A molecular marker for breeding lean sheep and its application

Abstract

The present invention belongs to the field of genetic breeding technology and specifically relates to a molecular marker for breeding lean-meat sheep and its application. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and a single nucleotide mutation from C to T occurs at the 101st bp position of the molecular marker. The present invention provides a SNP locus and related molecular markers that affect the fat thickness ratio of sheep. By selecting individuals with the CC genotype as sires or dams, the fat thickness ratio of offspring can be reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic breeding, and in particular relates to a molecular marker for breeding lean-meat sheep and an application thereof. Background Art

[0002] The Suffolk, also known as the Suffolk, is a meat sheep breed originating in southeast England in the early 19th century. It is bred by crossing the South Downs sheep with the larger, leaner Black-faced Norfolk sheep as the female parent. This breed is characterized by its large size, early sexual maturity, rapid growth and development, excellent meat production, and strong adaptability. It has been introduced to several countries and primarily used as a sire line for fattening lamb production. Since its introduction from Australia in the 1980s, the core population of Suffolk sheep has been primarily distributed in Inner Mongolia and Xinjiang. It is cultivated for purebred breeding and extensively crossbred with local coarse-wool and fine-wool sheep to improve meat quality. Fat thickness, a key growth metric for Suffolk sheep, directly influences carcass lean meat percentage and fat distribution. A moderate fat thickness ensures juicy meat while preventing excessive fat accumulation that reduces economic value. In order to break through the bottleneck of growth rate and meat production performance of Suffolk sheep, it is urgent to analyze the molecular markers that regulate fat thickness ratio at the genomic level. Summary of the Invention

[0003] The purpose of the present invention is to provide a molecular marker for breeding lean-meat sheep, which is used to reduce the fat-to-meat thickness ratio of sheep and to breed lean-meat sheep.

[0004] The technical solution adopted in the present invention is:

[0005] The present invention provides a molecular marker for breeding lean sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. A single nucleotide C to T mutation occurs at the 101 bp site of the molecular marker.

[0006] The second aspect of the present invention provides the use of the molecular marker, which is used to identify the fat thickness ratio of sheep.

[0007] Preferably, the calculation formula for the fat-to-meat thickness ratio is:

[0008] ;

[0009] in, M : backfat thickness, unit: cm; B : psoas muscle thickness, unit: cm; N : Fat thickness ratio, unit: %.

[0010] Preferably, the method for identifying the fat thickness ratio of sheep comprises the following steps:

[0011] Extraction of sheep genomic DNA;

[0012] Using sheep genomic DNA as a template, detecting the genotype of the 101 bp site in the molecular marker;

[0013] If the genotype is CC, the sheep is determined to have a low fat thickness ratio; the low fat thickness ratio means that the fat thickness ratio is lower than 30.8%.

[0014] Preferably, the sheep genomic DNA is derived from sheep blood.

[0015] Preferably, the sheep genomic DNA is extracted using the phenol-chloroform method.

[0016] The third aspect of the present invention provides the application of the molecular marker, which is used for breeding lean sheep.

[0017] Preferably, the breeding of lean sheep refers to reducing the fat thickness ratio of sheep offspring by selecting sheep individuals with the genotype CC of the molecular marker as parents.

[0018] Preferably, the sheep are Suffolk sheep.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a molecular marker for breeding lean sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1. A single nucleotide mutation from C to T occurs at the 101st bp position of the molecular marker. The present invention also provides a SNP locus and related molecular markers that affect the fat thickness ratio of Suffolk sheep. By selecting individuals with the CC genotype as sires or dams, the fat thickness ratio of offspring can be reduced.

[0021] In addition, the present invention also achieves in-depth exploration of the genetic potential of the breed by screening relevant genetic loci, establishing a breeding technology system, and precisely regulating fat metabolism pathways, providing a scientific basis for breeding new low-fat and high-yield meat sheep breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the distribution diagram of SNPs in the 1Mb window of chromosome after quality control.

[0023] Figure 2 Principal component analysis diagram.

[0024] Figure 3 This is a visualization diagram of the G matrix.

[0025] Figure 4 The GWAS results of Suffolk sheep backfat thickness are reflected in the Manhattan plot.

[0026] Figure 5 The GWAS results of Suffolk sheep backfat thickness reflected in the QQ plot. DETAILED DESCRIPTION

[0027] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0028] The inventive concept of the present invention is as follows:

[0029] Backfat thickness and meat quality are important indicators for measuring sheep production performance and meat quality. Through reasonable breeding, sheep production efficiency and meat quality can be effectively improved.

[0030] Fat-to-fat ratio (FTT) is a core growth trait in Suffolk sheep, directly impacting carcass leanness and fat distribution. A moderate FTT ensures juicy meat while preventing excessive fat accumulation that reduces economic value. To overcome the bottlenecks in growth rate and meat production in Suffolk sheep, there is an urgent need to identify molecular markers regulating FTT at the genomic level.

[0031] Based on this, the present invention provides a molecular marker for breeding lean sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and a single nucleotide C to T mutation occurs at the 101 bp site of the molecular marker.

[0032] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.

[0033] The abbreviations of the present invention are shown in Table 1.

[0034] Table 1 Abbreviations of the present invention

[0035]

[0036] The experimental animals and phenotype sources of the present invention are as follows:

[0037] The experimental sheep of the present invention were all from Siziwang Banner Sino Sheep Breeding Technology Co., Ltd. in Inner Mongolia Autonomous Region. The fat thickness ratio phenotype was measured and recorded from 2020 to 2024, as shown in Table 2.

[0038] Blood samples were collected from 300 Suffolk sheep, stored in anticoagulant tubes and placed in a -80°C refrigerator in the laboratory for DNA extraction.

[0039] Table 2 Description of body weight traits of Suffolk sheep

[0040]

[0041] Example

[0042] A molecular marker for breeding lean sheep and its application, as follows:

[0043] 1. Genomic DNA extraction and quality inspection.

[0044] DNA was extracted from blood samples using the phenol-chloroform method, and DNA concentration was measured using a NanoDrop 2000 spectrophotometer. The absorption wavelength ratio of the highest absorption peak at 260 nm / 280 nm was calculated to measure the content of DNA and protein phenolic substances. The absorption wavelength ratio of the highest absorption peak at 260 nm / 230 nm was calculated to measure the content of DNA and carbohydrates. DNA quality was evaluated using 1% agarose gel.

[0045] 2. Library construction and sequencing.

[0046] Qualified genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments were then subjected to end-repair, poly(A) addition, sequencing adapters, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and the effective concentration of the library was accurately quantified using qPCR to ensure library quality. After passing the library quality test, sequencing was performed using the BGI-T7 sequencing platform in PE150 mode.

[0047] 3. Identification, screening and annotation of variant sites.

[0048] Fastp software version V0.20.0 was used to filter raw reads data into clean reads data, and a genome index was established for the reference genome. The quality-controlled clean reads data were aligned with the sheep reference genome using Burrows-Wheeler Aligner software version V0.7.17. The aligned sam files were converted into bam files using SAMtools software version V1.8-20, and the bam files were sorted. The MarkDuplicates program in the Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and the HaplotypeCaller module in the GATK software was used to detect SNP variations. After obtaining the vcf file, it was filtered using the VariantFiltration module. The ANNOVAR software package is used to perform functional annotation on the detected genetic variants. Based on the location of the variant site on the reference genome and the gene location information on the reference genome, the region where the variant site occurs in the genome and the impact of the variant, such as synonymous mutations or non-synonymous mutations, can be obtained.

[0049] The reference genome of sheep used in the present invention is Oar_v4.0, GCF_000298735.2.

[0050] 4. Data quality control and group stratification correction.

[0051] Whole-genome resequencing was performed on 300 Suffolk sheep to establish a genotype database, generating a total raw read size of 17,243.32 Gb and obtaining a total of 47,506,993 SNPs. The genotyping data were quality-controlled using Plink software version 1.90. Individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and SNPs with a Hardy-Weinberg equilibrium (HWE) test P value of less than 10 were excluded. -6 A total of 20,182,599 high-quality SNPs were identified in the Suffolk population. These sites were evenly distributed on the 26 pairs of autosomes in sheep, such as Figure 1 shown. Figure 1 The middle left Y-axis represents the chromosome name, and the upper X-axis represents the window size.

[0052] The first three principal components were calculated using the "--pca 3" parameter of Plink software. PCA was plotted using R V3.6.0. The results are shown in the figure below. Figure 2As shown in the figure, there is population stratification in the experimental samples and the genetic correlation between individuals is high. The first three principal components need to be used as covariates to correct the population stratification phenomenon of Suffolk sheep.

[0053] The genome kinship analysis of the population was performed based on the G matrix using Plink v1.90. The results are as follows Figure 3 As shown, this indicates that the average relatedness between Suffolk sheep individuals is relatively distant. Figure 3 In the figure, each small square represents the kinship value between samples. The smaller the value is, the closer it is to light green, that is, the more distant the kinship between the two individuals, and vice versa.

[0054] 5. Genome-wide association analysis.

[0055] The association analysis between SNP and body weight traits was performed using the fastGWA-mlm model in the GCTA V1.94.0beta software. The formula is as follows.

[0056] ;

[0057] in, y is an n × 1 phenotypic vector, where n is the number of individuals; X snp is a genotype vector whose effects are β snp ; X c is the correlation matrix with gender and the first three PCAs as fixed covariates, and the corresponding coefficients are β c ; g is the vector of total genetic effects captured by the SNP-derived genetic relationship matrix, g~N(0, );π is the genetic relationship matrix vector derived from SNPs, where all off-diagonal elements are set to 0, : genetic variance; e is the residual vector, e ~N(0, ), is the identity matrix, is the residual variance.

[0058] Because the Bonferroni correction method of 0.05 / SNP number is too strict to determine the significance threshold of GWAS, independent SNPs are obtained through linkage disequilibrium (LD) screening to remove redundancy and use them to calculate the threshold. The parameters are:

[0059] 50: window size, number of SNPs;

[0060] 10: step length, number of SNPs;

[0061] 0.2:r 2 value, remove one of the SNP pairs with LD greater than 0.2.

[0062] The present invention adjusts the threshold of genome-wide significant association to P=1 / 620054, where 620054 is the number of independent SNPs screened by LD. The genomic expansion factor λ of the test statistic is calculated by the slope of the linear regression between the observed quantile and the theoretical quantile in R V3.6.0. After calculation, the λ value of the fat thickness ratio trait is 0.901, indicating that there is no genome expansion. Based on the resequencing data of 300 Suffolk sheep, 14 significant SNP sites associated with the fat thickness ratio trait were detected. These sites are located on chromosomes 6, 7, 12, 13, and 14, respectively, as shown in Table 3. Figure 4 and Figure 5 shown.

[0063] Table 3 Significant SNPs associated with fat thickness ratio

[0064]

[0065] 6. SNPs affecting the fat thickness ratio trait of Suffolk sheep.

[0066] Further verification of the above SNPs that reached the genome-wide significance level revealed that the C→T mutation at position 9451208 on chromosome 14 of the Suffolk sheep genome can significantly affect the fat thickness ratio trait of Suffolk sheep.

[0067] The association analysis between the SNP locus 9451208 on chromosome 14 of the Suffolk sheep genome and the fat thickness ratio trait is shown in Table 4.

[0068] Table 4 Polymorphisms at position 9451208 on chromosome 14 of Suffolk sheep genome

[0069]

[0070] Note: In Table 4, different lowercase letters in a column of fat thickness ratio indicate significant differences. P <0.05; the same letter indicates no significant difference. P >0.05.

[0071] As shown in Table 4, for individuals with CC genotype, their fat-to-meat thickness ratio is the smallest.

[0072] In a genome-wide association analysis, the SNP marker at position 9451208 on chromosome 14 of the Suffolk sheep genome reached genome-wide significance, indicating that this marker is significantly associated with the fat thickness ratio trait in Suffolk sheep. Furthermore, when the base of this marker is C, it favors Suffolk sheep with the smallest fat thickness ratio. The gene frequency and genotype frequency of the SNP at position 9451208 on chromosome 14 of the Suffolk sheep genome were subsequently calculated, as shown in Table 5.

[0073] Table 5 SNP gene frequency and genotype frequency at position 9451208 on chromosome 14 of Suffolk sheep genome

[0074]

[0075] The nucleotide sequence of the molecular marker comprising the C→T mutation site at position 9451208 on chromosome 14 of the present invention is shown in SEQ ID NO.1.

[0076] SEQ ID NO.1:

[0077] AACCCCACAGTAGAAGCCACTCCTCTCAGGGCCGTCCCTTCATCCCCACCAGTGTCTGGGCTGAGTGGCCTTTCCTTTGCAATAACCGCAGCTCTCTTCCTGTCCCCATCTCAGTCTCCTGAAATCTTCTGACATCACCTCGGAATTTCCTAGCGCCAGATTTGTCTCCCTTTATTTGTCGCTACTCTCTAGCACAGTG.

[0078] SEQ ID NO.1 shows the sequence of 100 bp upstream and downstream of the mutation site, with the bold portion being the mutation site, and the bold portion being C or T.

[0079] It can be seen from this that the Suffolk sheep breed with the minimum fat thickness ratio can be bred through the T→C mutation at position 9451208 on chromosome 14 of the Suffolk sheep genome, and the fat thickness ratio of Suffolk sheep offspring can be reduced by selecting individuals with the CC genotype as the father or mother.

[0080] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0081] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0082] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. An application of a sheep molecular marker typing detection reagent, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, and a single nucleotide mutation from C to T occurs at the 101 bp position of the molecular marker; The application is any one of the following: 1) Determine the fat to meat thickness ratio of sheep; 2) Breeding lean sheep; The sheep are Suffolk sheep.

2. The use according to claim 1, characterized in that The calculation formula of the fat thickness ratio is: ； in, M : backfat thickness, unit: cm; B : psoas muscle thickness, unit: cm; N : Fat thickness ratio, unit: %.

3. The use according to claim 1, characterized in that The method for identifying the fat thickness ratio of sheep comprises the following steps: Extraction of sheep genomic DNA; Using sheep genomic DNA as a template, detecting the genotype of the 101 bp site in the molecular marker; If the genotype is CC, the sheep is determined to have a low fat thickness ratio; the low fat thickness ratio means that the fat thickness ratio is lower than 30.8%.

4. The use according to claim 3, characterized in that The sheep genomic DNA is derived from sheep blood.

5. The use according to claim 4, characterized in that The sheep genomic DNA is extracted using the phenol-chloroform method.

6. The use according to claim 1, wherein The breeding of lean sheep refers to reducing the fat thickness ratio of sheep offspring by selecting sheep individuals with a genotype of CC at the 101bp site of the molecular marker as parents.

Images