO 140 light chain nucleic acid sequence is the DNA sequence shown in SEQ ID NO.4, the PRO 140 heavy chain nucleic acid sequence is the DNA sequence shown in SEQ ID NO.6, the light chain nucleic acid sequence of the PRO 140 mutant is the DNA sequence shown in SEQ ID NO.4, the heavy chain nucleic acid sequence of the PRO 140 mutant is the DNA sequence shown in SEQ ID NO.8, and the nucleic acid sequence of the linker peptide is (GGCGGAGGCGGAAGC) n , where n takes a value of 1, 2, 3, 4, 5, or 6.

[0016] In a third aspect, the present invention provides a recombinant expression vector, which contains the nucleic acid molecule described above.

[0017] Preferably, the vector can be a recombinant vector obtained by inserting the nucleic acid molecule encoding the fusion protein into a mammalian cell expression vector.

[0018] In a fourth aspect, the present invention provides an engineered animal cell line, which contains the recombinant expression vector described above or the nucleic acid molecule is integrated into the genome.

[0019] In a fifth aspect, the present invention provides a pharmaceutical composition, which contains the bifunctional fusion protein or its derivative described in any one of the above, and a pharmaceutically acceptable carrier or excipient; Preferably, the pharmaceutical composition is an inhibitor of human immunodeficiency virus entry.

[0020] In a sixth aspect, the present invention provides the use of the bifunctional fusion protein, the nucleic acid molecule, the recombinant expression vector or the engineered animal cell line described in any one of the above in the preparation of a functional product; The functional product is used for any one or a combination of the following: a) Antiviral; b) Preventing and / or treating diseases caused by viral infections; c) Inhibiting viral cell fusion; d) Inhibiting viral entry into cells; e) Inhibiting viral replication; Preferably, the virus includes but is not limited to HIV-1, HIV-2, or SIV; Preferably, the diseases caused by viral infections include but are not limited to AIDS.

[0021] More details of the present invention are described below, or some can also be embodied in the embodiments of the present invention. Unless otherwise indicated, the quantities of different components and reaction conditions used herein can be interpreted as "substantially" or "approximately" in any case. Correspondingly, unless specifically specified, the numerical parameters cited in the following and in the claims are approximate parameters, and different numerical parameters may be obtained due to different standard errors under their respective experimental conditions.

[0022] In practical applications, the drugs of the present invention can be directly administered to patients, or administered to patients after being mixed with suitable carriers or excipients, so as to achieve the purpose of treating and / or preventing HIV infection. The carrier materials here include but are not limited to water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly water-soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), enteric-soluble carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). Among them, the preferred one is the water-soluble carrier material. Using these materials, various dosage forms can be prepared, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories, freeze-dried powder injections, etc. It can be a conventional preparation, a sustained-release preparation, a controlled-release preparation and various microparticle drug delivery systems.

[0023] In order to prepare the unit dosage form into tablets, various carriers well-known in the art can be widely used. Examples of carriers are, for example, diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; wetting agents and binders, such as water, glycerol, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, polyvinylpyrrolidone, etc.; disintegrants, such as dry starch, alginate, agar powder, laminarin, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid ester, sodium dodecyl sulfate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors, such as sucrose, glyceryl tristearate, cocoa butter, hydrogenated oil, etc.; absorption promoters, such as quaternary ammonium salts, sodium dodecyl sulfate, etc.; lubricants, such as talc, silica, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, etc. The tablets can also be further made into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer tablets and multi-layer tablets.

[0024] To prepare the unit dosage form into pills, various carriers well-known in the art can be widely used. Examples of carriers are, for example, diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, Gelucire, kaolin, talc, etc.; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste or batter, etc.; disintegrants such as agar powder, dried starch, alginate, sodium lauryl sulfate, methylcellulose, ethylcellulose, etc. To prepare the unit dosage form into suppositories, various carriers well-known in the art can be widely used. Examples of carriers are, for example, polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides, etc. To prepare the unit dosage form into injectable preparations such as solutions, emulsions, freeze-dried powder injections and suspensions, all diluents commonly used in the art can be used, for example, water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxygenated isostearyl alcohol, polyoxyethylene sorbitan fatty acid esters, etc. In addition, to prepare isotonic injection solutions, an appropriate amount of sodium chloride, glucose or glycerol can be added to the injectable preparations. In addition, conventional solubilizers, buffers, pH regulators, etc. can also be added. In addition, if necessary, colorants, preservatives, fragrances, flavoring agents, sweeteners or other materials can also be added to the pharmaceutical preparations. The above dosage forms can be administered by injection, including subcutaneous injection, intravenous injection, intramuscular injection and intraperitoneal injection, intracisternal injection or infusion, etc.; administration via body cavities, such as rectally, vaginally and sublingually; administration via the respiratory tract, such as nasally; mucosal administration. The preferred administration route among the above is injection, and the preferred injection route is subcutaneous injection.

[0025] The dosage of the drug of the present invention depends on many factors, such as the nature and severity of the disease to be prevented or treated, the sex, age, weight and individual response of the patient or animal, the specific active ingredient used, the administration route and the number of administrations, etc. The above dosage can be administered in a single dosage form or divided into several, for example, two, three or four dosage forms.

[0026] The drug of the present invention can be directly and solely used for the treatment and prevention of HIV-infected individuals, or can be used in combination with one or more other antiviral drugs, which can be used simultaneously or at intervals to achieve the purpose of improving the overall treatment effect. These anti-HIV drugs include, but are not limited to, reverse transcriptase inhibitors, protease inhibitors, entry inhibitors, integrase inhibitors, viral capsid inhibitors, and maturation inhibitors, etc. The above-mentioned reverse transcriptase inhibitors can be nucleoside reverse transcriptase inhibitors, such as zidovudine (AZT), lamivudine (3TC), didanosine (ddI), zalcitabine (ddC), stavudine (d4T), tenofovir (TDF), abacavir (ABC), emtricitabine (FTC), or can be non-nucleoside reverse transcriptase inhibitors, such as nevirapine (NVP), efavirenz (EFV), delavirdine (DLV), etravirine (ETR), etc., one or several of them; the above-mentioned protease inhibitors can be saquinavir (SQV-HGC), indinavir (IDV), ritonavir (RTV), amprenavir (APV), Kaletra (LPV / RTV), nelfinavir (NFV), fosamprenavir calcium (FPV), Reyataz (ATV), and Prezista, etc., one or several of them; the above-mentioned integrase inhibitors can be Raltegravir, Dolutegravir, and Elvitegravi, etc., one or several of them; the above-mentioned entry inhibitors can be Maraviroc, T-20, Fostemsavir, TAK-779, T2635, VIRIP (VIR-576), sivlerapide, aboceptivide, soluble CD4 protein and its analogues, antibodies against co-receptor CCR5 (such as PRO 140), monoclonal antibodies against gp120 / gp41 (such as VRC01 and 10E8), and monoclonal antibodies against receptor CD4 (such as UB-421, TNX-355), etc., one or several of them; the above-mentioned viral capsid inhibitors can be lenacapavir and VH4004280 (VH-280), etc., one or several of them.

[0027] For any specific patient, the specific effective dosage level of treatment shall be determined according to a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific active ingredient employed; the specific composition employed; the age, weight, general health, sex and diet of the patient; the time of administration, route of administration and excretion rate of the specific active ingredient employed; the duration of treatment; drugs used in combination with or concurrently with the specific active ingredient employed; and similar factors well known in the medical field. For example, it is the practice in the art to start with a dosage of the active ingredient below the level required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is obtained. Generally speaking, the dosage of the drug of the present invention for mammals, especially humans, can be between 0.001 - 1000 mg / kg body weight / day, for example between 0.01 - 100 mg / kg body weight / day, and for another example between 0.1 - 10 mg / kg body weight / day. The dosing frequency can be once a day, once every two days, once every three days, once every four days, once every five days, once every six days, once every seven days or once every fourteen days, and preferably can be once a week or once every two weeks.

[0028] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention creatively links the short peptide 2P23 to the N-terminus and / or C-terminus of the light chain and / or heavy chain of the HIV monoclonal antibody PRO 140 or PRO 140 mutant to obtain a novel bifunctional fusion protein, which can simultaneously target the CCR5 co-receptor in the HIV entry process and the viral fusion protein gp41. Compared with the monomeric molecules PRO 140 and 2P23, the novel bifunctional fusion protein constructed by the present invention not only overcomes the limitation that the PRO 140 prototype antibody is ineffective against CXCR4-tropic strains, but also significantly improves the inhibitory activity and broad-spectrum property against CCR5-tropic strains, and at the same time has a higher drug resistance barrier.

[0029] 2. More importantly, compared with the 2P23-PRO140-Fc (a fusion protein obtained by linking the short peptide 2P23, the single-chain antibody of PRO140 and the IgG4-Fc mutant peptide segment) developed by the inventor's team in the early stage, the in vivo antiviral activity and in vivo stability of the novel bifunctional fusion protein of the present invention are significantly improved, showing broad development prospects. Brief Description of the Drawings

[0030] Figure 1Schematic diagram of the design of bifunctional fusion proteins with different configurations. Among them, A are fusion proteins 2P23-PRO140L obtained by connecting 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)3, fusion proteins 2P23-PRO140H obtained by connecting 2P23 to the N-terminus of the heavy chain of antibody PRO140 via (GGGGS)3, and fusion proteins 2P23-PRO140HL obtained by connecting 2P23 to the N-terminus of the light chain and the N-terminus of the heavy chain of antibody PRO 140 via (GGGGS)3 respectively; B are fusion proteins 2P23-0-PRO140L obtained by connecting 2P23 to the N-terminus of the light chain of antibody PRO140 via (GGGGS)0, fusion proteins 2P23-1-PRO140L obtained by connecting 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)1, and fusion proteins 2P23-6-PRO140L obtained by connecting 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)6; C are fusion proteins PRO140L-2P23 obtained by connecting 2P23 to the C-terminus of the light chain of antibody PRO 140 via (GGGGS)2, fusion proteins PRO140H-2P23 obtained by connecting 2P23 to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2, and fusion proteins PRO140HL-2P23 obtained by connecting 2P23 to the C-terminus of the light chain and the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2 respectively; D is a fusion protein 2P23-PRO140-2P23 obtained by connecting 2P23 to the N-terminus of the light chain of antibody PRO 140 via (GGGGS)3 and connecting 2P23 to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2; Figure 2 SDS-PAGE and Western blot analysis diagrams of bifunctional fusion proteins with different configurations. Among them, A is the SDS-PAGE analysis diagram of PRO140 (control) and fusion proteins 2P23-PRO140L, 2P23-PRO140H, 2P23-PRO140HL; B is the SDS-PAGE analysis diagram of PRO 140 (control) and fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140L, 2P23-6-PRO140L, and the Western blot analysis diagrams of fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140L; C is the SDS-PAGE analysis diagram of PRO 140 (control) and fusion proteins PRO140L-2P23, PRO140H-2P23, PRO140HL-2P23; D is the SDS-PAGE analysis diagram of PRO 140 (control) and fusion protein 2P23-PRO140-2P23; Figure 3Inhibitory activities of bifunctional fusion proteins with different configurations and controls against HIV-1 NL4-3 and JRFL strains. Among them, A shows the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL against NL4-3 and JRFL; B shows the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), 2P23-PRO140L, 2P23-1-PRO140L, and 2P23-6-PRO140L against NL4-3 and JRFL; C shows the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23 against NL4-3 and JRFL; D shows the inhibitory activities of PRO 140 (control), 2P23-PRO140-Fc (control), 2P23-PRO140L, PRO140HL-2P23, and 2P23-PRO140-2P23 against NL4-3 and JRFL; Figure 4 In vitro stability of novel bifunctional fusion proteins and controls; Figure 5 Antiviral activities and stability of novel bifunctional fusion proteins and controls in rat serum. Among them, A shows the inhibitory activities of rat sera of PRO 140 (control), 2P23-PRO140-Fc (control), 2P23-PRO140L, and PRO140HL-2P23 against NL4-3; B shows the inhibitory activities of rat sera of PRO 140 (control), 2P23-PRO140L, and PRO140HL-2P23 against SF162; Figure 6 SDS-PAGE analysis diagrams of long-acting bifunctional fusion proteins and their inhibitory activities against NL4-3 and JRFL. Among them, A shows the SDS-PAGE analysis diagrams of m2P23-PRO140L and mPRO140HL-2P23 fusion proteins; B shows the inhibitory activities of 2P23-PRO140L, PRO140HL-2P23, and long-acting proteins m2P23-PRO140L and mPRO140HL-2P23 against NL4-3 and JRFL; Figure 7 Antiviral activities and stability of long-acting bifunctional fusion proteins in rat serum. Among them, A shows the inhibitory activities of rat sera of 2P23-PRO140L (control) and m2P23-PRO140L against NL4-3; B shows the inhibitory activities of rat sera of PRO140HL-2P23 (control) and mPRO140HL-2P23 against NL4-3. Detailed implementation manners

[0031] The present invention will be further described in detail below in conjunction with the specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way. Those skilled in the art can draw on the content of this article and appropriately modify relevant parameters to implement. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as being included within the scope of the present invention. The method of the present invention has been described through preferred embodiments, and those related can obviously make changes or appropriate modifications and combinations to the compounds and preparation methods described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0032] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the art or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0033] Example 1: Design and preparation of a novel bifunctional fusion protein In this example, 2P23 and the PRO 140 prototype antibody were combined to design a number of novel bifunctional fusion proteins with different configurations, and the antiviral activity of the proteins was verified after expression and purification.

[0034] 1. Experimental materials and methods (1) Design of the novel bifunctional fusion protein: First, 2P23 was connected to the N-terminus of the light chain and / or heavy chain of the antibody PRO 140 through the linker peptide (GGGGS)3, and three N-terminal fusion bifunctional fusion proteins, 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL, were designed ( Figure 1 A); To explore the effect of the linker peptide length on the activity of the fusion protein, this example also designed to connect 2P23 to the N-terminus of the light chain of the antibody PRO 140 through the linker peptides (GGGGS)0, (GGGGS)1, and (GGGGS)6, respectively, to obtain the fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL ( Figure 1 B); In this example, 2P23 was continuously linked to the C-terminus of the light chain and / or heavy chain of antibody PRO 140 via the linker peptide (GGGGS)2, and three C-terminal fusion bifunctional fusion proteins, PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23, were designed ( Figure 1 C); In this example, 2P23 was also linked to the N-terminus of the light chain of antibody PRO 140 via the linker peptide (GGGGS)3 and to the C-terminus of the heavy chain of antibody PRO 140 via (GGGGS)2, and the bifunctional fusion protein 2P23-PRO140-2P23 was designed ( Figure 1 D).

[0035] (2) Construction of bifunctional fusion protein expression vectors: First, the IgG3 signal peptide gene sequence (the sequence is shown as SEQ ID NO.10, AAACATCTGTGGTTCTTCCTCCTCCTAGTGGCAGCTCCCAGATGGGTCCTGTCCAAGCTT), the 2P23 gene sequence (the sequence is shown as SEQ ID NO.2, GAGATGACCTGGGAGGAGTGGGAGAAGAAGGTGGAGGAGCTGGAGAAGAAGATCGAGGAGCTGCTGAAG), the linker peptide gene sequence ((GGCGGAGGCGGAAGC) n , n = 3), the PRO 140 antibody light chain gene sequence (the sequence is shown as SEQ ID NO.4), and the His tag gene sequence (the sequence is shown as SEQ ID NO. 12, CACCATCACCATCACCAT) were linked together in the order from upstream to downstream and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and denoted as the pcDNA3.4-2P23-PRO140L expression vector.

[0036] The IgG3 signal peptide gene sequence (the sequence is shown as SEQ ID NO.10), the 2P23 gene sequence (the sequence is shown as SEQ ID NO.2), the linker peptide gene sequence ((GGCGGAGGCGGAAGC) n , n = 3), and the PRO 140 antibody heavy chain gene sequence (the sequence is shown as SEQ ID NO.6) were linked together in the order from upstream to downstream and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector and denoted as the pcDNA3.4-2P23-PRO140H expression vector.

[0037] The IgG3 signal peptide gene sequence (the sequence is as shown in SEQ ID NO.10), 2P23 gene sequence (the sequence is as shown in SEQ ID NO.2), PRO 140 antibody light chain gene sequence (the sequence is as shown in SEQ ID NO.4), and His tag gene sequence (the sequence is as shown in SEQ ID NO.12) were linked together in the order from upstream to downstream, and then artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-2P23-0-PRO140L expression vector.

[0038] The IgG3 signal peptide gene sequence (the sequence is as shown in SEQ ID NO.10), 2P23 gene sequence (the sequence is as shown in SEQ ID NO.2), and linker peptide gene sequence ((GGCGGAGGCGGAAGC) n , n = 1), PRO 140 antibody light chain gene sequence (the sequence is as shown in SEQ ID NO.4), and His tag gene sequence (the sequence is as shown in SEQ ID NO.12) were linked together in the order from upstream to downstream, and then artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-2P23-1-PRO140L expression vector.

[0039] The IgG3 signal peptide gene sequence (the sequence is as shown in SEQ ID NO.10), 2P23 gene sequence (the sequence is as shown in SEQ ID NO.2), and linker peptide gene sequence ((GGCGGAGGCGGAAGC) n , n = 6), PRO 140 antibody light chain gene sequence (the sequence is as shown in SEQ ID NO.4), and His tag gene sequence (the sequence is as shown in SEQ ID NO.12) were linked together in the order from upstream to downstream, and then artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-2P23-6-PRO140L expression vector.

[0040] The IgG3 signal peptide gene sequence (the sequence is as shown in SEQ ID NO.10), PRO 140 antibody light chain gene sequence (the sequence is as shown in SEQ ID NO.4), and linker peptide gene sequence ((GGCGGAGGCGGAAGC) n, n = 2), the 2P23 gene sequence (the sequence is shown in SEQ ID NO.2), and the His-tag gene sequence (the sequence is shown in SEQ ID NO.12) were ligated together and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-PRO140L-2P23 expression vector.

[0041] In the order from upstream to downstream, the IgG3 signal peptide gene sequence (the sequence is shown in SEQ ID NO.10), the PRO 140 antibody heavy chain gene sequence (the sequence is shown in SEQ ID NO.6), and the linker peptide gene sequence ((GGCGGAGGCGGAAGC) n , n = 2), and the 2P23 gene sequence (the sequence is shown in SEQ ID NO.2) were ligated together and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-PRO140H-2P23 expression vector.

[0042] Meanwhile, in the order from upstream to downstream, the IgG3 signal peptide gene sequence (the sequence is shown in SEQ ID NO.10), the PRO 140 antibody light chain gene sequence (the sequence is shown in SEQ ID NO.4), and the His-tag gene sequence (the sequence is shown in SEQ ID NO.12) were ligated together and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-PRO140L expression vector.

[0043] In the order from upstream to downstream, the IgG3 signal peptide gene sequence (the sequence is shown in SEQ ID NO.10) and the PRO 140 antibody heavy chain gene sequence (the sequence is shown in SEQ ID NO.6) were ligated together and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-PRO140H expression vector.

[0044] During the vector construction process, the addition of the IgG3 signal peptide at the N-terminus of each sequence serves to promote the secretion of the synthesized protein outside the cell; the addition of the His-tag sequence at the C-terminus is used for protein purification and detection. Among them, the amino acid sequence of the light chain of the PRO 140 antibody is shown in SEQ ID NO. 3; the amino acid sequence of the heavy chain of the PRO 140 antibody is shown in SEQ ID NO. 5; the amino acid sequence of the IgG3 signal peptide is shown in SEQ ID NO. 9; the amino acid sequence of the His-tag is shown in SEQ ID NO. 11.

[0045] (3)Expression and purification of the bifunctional fusion protein: Based on the dual-plasmid co-transfection system, the recombinant protein expression plasmid obtained in step 2 was transfected into HEK293T cells at a mass ratio of light chain to heavy chain plasmid of 1:1 with the aid of the PEI transfection reagent. After 48 hours, the cell culture supernatant was collected, and the protein was purified by Protein A affinity chromatography. The purity of the fusion protein was detected by SDS-PAGE; the specificity of the fusion protein was detected by Western blot using an anti-His monoclonal antibody. The specific transfection combinations were: ① pcDNA3.4-PRO140L + pcDNA3.4-PRO140H, ② pcDNA3.4-2P23-PRO140L + pcDNA3.4-PRO140H; ③ pcDNA3.4-PRO140L + pcDNA3.4-2P23-PRO140H; ④ pcDNA3.4-2P23-PRO140L + pcDNA3.4-2P23-PRO140H; ⑤ pcDNA3.4-2P23-0-PRO140L + pcDNA3.4-PRO140H; ⑥ pcDNA3.4-2P23-1-PRO140L + pcDNA3.4-PRO140H; ⑦ pcDNA3.4-2P23-6-PRO140L + pcDNA3.4-PRO140H; ⑧ pcDNA3.4-PRO140L-2P23 + pcDNA3.4-PRO140H; ⑨ pcDNA3.4-PRO140L + pcDNA3.4-PRO140H-2P23; ⑩ pcDNA3.4-PRO140L-2P23 + pcDNA3.4-PRO140H-2P23; ⑪ pcDNA3.4-2P23-PRO140L+pcDNA3.4-PRO140H-2P23; ① above expresses the PRO 140 antibody (control); ②, ③, and ④ respectively express the N-terminal fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL; ⑤, ⑥, and ⑦ respectively express the N-terminal fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL with different linker peptide lengths; ⑧, ⑨, and ⑩ respectively express the C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23; ⑪ expresses the N-terminal and C-terminal dual fusion protein 2P23-PRO140-2P23.

[0046] The results are as Figure 2 shown in A. By SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining, the three N-terminal fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL and the control PRO 140 all effectively expressed the target fusion proteins, and the light / heavy chains both showed a single electrophoresis band, indicating that three bifunctional fusion proteins with clear molecular conformations were successfully obtained.

[0047] The SDS-PAGE electrophoresis results of the light chain N-terminal fusion proteins with different linker peptide lengths are as Figure 2 shown in B. When the linker peptide structure was lacking (2P23-0-PRO140L), the light chain band in its electrophoresis pattern was significantly missing, and the color intensity of the heavy chain protein band was also significantly weaker than that of other groups. Western blot quantitative detection showed that the light chain expression level in this group was significantly lower than that of other experimental groups, indicating that 2P23-0-PRO140L was not successfully expressed, probably because the lack of the linker peptide led to abnormal antibody assembly or unstable spatial conformation, thereby affecting the integrity of the protein structure. 2P23-1-PRO140L and 2P23-6-PRO140L could be normally expressed, and proteins with high purity could be obtained.

[0048] As Figure 2 shown in C. By SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining, the three C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23 all obtained target proteins with high purity, confirming that the three fusion proteins were all successfully expressed.

[0049] As Figure 2 shown in D. By SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining, the 2P23-PRO140-2P23 fusion protein obtained the target protein with high purity, confirming that 2P23-PRO140-2P23 was successfully expressed.

[0050] Example 2: Detection of the antiviral activity of the novel bifunctional fusion protein In this example, the N-terminal fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL prepared in Example 1; the N-terminal fusion proteins 2P23-0-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL with different linker peptide lengths; and the C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23 were used to detect the antiviral activity by using the HIV-1 pseudovirus inhibition assay. PRO 140 prepared in Example 1 and 2P23-PRO140-Fc (the amino acid sequence is shown in SEQ ID NO.13 and the nucleic acid sequence is shown in SEQ ID NO.14) developed and retained in the laboratory previously were used as controls. The virus used was HIV-1 NL4-3 or JRFL pseudovirus, prepared by this laboratory; the target cell TZM-bl was a product of the National Experimental Cell Resource Sharing Service Platform.

[0051] 1. Experimental materials and methods (1) Preparation of HIV-1 pseudovirus: A plasmid expressing the envelope protein (Env) of the HIV-1 NL4-3 or JRFL strain was co-transfected with the HIV-1 backbone plasmid pSG3∆env into HEK293T cells; the transfected cells were cultured in a 37 °C, 5% CO2 cell culture incubator for 48 hours, and then the supernatant was collected, filtered, and the filtrate was collected, which was the pseudovirus solution containing NL4-3 or JRFL. After titration, it was stored at -80 °C for later use.

[0052] (2) Dilute the drug to the starting concentration with DMEM medium, and then perform 3-fold serial dilution of the inhibitor in a 96-well cell culture plate to obtain the drug dilution solution. Nine dilution degrees were set for each test drug.

[0053] (3) In a 96-well cell culture plate, add the drug dilution solution (50 µL / well) to the drug wells and DMEM medium (50 µL / well) to the control wells, and set 3 replicates for each. Then add 100 TCID 50 of the virus solution (adjusted to 50 µL / well), and incubate at room temperature for 30 minutes.

[0054] (4) Resuspend the pre-cultured target cells TZM-bl with DMEM medium and adjust the cell concentration to 10×10 4Cells / mL, and then DEAE-dextran was added to a final concentration of 15 µg / mL. Finally, the cells (100 µL / well) were added to a 96-well plate containing the virus & inhibitor complex and cultured in a 37 °C, 5% CO2 cell culture incubator for 48 hours.

[0055] (5)The cell culture supernatant was discarded, 30 µL of cell lysis buffer (Promega, catalog number E1531) was added to each well, and the cells were lysed at room temperature for 15 minutes. Then, the luciferase assay substrate reagent (Promega, catalog number E1501) was added, and the relative light units (RLU) were measured using a microplate photometer. An inhibition rate curve was made and the half-maximal inhibitory concentration (IC 50 ) was calculated.

[0056] 2. Experimental Results and Analysis As Figure 3 shown, due to the viral tropism selection of PRO 140, it had no inhibitory effect on the CXCR4-tropic virus strain NL4-3 in this experimental system, and the IC 50 value for the CCR5-tropic virus strain JRFL was 5.884 nM. The IC 50 values of 2P23-PRO140-Fc for inhibiting NL4-3 and JRFL were 0.078 nM and 1.276 nM, respectively.

[0057] The three novel N-terminal fusion proteins 2P23-PRO140L, 2P23-PRO140H, and 2P23-PRO140HL all showed significant antiviral effects. The IC 50 values for inhibiting NL4-3 were 0.009 nM, 0.046 nM, and 0.699 nM, respectively, and the IC 50 values for inhibiting JRFL were 0.048 nM, 3.411 nM, and 2.139 nM, respectively. Among them, the light chain N-terminal fusion protein 2P23-PRO140L showed the strongest antiviral activity ( Figure 3 A).

[0058] The N-terminal fusion proteins 2P23-PRO140L, 2P23-1-PRO140H, and 2P23-6-PRO140HL containing (GGGGS)3, (GGGGS)1, and (GGGGS)6 linker peptides, respectively, had IC 50 values for inhibiting NL4-3 of 0.009 nM, 0.032 nM, and 0.006 nM, respectively, and IC 50The values were 0.049 nM, 0.138 nM, and 0.038 nM respectively. Among them, the activity of 2P23-1-PRO140L was the weakest, and the activities of 2P23-PRO140L and 2P23-6-PRO140HL were increased by about 3-5 times compared with it ( Figure 3 B).

[0059] The three C-terminal fusion proteins PRO140L-2P23, PRO140H-2P23, and PRO140HL-2P23 also showed significant antiviral effects. The IC 50 values for inhibiting NL4-3 were 0.03 nM, 0.015 nM, and 0.005 nM respectively, and the IC 50 values for inhibiting JRFL were 3.556 nM, 0.562 nM, and 0.122 nM respectively. Among them, the double-stranded C-terminal fusion protein PRO140HL-2P23 showed the strongest antiviral activity ( Figure 3 C).

[0060] The N-terminal and C-terminal double fusion protein 2P23-PRO140-2P23 also showed significant antiviral effects. The IC 50 value for inhibiting NL4-3 was 0.013 nM, and the IC 50 value for inhibiting JRFL was 0.149 nM ( Figure 3 D).

[0061] In summary, the dual-target fusion protein formed by connecting the 2P23 polypeptide to the N-terminal and / or C-terminal of the PRO 140 antibody overcomes the limitation that PRO 140 is ineffective against CXCR4-tropic strains, and the inhibitory activity against CCR5-tropic strains is also significantly improved compared with PRO 140; the fusion proteins of multiple configurations show significantly improved antiviral activity compared with 2P23-PRO140-Fc. Among them, the light-chain N-terminal fusion protein 2P23-PRO140L has an activity 9-27 times higher than that of 2P23-PRO140-Fc, the double-stranded C-terminal fusion protein PRO140HL-2P23 has an activity 3-16 times higher than that of 2P23-PRO140-Fc, and the N-terminal and C-terminal double fusion protein 2P23-PRO140-2P23 has an activity 6-9 times higher than that of 2P23-PRO140-Fc, showing broad development prospects. After comprehensive consideration, 2P23-PRO140L and PRO140HL-2P23 with better antiviral activities were selected as representative bifunctional fusion proteins for further evaluation.

[0062] Example 3: The novel bifunctional fusion protein has broad-spectrum inhibitory activity against HIV-1, HIV-2, and SIV In this example, the antiviral activities of the above-mentioned advantageous bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 against different subtypes of HIV-1 strains, HIV-2 strains and SIV strains were further evaluated through virus inhibition experiments and fusion inhibition experiments based on the DSP system.

[0063] 1. Experimental Materials and Methods (1) Virus Inhibition Experiment: The test drugs were the bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 prepared in Example 1, and PRO 140 prepared in Example 1 and 2P23-PRO140-Fc and 2P23 polypeptide (whose amino acid sequence is shown in SEQ ID NO.1, EMTWEEWEKKVEELEKKIEELLK) developed and reserved in the laboratory before were used as controls. The HIV-1 pseudoviruses used are shown in Tables 1 and 2, the SIV pseudoviruses used are SIV 239 and SIV PBJ and the HIV-2 replicating viruses used are HIV-2 ROD and HIV-2 ST , which were prepared by this laboratory. The target cell TZM-bl is a product of the National Experimental Cell Resource Sharing Service Platform. The specific experimental steps are as follows: Preparation of Virus: The plasmid expressing the HIV-1 or SIV envelope protein (Env) was co-transfected with the HIV-1 backbone plasmid pSG3∆env into HEK293T cells; the molecular cloning plasmid encoding the HIV-2 virus strains ROD or ST was transfected into HEK293T cells; the transfected cells were cultured in a 37°C, 5% CO2 cell culture incubator for 48 hours, and then the supernatant was collected, filtered and the filtrate was collected, which was the virus solution. After titration, it was stored at -80°C for later use.

[0064] After obtaining the virus solution, the experimental steps were the same as steps (2)-(5) in Example 2.

[0065] (2) Fusion Inhibition Experiment Based on the DSP System: The test drugs were the bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 prepared in Example 1, and PRO 140 prepared in Example 1 and the 2P23 polypeptide reserved in the laboratory were used as controls. The plasmids expressing different subtypes of HIV-1 Env were stored in this laboratory; the pDSP8-11 fluorescent reporter plasmid and the target cells 293FT stably expressing CXCR4 / CCR5 and DSP 8-11 were provided by Professor Zene Matsuda of the University of Tokyo, Japan and were routinely used and stored in this laboratory; the 293T cells were purchased from the American Type Culture Collection. The specific experimental steps are as follows: ① 293T cells (effector cells) were plated in 96-well plates (approximately 1.5×10 4 cells / well), and stably expressed CXCR4 / CCR5 and DSP 8-11 Target cells 293FT (about 1.5 × 10 4 Cells were plated in 10 cm cell culture dishes and cultured at 37°C with 5% CO2.

[0066] ② After 16 hours of culture, HIV-1 Env expression plasmid and DSP 1-7 The plasmids were co-transfected into 293T effector cells at a 1:1 ratio.

[0067] ③ 24 hours after transfection, dilute the drug to the starting concentration in DMEM medium and add it to the effector cells in a 96-well culture plate in a three-fold dilution series (50 µL / well) using nine dilution steps and three replicates. Use DMEM medium without drug as a control. Incubate the plate in a 37°C, 5% CO2 cell culture incubator for 1 hour.

[0068] ④ Resuspend the 293FT cells and adjust the cell concentration to about 30×10 4 EnduRen live cell substrate (Promega) was added at a ratio of 1:4000, mixed, and incubated at 37°C, 5% CO2 for 30 minutes.

[0069] ⑤ 100 μL of 293FT cells were added to the HIV-1 effector cell wells per well, and the cells were centrifuged at 300 g for 1 minute to allow the effector cells and target cells to fully contact each other. After incubation at 37°C for 1 hour, the luciferase activity (relative fluorescence unit, RLU) was measured, and the inhibition rate curve was prepared to calculate the drug half-maximal inhibitory concentration (IC 50 ).

[0070] 2. Experimental results and analysis 1) This example first evaluated the antiviral activity of 2P23-PRO140L and PRO140HL-2P23 using 12 internationally representative HIV-1 pseudoviruses, and used 2P23, PRO 140, and 2P23-PRO140-Fc as controls. The results are shown in Table 1. The two novel bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 effectively inhibited the 12 HIV-1 pseudoviruses and exhibited significantly better antiviral activity than the control molecules. Specifically, the average IC 50 The value was 0.044 nM, compared with 2P23 (IC 50 =2.383 nM), PRO 140 (IC50 = 7.28 nM) and 2P23-PRO140-Fc (IC 50 = 0.185 nM) were increased by 54-fold, 165-fold, and 4-fold, respectively; the average IC 50 value of PRO140HL-2P23 was 0.09 nM, which was 26-fold, 81-fold, and 2-fold higher than those of 2P23, PRO140, and 2P23-PRO140-Fc, respectively.

[0071] Table 1 Inhibitory activities of novel bifunctional fusion proteins and controls against HIV-1 international representative strain pseudoviruses

[0072] 2) In this example, the antiviral activities of 2P23-PRO140L and PRO140HL-2P23 were further evaluated using 21 HIV-1 epidemic strains (the strains covered major genotypes such as subtype B, subtype C, and recombinant subtypes CRF01_AE and CRF07_BC). The results are shown in Table 2. The average IC 50 values of 2P23-PRO140L, PRO140HL-2P23, and the control drugs 2P23 and PRO140 were 0.045 nM, 0.114 nM, 2.830 nM, and 4.974 nM, respectively; among them, 2P23-PRO140L showed the best antiviral activity, which was 63-fold and 111-fold higher than those of 2P23 and PRO140, respectively; PRO140HL-2P23 also showed potent activity, which was 25-fold and 44-fold higher than those of 2P23 and PRO140, respectively. It is worth noting that the broad-spectrum properties of the two bifunctional fusion proteins were significantly better than that of PRO140, and both showed potent antiviral capabilities independent of subtypes against the CXCR4-tropic strain CNE107 and the CCR5-tropic strain CNE49 highly resistant to PRO140.

[0073] Table 2 Inhibitory activities of novel bifunctional fusion proteins and controls against 21 different subtype HIV-1 pseudoviruses

[0074] 3) The inhibitory activities of 2P23-PRO140L, PRO140HL-2P23, and the control drugs 2P23 and PRO 140 against 5 representative HIV-1 Env-mediated cell-cell fusion are shown in Table 3. PRO 140 had no inhibitory effect on CXCR4-tropic strain NL4-3 Env-mediated cell-cell fusion at concentrations up to 500 nM, and its average inhibitory activity against cell-cell fusion mediated by the other 4 HIV-1 Envs was 7.565 nM. The two bifunctional fusion proteins showed significant inhibitory activities against cell-cell fusion mediated by 5 HIV-1 Envs, with average IC 50 values of 0.027 nM and 0.037 nM, respectively, which were 41-fold and 36-fold higher than the inhibitory activity of PRO 140, and 18-fold and 16-fold higher than the inhibitory activity of 2P23.

[0075] Table 3 Inhibitory activities of novel bifunctional fusion proteins and controls against HIV-1 Env-mediated cell fusion

[0076] 4) In terms of inhibitory activity against HIV-2 strains (Table 4), the control drug PRO 140 had no inhibitory activity against HIV-2 ROD at concentrations up to 500 nM, but 2P23-PRO140L could effectively inhibit HIV-2 ROD , with an IC 50 value of 0.309 nM, while the inhibitory activity of PRO140HL-2P23 against HIV-2 ROD was significantly decreased. For the HIV-2 ST strain, the two bifunctional fusion proteins both showed effective inhibitory activities, with IC 50 values of 0.534 nM and 0.457 nM, respectively. Compared with 2P23 and PRO 140, the activity of 2P23-PRO140L was increased by approximately 26-fold and 2-fold, respectively, and the activity of PRO140HL-2P23 was increased by 31-fold and 3-fold, respectively.

[0077] In terms of inhibitory activity against SIV strains (Table 4), the activities of the bifunctional fusion proteins were also greatly improved. The IC 239 values of 2P23-PRO140L against SIV PBJ and SIV 50 were 0.02 nM and 0.087 nM, respectively, which were 79 - 214-fold higher than 2P23 and 262 - 1160-fold higher than PRO 140. The activity of PRO140HL-2P23 against the two SIV pseudoviruses decreased slightly, with an IC 50The values were 0.228 nM and 1.691 nM respectively, but also showed a significant improvement compared to 2P23 and PRO 140.

[0078] Table 4 Inhibitory activities of the novel bifunctional fusion proteins and controls against HIV-2 and SIV strains

[0079] Example 4: The novel bifunctional fusion proteins maintain effective inhibitory activity against drug-resistant HIV-1 virus strains The antiviral activities of the bifunctional fusion proteins 2P23-PRO140L, PRO140HL-2P23 and the control drugs PRO 140 and 2P23 were evaluated using the pseudovirus inhibition assay in Example 2 above.

[0080] The results are shown in Table 5. Due to the viral tropism selectivity of PRO 140, it had no inhibitory effect on NL4-3 and its mutant strains in this experimental system; 2P23 could effectively inhibit the wild-type NL4-3 strain, but the activity against the 2P23-resistant strains decreased to varying degrees, with an average IC 50 value of 12.874 nM and an average drug resistance multiple of 29.94-fold; among them, 2P23 showed a drug resistance of 59.39-fold against the L57R mutant strain and an even higher drug resistance of 245.38-fold against the L57R / E136G mutant strain. In sharp contrast, the bifunctional fusion proteins showed great inhibitory activity against the 2P23-resistant strains. The average IC 50 value of 2P23-PRO140L against the drug-resistant strains was 0.013 nM, and the drug resistance multiple was only 1.4-fold. The average IC[[ID=!8]] 50 value of PRO140HL-2P23 was 0.012 nM, and the drug resistance multiple was only 2.46-fold, indicating that the two bifunctional fusion proteins were sensitive to all 2P23 drug-resistant mutations and maintained a high activity level. Especially for the highly 2P23-resistant mutant strain L57R / E136G, the activities of the two bifunctional fusion proteins were increased by 45875-fold and 24538-fold respectively compared to 2P23, and the sensitivity to the L57R / E136G mutant strain was even higher than that to the wild-type strain, indicating that the bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 are effective inhibitors against 2P23 drug-resistant mutant strains.

[0081] Table 5 Inhibitory activities of the novel bifunctional fusion proteins and controls against 2P23 drug-resistant mutant strains

[0082] Example 5: In vitro stability of the novel bifunctional fusion proteins To further verify the drug-likeness of the bifunctional fusion protein of the present invention, in this example, 2P23-PRO140L, PRO140HL-2P23 and the control PRO 140 were stored at 4 °C, 25 °C and 37 °C for a long time, incubated with human serum and digested with trypsin, and then the antiviral activity changes of the drugs were detected to judge their stability.

[0083] 1. Experimental Materials and Methods (1) Temperature stability experiment: The drug was adjusted to the required concentration with phosphate buffer (PBS), and samples were collected after storing at 4 °C, 25 °C and 37 °C for 0, 7, 14, 21, 28, 35, 42 days. The inhibitory effect of different samples on the infection of TZM-bl cells by NL4-3 strain was detected by the pseudovirus inhibition experiment in Example 2, and the IC 50 value was calculated.

[0084] (2) Human serum stability experiment: The drug was adjusted to the required concentration with phosphate buffer (PBS), and human serum with a final concentration of 20% was added thereto. After mixing, the samples were incubated at 37 °C for 0, 15, 30, 60, 90, 120, 180, 240 and 360 min and then collected. The inhibitory effect of different samples on the infection of TZM-bl cells by NL4-3 strain was detected by the pseudovirus inhibition experiment in Example 2, and the IC 50 value was calculated.

[0085] (3) Digestion with trypsin: The drug and trypsin (product of Sigma-Aldrich, catalog number T4799) were mixed at a ratio of 20:1 (final concentrations were 2 mg / mL and 0.1 mg / mL respectively), and the samples were collected after incubation at 37 °C for 0, 15, 30, 60, 90, 120, 180, 240 and 360 min. The inhibitory effect of different samples on the infection of TZM-bl cells by NL4-3 strain was detected by the pseudovirus inhibition experiment in Example 2, and the IC 50 value was calculated.

[0086] 2. Experimental Results and Analysis As Figure 4 shown, after storing at different temperatures (4 °C, 25 °C and 37 °C) for 42 days, the antiviral activities of 2P23-PRO140L, PRO140HL-2P23 and the control drug PRO 140 did not change significantly, and they had good temperature stability characteristics within 42 days. Further research on longer-term temperature stability is needed.

[0087] After incubation with human serum samples at 37 °C, 2P23-PRO140L, PRO140HL-2P23 and the control drug PRO140 all maintained stable antiviral activity ( Figure 4 ). After trypsin digestion, PRO 140 showed high resistance, while the activity of 2P23-PRO140L decreased by about 10-fold at 60 min of trypsin digestion and then maintained an activity level comparable to that of PRO 140; PRO140HL-2P23 showed an approximately 10-fold decrease in activity at the initial stage of trypsin digestion and then maintained an activity level comparable to that of PRO140, and its subsequent activity change trend was basically the same as that of PRO 140 ( Figure 4 ).

[0088] Example 6: Antiviral Activity of the Novel Bifunctional Fusion Protein in Rats To evaluate the antiviral activity of the bifunctional fusion protein in rats, 18 SD rats were selected in this example and randomly divided into an experimental group and a control group (n = 6). 2P23-PRO140L, PRO140HL-2P23 and the control drug PRO 140 were administered to SD rats by subcutaneous injection. Samples were collected at different time points before administration (0 h) and after administration (1 h, 4 h, 8 h, 12 h, 24 h, 2 d, 4 d, 5 d, 7 d, 10 d, 14 d). The inhibitory effects of rat sera before and after administration on the infection of TZM-bl cells by NL4-3 and SF162 strains were detected by the pseudovirus inhibition experiment in Example 2 in vitro, and the serum dilution multiples at which 50% inhibition of the virus was achieved were calculated.

[0089] In this example, the activities of rat sera inhibiting NL4-3 before and after administration of 2P23-PRO140L, PRO140HL-2P23 and the control drug PRO 140 were first detected and compared with the results of 2P23-PRO140-Fc. The results are as Figure 5As shown in Figure A, due to the virus tropism selection characteristics of PRO140, the PRO 140 serum has no inhibitory activity against NL4-3 in this experimental system. The blood drug concentration of 2P23-PRO140-Fc starts to take effect at 8 h after administration, reaches the peak at 24 h, corresponding to an average serum dilution of 1025 times, and can still maintain a certain antiviral activity 96 h after administration, and the activity drops to a lower level after 120 h. However, the novel bifunctional fusion protein 2P23-PRO140L rapidly reaches a high serum drug concentration at 4 h after administration, corresponding to an average serum dilution of 383 times; the peak time of serum drug concentration is 48 h, and the average serum dilution is 26874 times; after administration for up to 240 h (10 days), the serum can still maintain a high inhibitory activity, with an average dilution of 2588 times; after administration for 336 h (14 days), the serum antiviral activity drops to a lower level. The serum drug concentration of PRO140HL-2P23 reaches the peak at 24-48 h after administration, corresponding to a serum dilution of 43088-44155 times; its serum antiviral activity can last until 240 h (10 days), corresponding to a serum dilution of 1344 times, and after administration for 336 h (14 days), the serum antiviral activity drops to a lower level. In summary, the antiviral activities and stabilities of the two novel bifunctional fusion proteins in rats are much higher than those of 2P23-PRO140-Fc, indicating that they have better in vivo antiviral activities and drug half-lives.

[0090] In this example, the activities of the sera of rats before and after administration of 2P23-PRO140L, PRO140HL-2P23 and the control drug PRO 140 in inhibiting SF162 were also detected. The results are as Figure 5 shown in Figure B. The serum drug concentration of PRO 140 reaches the peak at 48 h after administration, with an average serum dilution of 242 times; the serum antiviral activity of PRO 140 lasts until 240 h (10 days). 2P23-PRO140L rapidly reaches a high serum drug concentration at 4 h after administration, corresponding to an average serum dilution of 266 times; the peak time of serum drug concentration is 48 h, and the average serum dilution is 4099 times; after administration for up to 240 h (10 days), the serum can still maintain a high inhibitory activity, with an average dilution of 675 times; after administration for 336 h (14 days), the serum antiviral activity drops to a lower level. The serum drug concentration of PRO140HL-2P23 reaches the peak at 24 h after administration, corresponding to a serum dilution of 2523 times; its serum antiviral activity can last until 240 h (10 days), corresponding to a serum dilution of 103 times. The results show that the antiviral activities of the two bifunctional fusion proteins in rats are much higher than those of PRO 140, and their in vivo stabilities are similar to those of PRO 140, indicating that they have good in vivo antiviral activities and drug half-lives.

[0091] Example 7: Construction and Expression of a Long-acting Modified Novel Bifunctional Fusion Protein The M428L / N434S (LS) mutation in the Fc region of the IgG antibody can enhance the affinity of the modified IgG for FcRn and simultaneously prolong the terminal half-life of the antibody. Based on the fact that the novel bifunctional fusion proteins 2P23-PRO140L and PRO140HL-2P23 exhibit good antiviral activity and stability, to further optimize the bifunctional fusion protein, in this example, double mutations M428L and N434S were introduced into the Fc region of the PRO 140 heavy chain to perform long-acting modification on 2P23-PRO140L and PRO140HL-2P23. The specific construction method is as follows: The IgG3 signal peptide gene sequence (the sequence is shown in SEQ ID NO.10) and the PRO 140 heavy chain mutant gene sequence (mPRO140H, the sequence is shown in SEQ ID NO.8) were linked together in the order from upstream to downstream and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-mPRO140H expression vector.

[0092] The IgG3 signal peptide gene sequence (the sequence is shown in SEQ ID NO.10), the PRO 140 heavy chain mutant gene sequence (the sequence is shown in SEQ ID NO.8), the linker peptide gene sequence ((GGCGGAGGCGGAAGC) n , n = 2), and the 2P23 gene sequence (the sequence is shown in SEQ ID NO.2) were linked together in the order from upstream to downstream and artificially synthesized (synthesized by GenScript Biotech Corporation). The synthesized sequence was cloned into the pcDNA3.4 mammalian expression vector, denoted as the pcDNA3.4-mPRO140H-2P23 expression vector.

[0093] During the vector construction process, the role of adding the IgG3 signal peptide at the N-terminus of each sequence is to promote the secretion of the protein to the extracellular space after synthesis.

[0094] Based on the dual-plasmid co-transfection system, transfection was carried out according to the following combinations: ① pcDNA3.4-2P23-PRO140L + pcDNA3.4-mPRO140H; ② pcDNA3.4-PRO140L-2P23 + pcDNA3.4-mPRO140H-2P23; ① and ② respectively expressed the N-terminal fusion protein m2P23-PRO140L with double mutations of M428L and N434S introduced into the heavy chain and the C-terminal fusion protein mPRO140HL-2P23 with double mutations of M428L and N434S introduced into the heavy chain. Then, the methods in Example 1 were used for protein purification and identification. Among them, the amino acid sequence of the PRO 140 antibody heavy chain mutant gene is shown in SEQ ID NO.7.

[0095] The results were as Figure 6 shown in A. After SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining, both fusion proteins effectively expressed the target fusion proteins, and single electrophoresis bands were presented for both the light / heavy chains, indicating the successful acquisition of bifunctional fusion proteins with clear molecular conformations.

[0096] Figure 6 B showed that the IC 50 values of the long-acting modified bifunctional fusion proteins m2P23-PRO140L and mPRO140HL-2P23 against NL4-3 were 0.005 nM and 0.003 nM respectively, and the IC 50 values against JRFL were 0.0255 nM and 0.1083 nM respectively. The antiviral activities of the long-acting modified bifunctional fusion proteins were comparable to those of their prototype proteins 2P23-PRO140L and PRO140HL-2P23.

[0097] Example 11: Antiviral Activity of Long-Acting Modified Novel Bifunctional Fusion Proteins in Rats To evaluate the antiviral activity of the long-acting modified bifunctional fusion proteins in rats, 12 SD rats were selected in this example and randomly divided into two groups (n = 6). m2P23-PRO140L and mPRO140HL-2P23 were subcutaneously injected into SD rats at a dose of 3 mg / kg. Samples were collected at different time points before administration (0 h) and after administration (1 h, 4 h, 8 h, 12 h, 24 h, 2 d, 4 d, 5 d, 7 d, 10 d, 14 d, 18 d, 21 d, 25 d, 28 d). In vitro, the inhibitory effect of rat serum before and after administration on the infection of TZM-bl cells by NL4-3 was detected using the pseudovirus inhibition experiment in Example 2, and the results were compared with those of their prototype proteins 2P23-PRO140L and PRO140HL-2P23.

[0098] The results were asFigure 7 As shown in A, after 336 h (14 days) of dosing, the serum drug concentration of 2P23-PRO140L decreased to a lower level, and the corresponding serum dilution was 78-fold. After 336 h (14 days) of dosing, the serum of m2P23-PRO140L could still maintain a high antiviral activity, and the corresponding average serum dilution was 200-fold; after 432 h (18 days) of dosing, the serum antiviral activity decreased to a lower level, and the corresponding serum dilution was 97-fold.

[0099] Figure 7 As shown in B, after 336 h (14 days) of dosing, the serum drug concentration of PRO140HL-2P23 decreased to a lower level, and the corresponding serum dilution was 94-fold. After 336 h (14 days) of dosing, the serum of mPRO140HL-2P23 could still maintain a high antiviral activity, and the corresponding average serum dilution was 616-fold; its serum antiviral activity could last until 432 h (18 days), and after 504 h (21 days) of dosing, the serum antiviral activity decreased to a lower level.

[0100] The above research results show that compared with the prototype protein, the long-acting bifunctional fusion proteins m2P23-PRO140L and mPRO140HL-2P23 show significantly enhanced stability and can maintain a more persistent antiviral activity in the rat model, indicating that both fusion proteins have the characteristic of an extended drug half-life.

Claims

1. A bifunctional fusion protein that simultaneously targets CCR5 and gp41, characterized in that, The bifunctional fusion protein comprises (1) a fusion protein obtained by connecting polypeptide 2P23 to the N-terminus and / or C-terminus of the light chain and / or heavy chain of antibody PRO 140 or a PRO 140 mutant via a linker peptide; or (2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the fusion protein in (1) above.

2. The bifunctional fusion protein that simultaneously targets CCR5 and gp41 as described in claim 1, wherein The amino acid sequence of the polypeptide 2P23 is as shown in SEQ ID NO.1; The amino acid sequence of the light chain of the antibody PRO 140 is as shown in SEQ ID NO.3; The amino acid sequence of the heavy chain of the antibody PRO 140 is as shown in SEQ ID NO.

5.

3. The bifunctional fusion protein that simultaneously targets CCR5 and gp41 as described in claim 1, wherein The amino acid sequence of the linker peptide is (GGGGS) n , where n takes the values of 1, 2, 3, 4, 5 or 6.

4. The bifunctional fusion protein that simultaneously targets CCR5 and gp41 as described in claim 1, wherein, The PRO 140 mutant is obtained by introducing M428L and N434S mutations in the Fc segment of the PRO 140 heavy chain; Preferably, the amino acid sequence of the light chain of the PRO 140 mutant is as shown in SEQ ID NO.3; The amino acid sequence of the heavy chain of the PRO 140 mutant is as shown in SEQ ID NO.

7.

5. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the bifunctional fusion protein according to any one of claims 1-4.

6. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule according to claim 5.

7. An engineered animal cell line, characterized in that, The animal cell line contains the recombinant expression vector according to claim 6 or the nucleic acid molecule according to claim 6 is integrated into the genome.

8. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the bifunctional fusion protein according to any one of claims 1-4 or a derivative thereof, and a pharmaceutically acceptable carrier or excipient; Preferably, the pharmaceutical composition is an inhibitor of human immunodeficiency virus entry.

9. Use of the bifunctional fusion protein according to any one of claims 1-4, the nucleic acid molecule according to claim 5, the recombinant expression vector according to claim 6 or the engineered animal cell line according to claim 7 in the preparation of a functional product; The functional product is used for any one or a combination of the following: a) antiviral; b) preventing and / or treating diseases caused by viral infections; c) inhibiting viral cell fusion; d) inhibiting viral entry into cells; e) inhibiting viral replication.

10. The use according to claim 9, characterized in that, The virus includes but is not limited to HIV-1, HIV-2 or SIV; The diseases caused by viral infections include but are not limited to acquired immunodeficiency syndrome.

Images