Construction method and application of heavy metal Cd passivated strain based on protein surface display

Abstract

The invention relates to a construction method and application of a heavy metal Cd passivated strain based on protein surface display, Rhodopseudomonas palustris is taken as a host, a surface display technology is adopted, Cd specific binding protein CadR gene from Pseudomonas syringae is fused with a promoter, an anchoring protein, a connecting peptide and a purification tag gene, and the Cd passivated strain is obtained. Introducing into rhodopseudomonas palustris host cells for surface localization expression; the Cd whole-cell adsorbent with the heavy metal passivation function is obtained; the surface display engineering bacterium disclosed by the invention can realize stable and efficient adsorption of Cd < 2 + > in a water body, and has a good application prospect in the field of bioremediation of heavy metal polluted wastewater.

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular biology and genetic engineering, and particularly relates to a construction method and application of a heavy metal Cd passivation strain based on protein surface display. Background Art

[0002] Heavy metals are globally prevalent pollutants that cause serious harm to the environment and organisms. In the field of environmental bioremediation, the lack of nutrients and electron acceptors in contaminated areas limits the growth and remediation effect of the bacteria used, and the significant advantage of photosynthetic bacteria as bioremediation agents lies in their good adaptability to various environmental conditions and nutritional patterns. However, direct bioremediation has problems such as cumbersome strain screening steps, strong cytotoxicity, inability to adapt to high-concentration heavy metal environments, and low adsorption efficiency.

[0003] To address these problems, surface display technology has been developed and applied to heavy metal bioremediation, showing good results. Microbial surface display technology refers to the targeted expression of foreign proteins or polypeptides on the surface of host cells by genetic engineering means. Based on the variable structure and function of the microbial cell surface, surface display technology has been widely applied in bioadsorbents, biosensors, antibody production, biocatalysts, etc. Among various bioadsorption methods, microbial surface display technology has attracted increasing attention. Compared with intracellular and extracellular adsorption, microbial surface display has the following advantages: no protein purification is required; no cell disruption is required; it is convenient for recycling and reuse; specific and stable adsorption of target metal ions, etc. Therefore, surface display technology has broad application prospects in the field of heavy metal bioremediation.

[0004] However, the hosts currently used are still limited to model microorganisms such as Escherichia coli, Bacillus subtilis, and Saccharomyces cerevisiae, and there are problems such as the need for induction of protein expression and the susceptibility of bioremediation effects to environmental conditions. Chinese Patent Application CN109439558A discloses a recombinant yeast strain, its construction method and application, and the recombinant yeast strain is obtained by transforming Saccharomyces cerevisiae with the metallothionein BnMTL gene derived from ramie. Using yeast surface display technology, a recombinant yeast strain expressing a small molecule metallothionein derived from ramie on the cell wall surface is constructed, and cadmium ions are directly adsorbed and solidified through the heterologously expressed metallothionein on the cell wall surface, thereby reducing the mobility and bioavailability of cadmium in the soil. However, the host of this invention is Saccharomyces cerevisiae, protein expression requires induction, and the bioremediation effect is easily interfered by the environment. Summary of the Invention

[0005] To overcome the deficiencies of the above-mentioned existing technologies, the purpose of the present invention is to provide a method for constructing and applying a heavy metal Cd passivating strain based on protein surface display, localize the expression of a Cd-specific binding protein on the cell surface of Rhodopseudomonas palustris, and obtain a recombinant Rhodopseudomonas palustris CGA-Pd-OGSC that efficiently surface-displays the Cd-specific binding protein CadR by optimizing the expression cassette elements, realizing the stable and efficient adsorption of Cd 2+ in the culture medium, and having good application prospects in the field of bioremediation of heavy metal-polluted wastewater.

[0006] To achieve the above purpose, the technical solution of the present invention is:

[0007] A recombinant Rhodopseudomonas palustris strain that surface-displays a Cd-specific binding protein, the preservation unit: Guangdong Provincial Microbial Culture Collection Center (GDMCC); preservation number: GDMCC No. 66049; preservation date: March 25, 2025; address: 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou; the strain is viable; taxonomic naming: Rhodopseudomonas palustris;

[0008] The recombinant Rhodopseudomonas palustris strain is Rhodopseudomonas palustris CGA-Pd-OGSC; the recombinant Rhodopseudomonas palustris strain is formed by introducing the Cd-specific binding protein CadR gene derived from Pseudomonas syringae DC3000 into Rhodopseudomonas palustris.

[0009] The host of the Rhodopseudomonas palustris is the wild-type Rhodopseudomonas palustris CGA009.

[0010] The recombinant Rhodopseudomonas palustris strain that surface-displays a Cd-specific binding protein is obtained by fusing the Cd-specific binding protein CadR gene with a linker peptide and an anchor protein sequence in sequence, that is, connecting the gene fragments together; and then fusing with the promoter and purification tag sequence in the expression cassette in sequence, and importing it into the Rhodopseudomonas palustris host.

[0011] The nucleotide sequence of the Cd-specific binding protein CadR gene is optimized according to the codon preference of Rhodopseudomonas palustris.

[0012] The linker peptide uses a flexible linker peptide (GGGGS)3, and the nucleotide sequence of the linker peptide is connected to the 5' end of the CadR gene.

[0013] The gene of the anchor protein is derived from the outer membrane protein OmpA gene of Rhodopseudomonas palustris CGA009, and the nucleotide sequence of the anchor protein is connected to the 5' end of the linker peptide gene.

[0014] The promoter in the expression cassette is the promoter Pd of the pucBAd gene derived from Rhodopseudomonas palustris CGA009; the purification tag in the expression cassette is the protein purification tag His-tag, and the nucleotide sequence of the His-tag gene is optimized according to the codon preference of Rhodopseudomonas palustris, and the nucleotide sequence of the His-tag gene is ligated to the 3' end of the CadR gene.

[0015] A method for constructing a recombinant Rhodopseudomonas palustris strain specifically includes the following steps:

[0016] Step 1: Retrieve the CadR gene sequence of Pseudomonas syringae DC3000 and the OmpA gene sequence of Rhodopseudomonas palustris CGA009 in the database, synthesize the OmpA sequence and the linker peptide (GGGGS)3, CadR, and His-tag gene sequences optimized according to the codon preference of Rhodopseudomonas palustris to obtain the fusion fragment OmpA-(GGGGS)3-CadR-His-tag;

[0017] Step 2: Using the whole genome of Rhodopseudomonas palustris CGA009 as a template, obtain the promoter Pd of the pucBAd gene and its upstream homologous arm by PCR amplification, and introduce restriction enzyme sites at both ends of the promoter Pd of the pucBAd gene and its upstream homologous arm;

[0018] Step 3: Connect the promoter Pd of the pucBAd gene and its upstream homologous arm sequence to the 5' end of the fusion fragment OmpA-(GGGGS)3-CadR-His-tag obtained in Step 1 through restriction enzyme sites to obtain the fusion fragment Pd-OmpA-(GGGGS)3-CadR-His-tag, and ligate it into a broad-host shuttle plasmid to obtain the recombinant plasmid pBBR-Pd-OGSC containing the fusion fragment;

[0019] Step 4: Transform the recombinant plasmid containing the fusion fragment obtained in Step 3 into Rhodopseudomonas palustris CGA009 by triparental mating, and screen for recombinant Rhodopseudomonas palustris in a medium containing antibiotics. The antibiotics in the medium containing antibiotics include kanamycin or ampicillin medium.

[0020] The specific method of Step 4 is as follows:

[0021] 4.1, Pre-culture Escherichia coli S17-1 carrying the recombinant plasmid pBBR-Pd-OGSC obtained in Step 3 and the helper bacterium pRK2013 / HB101 with 3 - 5 mL of LB medium containing antibiotics at a pre-culture temperature of 35 - 37°C for a pre-culture time of 16 - 18 h, and pre-culture Rhodopseudomonas palustris CGA009 with 8 - 10 mL of ACY medium at 35 - 37°C for 48 - 60 h;

[0022] 4.2. Collect the cells by centrifugation at 6000-8000 rpm for 8-10 min, then wash once or twice with 8-10 mL of MedA medium. Centrifuge again at 6000-8000 rpm for 8-10 min, resuspend the E. coli S17-1 carrying the recombinant plasmid pBBR-Pd-OGSC and the helper bacteria pRK2013 / HB101 in 300-500 μL of MedA, and resuspend Rhodopseudomonas palustris in 800-1000 μL of MedA.

[0023] 4.3. Pipette 20-30 μL of E. coli S17-1 carrying the recombinant plasmid pBBR-Pd-OGSC, 20-30 μL of the helper bacteria pRK2013 / HB101, and 80-100 μL of Rhodopseudomonas palustris CGA009, mix them evenly, and spread them on MedA plates to form circular spots with a diameter of 2 ± 0.2 cm;

[0024] 4.4. After the round spots have dried, invert the plate and incubate at 35-37°C for 24-36 hours. Then, scrape the round spots with 1-2 mL MedA and a coating stick, centrifuge at 6000-8000 rpm for 2-4 minutes, collect the bacteria, and use 1-2 mL The mixture was washed 1-2 times with MedA medium, and then centrifuged at 6000-8000 rpm for 2-4 minutes. The mixed bacteria were then resuspended with 800-1000 μL of MedA. 80-100 μL of the resuspended solution was spread on a MedA plate with kanamycin and inverted at 35-37°C for 5-7 days. A single red colony grown on the plate was picked and inoculated into MedA liquid medium containing antibiotics. After growing for 48-60 hours, 0.5-1 μL of the bacterial solution was aspirated as a template for bacterial solution PCR amplification. The bacterial solution that successfully amplified the target band was screened and frozen at -80°C. The product of bacterial solution amplification was purified and sequenced for verification. The successfully constructed recombinant Rhodopseudomonas palustris strain was named CGA-Pd-OGSC.

[0025] A recombinant Rhodopseudomonas palustris strain is used for heavy metal passivation. 2+ The culture medium was used for fermentation and free Cd was removed from the culture medium by combining CadR protein with Cd. 2+ , the specific steps are as follows:

[0026] Step 1, inoculating the seed liquid of the recombinant Rhodopseudomonas palustris into ACY liquid culture medium, and pre-culturing at 35-37° C. and 160-200 rpm for 48-72 hours;

[0027] Step 2: Inoculate the culture obtained from the pre-culture in Step 1 into the ACY liquid medium containing Cd 2+ , and dilute and adjust the bacterial density in the ACY liquid medium after inoculation to an OD 660nm of approximately 0.1 - 0.5. Conduct light anaerobic culture at 30 - 37°C and 800 - 1500 lux. Sample every 12 - 24 h, centrifuge at 8000 - 9000 rpm for 3 - 5 min, and collect the supernatant;

[0028] Step 3: Measure the residual concentration of Cd2+ in the supernatant until the residual amount no longer decreases.

[0029] For the prior art, the beneficial effects of the present invention are as follows:

[0030] 1. The present invention uses surface display technology to localize and express a Cd-specific binding protein on the surface of Rhodopseudomonas palustris cells. By optimizing the expression cassette elements, a recombinant Rhodopseudomonas palustris CGA-Pd-OGSC that efficiently surface-displays the Cd-specific binding protein CadR is obtained, and the Cd2+ removal rate reaches 95.6%.

[0031] 2. The recombinant Rhodopseudomonas palustris with surface-displayed CadR in the present invention can tolerate Cd2+ with a concentration as high as 10 mM, alleviating the growth inhibitory effect of high-concentration Cd2+ on Rhodopseudomonas palustris.

[0032] 3. The recombinant Rhodopseudomonas palustris with surface-displayed CadR in the present invention can resist the interference of various complex components in Cd-containing wastewater and maintain a Cd2+ removal efficiency of more than 90%.

[0033] 4. The recombinant Rhodopseudomonas palustris in the present invention can achieve stable and efficient adsorption of Cd2+ in water, and at the same time provides a new type of whole-cell adsorbent for heavy metal passivation in heavy metal-contaminated wastewater, having good industrial application prospects.

[0034] In summary, the present invention uses Rhodopseudomonas palustris as a host, adopts surface display technology, fuses the Cd-specific binding protein CadR gene derived from Pseudomonas syringae with promoter, anchor protein, linker peptide, and purification tag genes, and imports them into the Rhodopseudomonas palustris host cell for surface localization expression; a Cd whole-cell adsorbent with heavy metal passivation function is obtained; the surface-displayed engineering bacteria of the present invention can achieve stable and efficient adsorption of Cd2+ in water and have good application prospects in the field of bioremediation of heavy metal-contaminated wastewater. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is a schematic diagram of the construction method of recombinant Rhodopseudomonas palustris with surface-displayed CadR and its Cd passivation application.

[0036] Figure 2 It is the structural map of the recombinant expression vector pBBR-Pd-OGSC.

[0037] Figure 3 It is the double digestion electrophoresis verification image of the fusion protein expression vectors pBBR-OGSC and pBBR-Pd-OGSC.

[0038] Figure 4 It is the agarose gel electrophoresis image of the PCR products of the wild strain CGA009 and the recombinant strain CGA-Pd-OGSC.

[0039] Figure 5 It is the 10% SDS-PAGE analysis result of the purified target fusion protein.

[0040] Figure 6 It is the maximum growth density of the wild strain CGA009 and the recombinant strain CGA-Pd-OGSC at different Cd2+ concentrations.

[0041] Figure 7 It is the residual Cd2+ concentration in the culture supernatant of the wild strain CGA009 and the recombinant strain CGA-Pd-OGSC.

[0042] Figure 8 It is the Cd2+ removal rate of the wild strain CGA009 and the recombinant strain CGA-Pd-OGSC in the culture medium.

[0043] Figure 9 It is the Cd2+ removal rate of the wild strain CGA009 and the recombinant strain CGA-Pd-OGSC in Cd wastewater. Specific implementation manners

[0044] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings and the cases in the embodiments of the present invention. The technical solutions described in the present invention are conventional solutions in the art unless otherwise specified; the reagents or materials are from commercial channels unless otherwise specified.

[0045] Example 1

[0046] Construction of the expression vector for surface display of the Cd-specific binding protein CadR

[0047] (1) In this embodiment, two strains, Rhodopseudomonas palustris and Escherichia coli, need to be cultured. Streak inoculate Rhodopseudomonas palustris on an ACY or MedA plate and incubate it upside down in an incubator at 35 °C for 4 d (ACY) or 7 d (MedA). Then pick a single colony and inoculate it into 10 mL of ACY liquid medium, and culture it aerobically in the dark at 180 rpm on a shaker at 35 °C for 3 d to obtain a Rhodopseudomonas palustris culture. Streak inoculate Escherichia coli on Luria-Bertani (LB) solid medium and incubate it upside down at 37 °C for 16 - 20 h. Then pick a single colony and inoculate it into 10 mL of LB culture solution, and culture it overnight at 180 rpm on a shaker at 37 °C. Add the corresponding antibiotic (kanamycin 50 μg / mL or ampicillin 100 μg / mL) to the LB medium according to the resistance gene type of the carried plasmid.

[0048] ACY medium: Casein 5.0 g / L, yeast extract 3.0 g / L, Solution C 20 mL / L, (NH4)2SO4 0.5 g / L, sodium succinate 2.0 g / L, L-glutamic acid 0.1 g / L, L-aspartic acid 0.04 g / L, NaCl 1.0 g / L, phosphate buffer 20 mM, 1000*Vitamin 1.0 mL / L. Dissolve with ultrapure water and make up the volume to 1 L, and adjust the pH = 7.0.

[0049] Solution C: Nitrilotriacetic acid 10.0 g / L, MgSO4·7H2O 29.5 g / L, CaCl2·2H2O 3.335 g / L, FeSO4·7H2O 0.09 g / L, (NH4)6Mo7O 24 .4H2O 0.0093 g / L, trace elements 50 mL. Dissolve with ultrapure water and make up the volume, and the pH = 6.8.

[0050] Trace elements (100 mL): ZnSO4·7H2O 1.095 g, EDTA 250 mg, FeSO4·7H2O 500 mg, H3BO3 11.4 mg, MnSO4·H2O 154 mg, CuSO4·5H2O 39.2 mg, Co(NO3)2·6H2O 24.8 mg. Dissolve with ultrapure water and make up the volume.

[0051] 1000*Vitamin (100 mL): Thiamine hydrochloride 50 mg, nicotinic acid 100 mg, biotin 1 mg. Dissolve with ultrapure water and make up the volume.

[0052] MedA medium is obtained by removing casein and yeast extract from ACY medium.

[0053] (2) In this embodiment, the whole genome sequences of Pseudomonas syringae DC3000 and Rhodopseudomonas palustris CGA009 are from the NCBI database, and specific primers are designed using Primer Premier 5.0 for DNA amplification. The strains, plasmids and primers used in the present invention are shown in Table 1.

[0054] Table 1 Strains, plasmids and primers

[0055]

[0056]

[0057] (3) The coding sequence of outer membrane protein A OmpA of Rhodopseudomonas palustris CGA009 and the coding sequence of Cd-specific binding protein CadR of Pseudomonas syringae are retrieved from the NCBI database. According to the codon preference of Rhodopseudomonas palustris, the CadR sequence is codon-optimized and the stop codon is deleted (the nucleotide sequence is shown as SEQ ID NO:1). Then, the coding sequence of the optimized linker peptide (GGGGS)3 is ligated upstream of the CadR fragment (the nucleotide sequence is shown as SEQ ID NO:2), the coding sequence of the optimized purification tag His-tag is ligated downstream of the CadR fragment, and the stop codon TAA and the restriction enzyme cleavage site -TCTAGA- of restriction endonuclease Xba I are added at the N-terminus (the nucleotide sequence is shown as SEQ ID NO:5). In addition, the OmpA coding sequence is ligated upstream of the linker peptide fragment, the stop codon of OmpA is deleted, and the restriction enzyme cleavage site -AAGCTT- of restriction endonuclease Hind III and the ribosome binding site RBS (the nucleotide sequence is shown as SEQ ID NO:3) are ligated at its 5'-end. A biological company providing gene synthesis services is commissioned to synthesize the fusion fragment Hind III-RBS-OmpA-(GGGGS)3-CadR-His-tag-Xba I and ligate it between the Hind III and Xba I restriction enzyme cleavage sites of plasmid PUC57 to obtain plasmid PUC57-OGSC.

[0058] SEQ ID NO:1:

[0059] ATGAAGATCGGCGAGCTGGCCAAGCTCACCGACACGCAGGTGGAGACCATCCGCTACTACGAGCGCGAGGGCCTGCTGCCCGCCCCGGCCCGGTCGGACGGCAACTACCGCCTGTACACCCAGGCGCACATGGAGCGCCTGAGCTTCATCCGCAACTGCCGGTCGCTGGACATGACCCTGGAGGAGATCCGCAACCTGCTGAACCTGCGCGACTCGCCGCAGGACCAGTGCGAGTCGGTGAACGCGCTGATCGACGAGCACATCGAGCACGTGAACGCGCGCGTCGCGTCGCTGCAGGCGCTGCAGGAGCAGCTGCTGGACCTGCGCCGCCGCTGCAGCGACGGCGTGGCGGACCACTGCGCGATCCTGGAGCGCCTCGAAGTGACGGGCGCGGTGGCGGCGCCGGAGGGCGAGCCGTCGCACGTGGGCCGCAGCCACGGCCAC

[0060] SEQ ID NO:2:

[0061] GGCGGCGGCGGCTCGGGCGGCGGCGGCTCGGGCGGCGGGGGCTCC

[0062] SEQ ID NO:3:

[0063] AAGCTTCGCAGGAGGACAAATCATGACCTGGAGGTCCGCAGCCCGACACCGCGCCAAGGTCGGCGCACTCATCCTGGCACTCGGCGCGGCATTCCCGCTCGGCGTCGCATCGGCCGGCGAGGTGACGTCGGACCAGATCGTGCGGGCGCTGACGCCGAACAAGCCGCTCACCCGCAGCCTGTCGGCCGCGCAGCCGGCCGCAGCGACGGTCGATCCGACCCAGGCCAAGTTCGTCGACAGCCTGCGCAACCGTCCAACCCGGTCCCTGTCCTCCGGCGAGCGGACCCAGATCGCCGAGATCACCAAGGACAAGCCGAACATCGATCTCGAAATCACCTTCGAGTACAACTCCGCCAATATCAGCCGTCAGGCGGCTCCAGCCGTCGAAGCGCTTGGCAAGGCGCTGTCCAGTCCCGATCTGAAAGGCGGGACCTTCGTGGTCGCAGGCCATACCGACAGCGTCGGCAGCGACAGCTTCAACCAGGACCTGTCGGAACGCCGCGCCGATACCATCAAGCGCGTGCTGGTCGAGAAGTACGGCATTGCGGGCGCCGACCTCGTCACTGTCGGTTATGGCGAGAGCCGGCTGAAAGATCCGGCGCATCCCGACAGCGGCATCAATCGCCGGGTGCAGGTGGTCAACATGTCCGACCAGAGCACCGCGGCCAAA

[0064] SEQ ID NO:5:

[0065] CACCACCACCATCACCACTAATCTAGA

[0066] (4) The plasmid PUC57-OGSC and pBBR1MCS-2 were extracted using the Column Plasmid DNA Mini-Preparation Kit (DiaSpin, Sangon Biotech). The fusion fragment was cloned into the plasmid pBBR1MCS-2 by double digestion with Hind III and XbaI. After the digestion products were purified using the Column PCR Product Purification Kit (DiaSpin, Sangon Biotech), the fragment length was detected by 0.5×TBE electrophoresis buffer and 1% agarose gel electrophoresis (electrophoresis apparatus HC, Bio-Rad) and gel imaging system (Universal Hood II, Bio-Rad). After obtaining the recombinant plasmid pBBR-OGSC with the correct fragment size, it was transferred into competent Escherichia coli S17-1 by electroporation. The transformed culture was resuscitated at 37°C for 1 h and then spread on an LB plate supplemented with X-gal, IPTG, and kanamycin. Colonies containing the recombinant plasmid were screened based on the principle of blue-white screening.

[0067] (5) Multiple copies of the pucBA gene of Rhodopseudomonas palustris CGA009 were retrieved from the NCBI database, and the fragment (509 bp) upstream of the pucBAd gene was selected as the promoter Pd. The genomic DNA of Rhodopseudomonas palustris CGA009 was isolated using the Column Bacterial Genomic DNA Extraction Kit (DiaSpin, Sangon Biotech) and used as a template. The fragment Pd (nucleotide sequence shown in SEQ ID NO:4) was amplified using the primers F-Pd / R-Pd. After double digestion of the PCR product, it was cloned between the Kpn I and Hind III sites of the plasmid pBlu2SKP to obtain the plasmid pBS-Pd, which was then transferred into competent Escherichia coli DH5α. After obtaining a large number of copies of the recombinant plasmid in DH5α, the Pd fragment was cloned upstream of the fusion fragment in the vector pBBR-OGSC by double digestion to obtain the plasmid pBBR-Pd-OGSC, which was then transferred into competent Escherichia coli S17-1. The recombinant plasmid was identified by double digestion with Kpn I and Xba I and sent to a biological company providing gene sequencing services. After the sequencing was correct, it was used for subsequent experiments. Figure 1 Schematic diagram of the construction method of recombinant Rhodopseudomonas palustris displaying CadR and its application in Cd passivation Figure 2 Schematic diagram of the structure of the recombinant expression vector pBBR-Pd-OGSC Figure 3 Verification image of double digestion electrophoresis of the fusion protein expression vector. After double digestion with Kpn I and Xba I, pBBR-OGSC and pBBR-Pd-OGSC both obtained two bands, which were the plasmid backbone and the exogenous insertion sequence respectively. The lengths of the exogenous insertion sequences of pBBR-OGSC and pBBR-Pd-OGSC were 1186 bp and 1653 bp respectively. The fragment sizes were consistent with the expected values, and the sequencing results showed that no base mutations occurred in the sequences, proving that the expression vectors were successfully constructed.

[0068] SEQ ID NO:4:

[0069] GGTACCCGTCCGCGATGAAAATCCGCAGATGCCCCTGATGCACCCGTCGCGTGAGTTTCTGATCCATCGTCCGCACCATCTGCCGAGCAAGATCGCGGTCCCGAAGGCGTGCTCGCTGCGATCCTGATCTTCACGGAGAAAACTACACCTGGCGGTGTCGTGGTCGGTTGGCACAAATCAAATCGGAGCGTCAGGAAATCCTGACGACGGAGTCCAACCTCCAGCATCGTACGGACGGTCGGTTTCTGTCAGCCCAAATTGACGCTTCGAGACGTCAGCGTAAGTTCACCCCGCGTCCTGATCACAGAATCTTGATGATTATCGGGGCGGGGCGCACGAGAGCCGAACCGAGACACTTCTGAGATTTCGGAAGCAGACGGCGAGGCGATCATCAGATCCATTGCTGACACCGCGAGCACTCGTTCGGCGTAGCAGTGAACAACTACCTGCGTGCGGGTTCAGCACGAAACTGATCGTTAGTCTCTTAGGAGGTTATCCATGATAAGCTT

[0070] Example 2

[0071] Construction of a recombinant Rhodopseudomonas palustris strain with surface-displayed CadR

[0072] (1) Transfer the recombinant expression vector into the Rhodopseudomonas palustris host by triparental mating. Pre-culture Rhodopseudomonas palustris CGA009, Escherichia coli S17-1 carrying the recombinant plasmid pBBR-Pd-OGSC, and the helper bacterium pRK2013 / HB101.

[0073] Pre-culture Escherichia coli S17-1 carrying recombinant plasmid pBBR-Pd-OGSC and helper bacterium pRK2013 / HB101 with 3 mL, or 4 mL, or 5 mL of LB medium containing antibiotics. The pre-culture temperature is 35°C, or 36°C, or 37°C, and the pre-culture time is 16 h, or 17 h, or 18 h. Pre-culture Rhodopseudomonas palustris CGA009 with 8 mL, or 9 mL, or 10 mL of ACY medium at 35°C, or 36°C, or 37°C for 48, or 54, or 60 h; Centrifuge to collect the cells at a rotational speed of 6000 rpm, or 7000 rpm, or 8000 rpm for 8 min, or 9 min, or 10 min, then wash once or twice with 8 mL, or 9 mL, or 10 mL of MedA medium, and centrifuge again at a rotational speed of 6000 rpm, or 7000 rpm, or 8000 rpm for 8 min, or 9 min, or 10 min. Resuspend Escherichia coli S17-1 carrying recombinant plasmid pBBR-Pd-OGSC and helper bacterium pRK2013 / HB101 with 300 μL, or 400 μL, or 500 μL of MedA, and resuspend Rhodopseudomonas palustris with 800 μL, or 900 μL, or 1000 μL of MedA; Respectively aspirate 20 μL, or 25 μL, or 30 μL of Escherichia coli S17-1 carrying recombinant plasmid pBBR-Pd-OGSC and 20 μL, or 25 μL, or 30 μL of helper bacterium pRK2013 / HB101, as well as 80 μL, or 90 μL, or 100 μL of Rhodopseudomonas palustris CGA009, mix evenly and spread on a MedA plate to form a circular spot with a diameter of 2 ± 0.2 cm; After the circular spot dries, invert the plate and culture at 35°C, or 36°C, or 37°C for 24 h, or 30 h, or 36 h; Then, scrape the bacteria in the circular spot with 1 mL, or 1.5 mL, or 2 mL of MedA and a spreading rod, centrifuge at a rotational speed of 6000 rpm, or 7000 rpm, or 8000 rpm for 2 min, or 3 min, or 4 min to collect the bacteria, wash once or twice with 1 mL, or 1.5 mL, or 2 mL of MedA medium, and centrifuge again at a rotational speed of 6000 rpm, or 7000 rpm, or 8000 rpm for 2 min, or 3 min, or 4 min, then resuspend this mixed bacteria with 800 μL, or 900 μL, or 1000 μL of MedA; Aspirate 80 μL, or 90 μL, or 100 μL of the resuspension and spread it on a MedA plate with kanamycin, and culture it inverted at 35°C, or 36°C, or 37°C for 5 days, or 6 days, or 7 days; Pick the red single colonies grown on the plate and inoculate them into MedA liquid medium containing kanamycin. After growing for 48 h, or 54 h, or 60 h, aspirate 0.5 μL, or 0.8 μL, or 1 μL of the bacterial liquid as a template for the bacterial liquid PCR amplification process (using primers F-CX / R-CX on the plasmid backbone)

[0074] The bacterial liquid with successfully amplified target bands was cryopreserved. After purifying the PCR product, it was sent to a biological company providing gene sequencing services for sequencing verification. The successfully constructed recombinant Rhodopseudomonas palustris strain was named CGA-Pd-OGSC. Figure 4 This is the agarose gel electrophoresis image of the PCR product of the bacterial liquid. The results showed that compared with the wild strain CGA009, the Rhodopseudomonas palustris containing the recombinant expression vector amplified the target fragment of the corresponding length (1901 bp). In addition, the sequencing result of the PCR product was correct. This indicated that the recombinant expression vector had been successfully transferred into the Rhodopseudomonas palustris strain and stably replicated.

[0075] The PCR amplification process requires a pair of primers. Primers F-CX / R-CX on the plasmid backbone were used, which are located upstream and downstream of the target gene fragment respectively. PCR amplification is to amplify the sequence between the upstream and downstream primers. The primers used in this step are on the plasmid backbone; the distance between the upstream and downstream primers is about dozens to 100 bp. If the amplified fragment by PCR is only dozens to 100 bp, it means that the imported plasmid is an empty plasmid without the target fragment; if the length of the amplified fragment by PCR is the length of the target fragment plus dozens to 100 bp, it means that the plasmid imported into the photosynthetic bacteria is the recombinant plasmid obtained previously. (Although a series of verifications were carried out after the recombinant plasmid was constructed before, there are still small probability events such as loss of the target fragment and false positives during the process of transferring it into the photosynthetic bacteria. Therefore, after the recombinant plasmid is transferred into the photosynthetic bacteria, we generally perform bacterial liquid PCR and sequencing verification again to ensure that the finally obtained recombinant bacteria meet the initial design; the bacterial liquid with successfully amplified target bands was cryopreserved at -80 °C. After purifying the PCR product, it was sent to a biological company providing gene sequencing services for sequencing verification. The successfully constructed recombinant Rhodopseudomonas palustris strain was named CGA-Pd-OGSC.

[0076] (2) Cultivate the wild strain and the recombinant strain under anaerobic light conditions and extract protein samples to identify the expression of the fusion protein. Rhodopseudomonas palustris grows aerobically in ACY medium at 35 °C for 48 h, and the cell concentration is determined by measuring the absorbance of the bacterial solution at 660 nm using a UV spectrophotometer. Centrifuge to collect the bacteria and resuspend them in ACY medium, adjust the cell density to OD 660 nm = 0.2, and perform light anaerobic growth at 30 °C. Use a 30 mL syringe as the reactor, with a working volume of 10 mL. Drain the air in the syringe tube and seal it with a rubber stopper. Place a magnetic stir bar with a specification of 3 * 5 mm in the reactor and stir the bacterial solution using a magnetic stirrer at a rotation speed of 250 rpm. Control the light intensity at 1000 lux by adjusting the transformer voltage, and control the culture temperature at 30 °C using a water bath circulation system. Add kanamycin with a concentration of 10 μg / mL to the culture system of recombinant Rhodopseudomonas palustris CGA-Pd-OGSC.

[0077] After 4 days of light anaerobic culture, take 5 ml of the bacterial solution and obtain total protein samples using a total bacterial protein extraction kit (Sangon Biotech). Then, use a His-tag protein purification kit (Beyotime) to purify the target fusion protein from the total protein samples to obtain the purified fusion protein. Prepare 10% separating gel and 5% stacking gel and pour them into a Bio-rad protein electrophoresis gel plate. Mix the fusion protein with protein loading buffer and boil for 5 min for 10% SDS-PAGE analysis. Use Coomassie Brilliant Blue R-250 to fully stain the gel after electrophoresis, and then decolorize it with deionized water overnight. Take a photo and observe after the gel background is decolorized cleanly. Figure 5 Figure 10% SDS-PAGE analysis results of the fusion protein. The results show that the target fusion protein can be purified and extracted from the total protein samples of recombinant Rhodopseudomonas palustris CGA-Pd-OGSC, and obvious protein bands appear between 42 - 52 kDa, which is consistent with the size of the target fusion protein (47.3 kDa), proving the successful construction of recombinant Rhodopseudomonas palustris with surface-displayed CadR.

[0078] Example 3

[0079] Application of recombinant Rhodopseudomonas palustris strain with surface-displayed CadR

[0080] (1) Analyze the Cd2+ tolerance of each sample by comparing the maximum growth density of the wild strain and the recombinant strain in the medium containing Cd2+. Cultivate the wild strain and the recombinant strain under light anaerobic conditions according to the cultivation method in Example 2. Add CdCl2 to the culture system and adjust the Cd2+ concentrations to 0 mM, 2.5 mM, 5 mM, and 10 mM respectively. Perform light anaerobic culture at 30 °C until the growth plateau phase, and measure the absorbance of the bacterial solution at 660 nm using a UV spectrophotometer to compare the maximum growth density of each sample.Figure 6 shows the maximum growth density of wild and recombinant bacteria at different Cd2+ concentrations. The results show that 5 mM Cd2+ slightly inhibited the growth of CGA009, and the growth of CGA009 was severely inhibited under 10 mM Cd2+, with the maximum OD660 decreasing by 48.9% relative to 0 mM. There was no significant difference in the growth of CGA-Pd-OGSC in environments with different Cd2+ concentrations. This result indicates that surface-displaying the CadR protein can improve the tolerance of Rhodopseudomonas palustris to high concentrations of Cd2+.

[0081] (2) The heavy metal passivation ability of recombinant Rhodopseudomonas palustris was explored by detecting the residual amount of Cd2+ in the culture medium supernatant.

[0082] The seed solution of recombinant Rhodopseudomonas palustris was inoculated into ACY liquid medium and pre-cultured by shaking at 35, or 36, or 37 °C and 160, or 180, or 200 rpm for 48, or 60, or 72 h; the culture obtained from the pre-culture was inoculated into ACY liquid medium containing 1 mM Cd2+, and the bacterial density in the ACY liquid medium after inoculation was diluted and adjusted to OD 660nm of 0.1, or 0.2, or 0.5, and anaerobically cultured under light at 30 °C, or 35 °C, or 37 °C and 800, or 1000, or 1500 lux. Samples were taken every 12, or 18, or 24 h, and centrifuged at 8000 rpm, or 8500 rpm, or 9000 rpm for 3, or 4, or 5 min to collect the supernatant;

[0083] The supernatant was aspirated and diluted 1000 times, and the residual Cd2+ in the supernatant was detected using an inductively coupled plasma mass spectrometer (ICP-MS, PerkinElmer, NxeION 5000G), and the Cd2+ removal efficiency was calculated until the residual amount no longer decreased. The Cd2+ removal rate calculation formula is as follows:

[0084]

[0085] where E: Cd2+ removal efficiency; Ci: initial Cd2+ concentration in the culture solution, mg / L; Ce: residual Cd2+ concentration in the supernatant at adsorption equilibrium, mg / L. Figure 7 shows the residual concentration of Cd2+ in the culture medium supernatant, Figure 8It is the Cd2+ removal rate of wild bacteria and recombinant bacteria in the culture medium. The results showed that after the wild bacteria and recombinant bacteria grew to the stationary phase in the culture medium supplemented with 1 mM Cd2+, 46.4 mg / L Cd2+ remained in the supernatant of wild Rhodopseudomonas palustris CGA009, and the adsorption rate was only 56.3%. However, the residual amount in the supernatant of recombinant Rhodopseudomonas palustris CGA-Pd-OGSC was only 4.7 mg / L, and the adsorption rate reached 95.6%. This result indicates that surface-displaying CadR protein can significantly improve the heavy metal passivation effect of Rhodopseudomonas palustris, and this recombinant bacterium has the potential to be applied to the bioremediation of cadmium-polluted wastewater.

[0086] (3) To explore the Cd adsorption effect of recombinant Rhodopseudomonas palustris with surface-displayed CadR in real environmental samples, 5% of artificially simulated Cd-polluted wastewater was added to the ACY medium, and it was used for the light anaerobic culture and Cd2+ adsorption analysis of wild bacteria and recombinant bacteria. Every 24 h, 100 μL of the culture was taken, centrifuged at 9000 rpm for 4 min, the supernatant was aspirated and diluted 1000 times, and the residual Cd2+ in the supernatant was detected using an inductively coupled plasma mass spectrometer (ICP-MS, PerkinElmer, NxeION 5000G), and the Cd2+ removal efficiency was calculated. Figure 9 It shows the Cd2+ removal rate of wild bacteria and recombinant bacteria in Cd wastewater. The results indicate that the Cd2+ removal rate of wild Rhodopseudomonas palustris CGA009 is only 51.9%, while the recombinant Rhodopseudomonas palustris with surface-displayed CadR can remove 94.3% of Cd2+ in the wastewater, proving that this recombinant bacterium can stably play the adsorption function in the wastewater, and the complex components in the wastewater will not interfere with its Cd2+ adsorption performance. The recombinant Rhodopseudomonas palustris with surface-displayed CadR has wide practical applicability.

[0087] As described above, it is only a preferred embodiment of the present invention and does not impose any limitation on the present invention. Any simple modification, change, and equivalent structural change made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein, characterized in that, The recombinant Rhodopseudomonas palustris strain is Rhodopseudomonas palustris CGA-Pd-OGSC; the recombinant Rhodopseudomonas palustris strain is formed by introducing the Cd-specific binding protein CadR gene derived from Pseudomonas syringae DC3000 into Rhodopseudomonas palustris.

2. The recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein according to claim 1, characterized in that, The host of the Rhodopseudomonas palustris is the wild-type Rhodopseudomonas palustris CGA009.

3. The recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein according to claim 1, characterized in that, The recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein is obtained by successively fusing the Cd-specific binding protein CadR gene with a linker peptide and an anchor protein sequence, i.e., linking the gene fragments together; and then successively fusing them with the promoter and purification tag sequence in the expression cassette, and then introducing them into the Rhodopseudomonas palustris host.

4. A recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein according to claim 1, characterized in that, The nucleotide sequence of the Cd-specific binding protein CadR gene is optimized according to the codon preference of Rhodopseudomonas palustris.

5. A recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein according to claim 1, characterized in that, The linker peptide uses the flexible linker peptide (GGGGS)3, and the nucleotide sequence of the linker peptide is linked to the 5' end of the CadR gene.

6. A recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein according to claim 1, characterized in that, The gene of the anchor protein is derived from the outer membrane protein OmpA gene of Rhodopseudomonas palustris CGA009, and the nucleotide sequence of the anchor protein is linked to the 5' end of the linker peptide gene.

7. A recombinant Rhodopseudomonas palustris strain with surface-displayed Cd-specific binding protein according to claim 1, characterized in that, The promoter in the expression cassette is the promoter Pd of the pucBAd gene derived from Rhodopseudomonas palustris CGA009; the purification tag in the expression cassette is the protein purification tag His-tag, and the nucleotide sequence of the His-tag gene is optimized according to the codon preference of Rhodopseudomonas palustris, and the nucleotide sequence of the His-tag gene is linked to the 3' end of the CadR gene.

8. A method for constructing a recombinant Rhodopseudomonas palustris strain, characterized in that, Specifically, it includes the following steps: Step 1: Retrieve the CadR gene sequence of Pseudomonas syringae DC3000 and the OmpA gene sequence of Rhodopseudomonas palustris CGA009 in the database, and synthesize the OmpA sequence and the linker peptide (GGGGS)3, CadR, and His-tag gene sequences optimized according to the codon preference of Rhodopseudomonas palustris to obtain the fusion fragment OmpA-(GGGGS)3-CadR-His-tag; Step 2: Using the whole genome of Rhodopseudomonas palustris CGA009 as a template, amplify the promoter Pd of the pucBAd gene and its upstream homologous arm by PCR, and introduce restriction enzyme sites at both ends of the promoter Pd of the pucBAd gene and its upstream homologous arm; Step 3: Connect the promoter Pd of the pucBAd gene and its upstream homologous arm sequence to the 5' end of the fusion fragment OmpA-(GGGGS)3-CadR-His-tag obtained in Step 1 through the restriction enzyme sites to obtain the fusion fragment Pd-OmpA-(GGGGS)3-CadR-His-tag, and ligate it into a broad-host shuttle plasmid to obtain the recombinant plasmid pBBR-Pd-OGSC containing the fusion fragment; Step 4. Transform the recombinant plasmid containing the fusion fragment obtained in Step 3 into Rhodopseudomonas palustris CGA009 by triparental mating, and screen for recombinant Rhodopseudomonas palustris in a medium containing antibiotics. The antibiotics in the medium containing antibiotics include kanamycin or ampicillin medium.

9. The construction method of a recombinant Rhodopseudomonas palustris strain according to claim 8, characterized in that, The specific method of Step 4 is as follows: 4.

1. Pre-culture Escherichia coli S17-1 carrying the recombinant plasmid pBBR-Pd-OGSC obtained in Step 3 and helper bacteria pRK2013 / HB101 in 3-5 mL of LB medium containing antibiotics at a pre-culture temperature of 35-37 °C for 16-18 h. Pre-culture Rhodopseudomonas palustris CGA009 in 8-10 mL of ACY medium at 35-37 °C for 48-60 h. 4.

2. Centrifuge to collect the cells at a speed of 6000-8000 rpm for 8-10 min, then wash them 1-2 times with 8-10 mL of MedA medium, and centrifuge again at a speed of 6000-8000 rpm for 8-10 min. Resuspend Escherichia coli S17-1 carrying the recombinant plasmid pBBR-Pd-OGSC and helper bacteria pRK2013 / HB101 with 300-500 μL of MedA, and resuspend Rhodopseudomonas palustris with 800-1000 μL of MedA. 4.

3. Respectively pipette 20-30 μL of Escherichia coli S17-1 carrying the recombinant plasmid pBBR-Pd-OGSC, 20-30 μL of helper bacteria pRK2013 / HB101, and 80-100 μL of Rhodopseudomonas palustris CGA009, mix them evenly and spread them on a MedA plate to form a circular spot with a diameter of 2 ± 0.2 cm. 4.

4. After the circular spot dries, invert the plate and culture it at 35-37 °C for 24-36 h. Then, scrape the bacteria in the circular spot with 1-2 mL of MedA and a spreading rod, centrifuge at a speed of 6000-8000 rpm for 2-4 min to collect the bacteria, wash them 1-2 times with 1-2 mL of MedA medium, and centrifuge again at a speed of 6000-8000 rpm for 2-4 min. Then resuspend this mixed bacteria with 800-1000 μL of MedA. Pipette 80-100 μL of the resuspended solution and spread it on a MedA plate with kanamycin, and culture it inverted at 35-37 °C for 5-7 days. Pick the red single colonies grown on the plate and inoculate them into a MedA liquid medium containing antibiotics. After growing for 48-60 h, pipette 0.5-1 μL of the bacterial solution as a template for bacterial solution PCR amplification. Screen the bacterial solution that successfully amplifies the target band, freeze it at -80 °C, and purify and sequence the product of the bacterial solution PCR amplification using the bacterial solution as a template. The successfully constructed recombinant Rhodopseudomonas palustris strain is named CGA-Pd-OGSC.

10. A recombinant Rhodopseudomonas palustris strain is applied to heavy metal passivation, characterized in that, Recombinant Rhodopseudomonas palustris is fermented and cultured in a medium containing Cd 2+ to remove free Cd in the culture solution by the binding of CadR protein to Cd 2+ , and the specific steps are as follows: Step 1. Inoculate the seed solution of the recombinant Rhodopseudomonas palustris into ACY liquid medium, and perform pre-culture by shaking culture at 35-37 °C and 160-200 rpm for 48-72 h. Step 2: Inoculate the culture obtained from the pre-culture in Step 1 into the ACY liquid medium containing Cd 2+ , and dilute and adjust the bacterial density in the ACY liquid medium after inoculation to an OD 660nm of approximately 0.1 - 0.

5. Conduct light anaerobic culture at 30 - 37°C and 800 - 1500 lux. Sample every 12 - 24 h, centrifuge at 8000 - 9000 rpm for 3 - 5 min, and collect the supernatant; Step 3: Measure the residual concentration of Cd2+ in the supernatant until the residual amount no longer decreases.

Images