Application of molecular marker related to daily gain character of sheep before weaning
By identifying and utilizing molecular markers related to pre-weaning weight gain in sheep, the problem of declining genetic diversity in Suffolk sheep has been solved, enabling accurate identification of pre-weaning weight gain traits and improvement of offspring performance, thus promoting the genetic improvement and breeding of Suffolk sheep.
Patent Information
- Application Number
- CN202610179015.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-09
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2046-02-09
AI Technical Summary
In the current technology, the core population of Suffolk sheep is limited in size. Some groups have experienced a decline in genetic diversity and production performance due to long-term closed breeding. It is difficult to identify and screen for pre-weaning weight gain traits, which affects slaughter efficiency and breeding benefits.
We developed molecular markers associated with pre-weaning weight gain in sheep, identified SNP loci affecting pre-weaning weight gain through genome sequencing and genome-wide association analysis, and used individuals with the CC genotype for breeding to improve the pre-weaning weight gain of offspring.
It enabled accurate identification and screening of pre-weaning weight gain traits in sheep, improved the pre-weaning weight gain of Suffolk sheep offspring, and promoted genetic improvement and precision breeding.
Smart Images

Figure CN121674587A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a molecular marker related to the pre-weaning weight gain trait in sheep. Background Technology
[0002] Suffolk sheep are a well-known large meat sheep breed, developed through crossbreeding with the large, muscular black-headed horned Norfolk sheep. Suffolk sheep are characterized by rapid growth, high dressing percentage, and excellent meat quality, which helps shorten the feeding cycle, improve feed conversion efficiency, and thus increase the economic benefits of raising them.
[0003] With the continued growth in market demand for high-quality mutton, Suffolk sheep have shown promising application prospects in high-end mutton production. However, the core Suffolk sheep population in China is currently limited in size, and some groups have experienced increased inbreeding due to long-term closed breeding, leading to problems such as decreased genetic diversity and declining production performance. Pre-weaning weight gain is a key indicator reflecting the early growth rate of lambs, directly affecting slaughter efficiency and breeding profitability.
[0004] Therefore, in order to further improve the growth performance of Suffolk sheep, it is urgent to develop a new technology that can accurately identify and screen the genetic potential related to pre-weaning weight gain traits at an early stage. This is of great significance for accelerating the genetic improvement process and achieving precise breeding. Summary of the Invention
[0005] To address the above problems, this invention provides an application of molecular markers related to pre-weaning weight gain traits in sheep, which can be used to identify pre-weaning weight gain traits in sheep and to select sheep with high pre-weaning weight gain.
[0006] This invention is achieved through the following technical solution: Application of a molecular marker associated with pre-weaning weight gain traits in sheep, wherein the molecular marker is at least one of the following ① to ②: ①The nucleotide sequence shown in SEQ ID NO.1 has a nucleotide sequence of T or C at the 101 bp site.
[0007] ②The nucleotide sequence shown in SEQ ID NO.3 has a nucleotide sequence of T or C at the 101 bp site.
[0008] The application refers to any one of the following (1) and (2): (1) Identify the weight gain of sheep the day before weaning.
[0009] (2) Improve the pre-weaning weight gain of sheep offspring.
[0010] Preferably, the method for identifying the weight gain traits of sheep on the day before weaning is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.
[0011] Determine the genotype of the sheep at the 101 bp site of SEQ ID NO.1 or SEQ ID NO.3.
[0012] If the genotype is at least one of A) to B), then the sheep has a pre-weaning daily weight gain, which means a pre-weaning daily weight gain greater than 0.39 kg / d.
[0013] A) The genotype at 101bp of SEQ ID NO.1 is CC.
[0014] B) The genotype at 101bp of SEQ ID NO.3 is CC.
[0015] Preferably, the method for increasing the weight gain of sheep offspring on the day before weaning is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.
[0016] Determine the genotype of the sheep at the 101 bp site of SEQ ID NO.1 or SEQ ID NO.3.
[0017] By selecting sheep individuals carrying at least one of the genotypes shown in a) to b) as parents for breeding, it is possible to improve the pre-weaning weight gain of sheep offspring.
[0018] a) The genotype at 101bp of SEQ ID NO.1 is CC.
[0019] b) The genotype at 101bp of SEQ ID NO.3 is CC.
[0020] Preferably, the genomic DNA is derived from sheep blood.
[0021] Preferably, the genomic DNA is extracted using the phenol-chloroform method.
[0022] Preferably, the sheep is a Suffolk sheep.
[0023] Compared with the prior art, the present invention has the following beneficial effects: This invention relates to the application of a molecular marker associated with pre-weaning weight gain traits in sheep, wherein the molecular marker is at least one of the following ① to ②: ① The nucleotide sequence shown in SEQ ID NO.1, wherein the nucleotide sequence at the 101 bp site is T or C. ② The nucleotide sequence shown in SEQ ID NO.3, wherein the nucleotide sequence at the 101 bp site is T or C. The application refers to any one of the following (1) and (2):
[0024] (1) Identifying the pre-weaning weight gain in sheep. (2) Improving the pre-weaning weight gain in sheep offspring. This invention uses methods such as genome sequencing, identification of variant sites, and genome-wide association analysis to screen molecular markers that affect the pre-weaning weight gain trait in sheep. By detecting the genotype of the molecular markers, the pre-weaning weight gain trait in sheep is identified. By selecting individuals with the CC genotype as the paternal or maternal parent, the pre-weaning weight gain of offspring can be improved. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 This is a distribution diagram of SNPs after quality control in a 1Mb window of chromosomes. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.
[0027] Figure 2 This is a visualization of the G matrix of the present invention.
[0028] Figure 3 The principal component analysis plot of this invention uses the first three explained variance percentages PC1, PC2, and PC3 as the X, Y, and Z axes.
[0029] Figure 4 The Manhattan Plots and QQ-plots of this invention show the GWAS results of pre-weaning weight gain in Suffolk sheep, with significant genome-wide SNPs shown in red; A is the Manhattan plot of pre-weaning weight gain in Suffolk sheep; B is the QQ plot of pre-weaning weight gain in Suffolk sheep. Detailed Implementation
[0030] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0031] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0032] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0033] The following is a list of abbreviations related to this invention: LD: Linkage Disequilibrium.
[0034] Manhattan Plot.
[0035] QQ chart: Quantile-Quantile Plot.
[0036] SNP: Single nucleotide polymorphism.
[0037] GWAS: Genome-wide association analysis.
[0038] IBS: Identity-by-State.
[0039] Example 1 Test animals and phenotypic sources: All sheep used in this study were from Inner Mongolia Sainuo Sheep Breeding Technology Co., Ltd. Phenotypic records of daily weight gain before weaning in Suffolk sheep from 2020 to 2024 were measured and are shown in Table 1. Blood samples were collected from 300 individual Suffolk sheep. All samples were immediately stored at -80℃ after collection and transported to the laboratory on dry ice for long-term storage at -80℃.
[0040] Table 1. Description of weight gain traits in Suffolk sheep the day before weaning.
[0041] I. Genomic DNA Extraction and Quality Inspection DNA was extracted from blood samples using the phenol-chloroform method. The concentration of DNA, the ratio of the absorption wavelengths of the highest absorption peaks of nucleic acids, proteins, and phenolic substances (260 nm / 280 nm), and the ratio of the absorption wavelengths of the highest absorption peaks of carbohydrates (260 nm / 230 nm) were measured using a NanoDrop2000 spectrophotometer. DNA quality was assessed by 1% w / v agarose gel electrophoresis.
[0042] II. Library Construction and Sequencing After processing qualified genomic DNA samples, the genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly A addition, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation process. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.
[0043] III. Identification, screening, and annotation of variant sites The raw sequencing data was quality controlled and preprocessed using FastP software version V0.20.0 to obtain Clean reads. A genome index was built on the reference genome. The quality-controlled Clean reads were aligned with the sheep reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version V0.7.17. The aligned SAM files were converted into BAM files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted BAM files to obtain the final BAM files. An index was built on the final BAM files, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. After obtaining the VCF files, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on detected gene variations. Based on the location of the variant site on the reference genome and the gene location information on the reference genome, the region in which the variant site occurs in the genome, such as intergenic regions, intronic regions, or CDS regions, can be determined, as well as the impact of the variation, such as synonymous and non-synonymous mutations.
[0044] IV. Data quality control and population stratification correction The detection rate is called the call rate; the minimum allele frequency is called the MAF; and the Hardy-Weinberg equilibrium is called the HWE.
[0045] Whole-genome resequencing was performed on 300 Suffolk sheep individuals to establish a genotype database, generating a total of 17243.32 Gb of raw reads and identifying 47,506,993 SNPs. The genotyping data were quality controlled using Plink software version 1.90, removing individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and SNPs with a Hardy-Weinberg equilibrium p-value of less than 10. -6 In the Suffolk population, a total of 20,182,599 high-quality SNPs were identified. These loci were evenly distributed across the 26 pairs of autosomes in sheep. Figure 1 As shown.
[0046] Genomic phylogenetic analysis based on the G matrix was performed on this population using Plink v1.90, and the results are as follows: Figure 2 As shown, Figure 2 Each small square in the diagram represents the pairwise kinship value between the first and last samples. The smaller the value, the closer it is to light green, indicating a more distant kinship between the two individuals, and vice versa. The results show that the average kinship between Suffolk sheep individuals is relatively distant. The first three principal components were calculated using the "--pca3" parameter in Plink software version 1.90. The PCA plot was then drawn using R version 3.6.0, and the results are shown below. Figure 3 As shown, the experimental sample exhibits population stratification and a high degree of genetic correlation among individuals. Therefore, the first three principal components need to be used as covariates to correct for the population stratification phenomenon in Suffolk sheep.
[0047] V. Genome-wide association analysis Association analysis between SNPs and pre-weaning daily weight gain traits was performed using the fastGWA-mlm model in GCTA software version V1.94.0beta.
[0048] y=X snp β snp +X c β c +g+e.
[0049] Where y is the phenotypic vector; X snp It is a genotype vector, and its effect is β. snp ;X c This is the correlation matrix of the first three PCA variables with fixed covariates, and its corresponding coefficient is β. c ;g is the vector of total genetic effects captured by the genetic relationship matrix derived from SNPs, g~N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).
[0050] Using the Bonferroni correction method of 0.05 / number of SNPs to determine the significance threshold of GWAS is too stringent. Instead, a linkage disequilibrium screening process is used to remove redundancy, resulting in independent SNPs, which are then used to calculate the threshold.
[0051] The parameter is 200: window size, i.e., the number of SNPs.
[0052] 50: Step length, i.e., the number of SNPs.
[0053] 0.2: r 2 Delete one of the SNP pairs where LD is greater than 0.2.
[0054] This invention adjusts the threshold for genome-wide significant association to P=1 / 620054, where 620054 is the number of independent SNPs screened by LD. The genome expansion factor, λ, is calculated using the slope of a linear regression between observed quantiles and theoretical quantiles in R version V3.6.0. The calculated λ value for the pre-weaning daily weight gain trait is 1.060, indicating no genome expansion. Based on resequencing data from 300 Suffolk sheep, 18 significant SNP loci associated with the pre-weaning daily weight gain trait were detected. These loci are located on chromosomes 1, 5, 7, 9, 12, 13, 15, 16, 19, and 20, as shown in Table 2. Figure 4 As shown.
[0055] Table 2. Significant SNP loci associated with pre-weaning weight gain traits.
[0056] VI. SNPs affecting pre-weaning weight gain in Suffolk sheep Further investigation of SNPs that reached genome-wide significance revealed that the T→C mutation at position 1906616 on chromosome 9 of the Suffolk sheep genome can significantly affect the pre-weaning daily weight gain trait in Suffolk sheep.
[0057] Association analysis was performed on the SNP locus at position 1906616 on chromosome 9 of the Suffolk sheep genome with pre-weaning weight gain trait. The results are shown in Table 3. Table 3. Polymorphism at position 1906616 on chromosome 9 of the Suffolk sheep genome.
[0058] Note: Different lowercase letters indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.
[0059] As shown in Table 3, individuals with the CC genotype had the greatest weight gain the day before weaning, while individuals with the TT genotype had the smallest weight gain the day before weaning.
[0060] In the genome-wide association analysis, the SNP molecular marker at position 1906616 on chromosome 9 of the Suffolk sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the pre-weaning weight gain trait of Suffolk sheep. Furthermore, when the molecular marker base is C, it is beneficial for Suffolk sheep to have a larger pre-weaning weight gain, which is greater than 0.39 kg.
[0061] Subsequently, the frequency of the SNP gene and genotype at position 1906616 on chromosome 9 of the Suffolk sheep genome were analyzed, as shown in Table 4.
[0062] Table 4. Frequency of SNP gene and genotype at position 1906616 on chromosome 9 of the Suffolk sheep genome.
[0063] The nucleotide sequence of the molecular marker containing the T→C mutation site at position 1906616 on chromosome 9 is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0064] SEQ ID NO.1: ACCACATAACATTGTAAATCAACTGTACTTCAATAAAATAAAGTAATAAAAGAATTACTCCTGTAAGCCATACTTTCTGCTTCTACACTGTGTTTATACTTGACATTTACATTTGTATCACTGAAACTAAATATTGCAAAAATAATATTATCTTTAGTTCTTTCTGTGAATGCAGACAGAAAAATCAGGTTCAGAAGAAA.
[0065] SEQ ID NO.2: ACCACATAACATTGTAAATCAACTGTACTTCAATAAAATAAAGTAATAAAAGAATTACTCCTGTAAGCCATACTTTCTGCTTCTACACTGTGTTTATACCTGACATTTACATTTGTATCACTGAAACTAAATATTGCAAAAATAATATTATCTTTAGTTCTTTCTGTGAATGCAGACAGAAAAATCAGGTTCAGAAGAAA.
[0066] Further investigation of SNPs that reached genome-wide significance revealed that the T→C mutation at position 54510547 on chromosome 12 of the Suffolk sheep genome can significantly affect the pre-weaning daily weight gain trait in Suffolk sheep.
[0067] The association analysis between the SNP locus at position 54510547 on chromosome 12 of the Suffolk sheep genome and the pre-weaning daily weight gain trait is as follows: Table 5. Polymorphism at position 54510547 on chromosome 12 of the Suffolk sheep genome.
[0068] Note: Different lowercase letters indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.
[0069] As shown in Table 5, individuals with the CC genotype had the greatest weight gain the day before weaning, while individuals with the TT genotype had the smallest weight gain the day before weaning.
[0070] In the genome-wide association analysis, the SNP molecular marker at position 54510547 on chromosome 12 of the Suffolk sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the pre-weaning weight gain trait of Suffolk sheep. Furthermore, when the molecular marker base is C, it is beneficial for Suffolk sheep to have a larger pre-weaning weight gain, which is greater than 0.45 kg.
[0071] Table 6. Frequency of SNP gene and genotype at position 54510547 on chromosome 12 of the Suffolk sheep genome.
[0072] The nucleotide sequence of the molecular marker containing the T→C mutation site at position 54510547 on chromosome 12 is shown in SEQ ID NO.3 and SEQ ID NO.4.
[0073] SEQ ID NO.3: TAGGAAGCGGGAGGTAGGAGCATTGATCAGGGGAACTCAGAGTGGACCCTGAGGGTCCAGAGGATCTGGACATCCTACCCAATAGCCTGGGAGGGGGTTCTGTCCACCTTTAATTACACTGTCTTTCCTGTTTTCTGCTTCAGCCCTCCTGAGGCTCCCATAACTGGGTCAGAGAATATTGTCCCCTGTCTCCTGACGCCA.
[0074] SEQ ID NO.4: TAGGAAGCGGGAGGTAGGAGCATTGATCAGGGGAACTCAGAGTGGACCCTGAGGGTCCAGAGGATCTGGACATCCTACCCAATAGCCTGGGAGGGGGTTCCGTCCACCTTTAATTACACTGTCTTTCCTGTTTTCTGCTTCAGCCCTCCTGAGGCTCCCATAACTGGGTCAGAGAATATTGTCCCCTGTCTCCTGACGCCA.
[0075] Therefore, it is evident that Suffolk sheep breeds with high pre-weaning weight gain can be bred by using the T→C mutation at position 1906616 on chromosome 9 of the Suffolk sheep genome, and / or by using the T→C mutation at position 54510547 on chromosome 12 of the Suffolk sheep genome. Individuals with the CC genotype can be selected as the paternal or maternal line to improve the pre-weaning weight gain of Suffolk sheep offspring.
[0076] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0077] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0078] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.
Claims
1. Use of a molecular marker associated with pre-weaning daily gain trait in sheep, characterized in that, The molecular marker is at least one of the following ①~②: ① The nucleotide sequence shown in SEQ ID NO. 1, the nucleotide sequence at the 101bp site is T or C; ② The nucleotide sequence shown in SEQ ID NO. 3, the nucleotide sequence at the 101bp site is T or C; The application refers to any one of the following (1) and (2): (1) Identifying the pre-weaning daily gain of sheep; (2) Improving the pre-weaning daily gain of sheep offspring.
2. Use according to claim 1, wherein The method for identifying the pre-weaning daily gain of sheep is as follows: Extracting the genomic DNA of the sheep to be tested for sequencing; Determining the genotype of the sheep at the 101bp site of SEQ ID NO. 1 or SEQ ID NO. 3; If the genotype is at least one of the following A)~B), the sheep is pre-weaning daily gain, which refers to the pre-weaning daily gain value greater than 0.39kg / d; A) The genotype at the 101bp site of SEQ ID NO. 1 is CC; B) The genotype at the 101bp site of SEQ ID NO. 3 is CC.
3. The use according to claim 1, wherein The method for improving the pre-weaning daily gain of sheep offspring is as follows: Extracting the genomic DNA of the sheep to be tested for sequencing; Determining the genotype of the sheep at the 101bp site of SEQ ID NO. 1 or SEQ ID NO. 3; Selecting the sheep individuals carrying at least one of the genotypes shown in a)~b) as parents for breeding, which can improve the pre-weaning daily gain of sheep offspring; a) The genotype at the 101bp site of SEQ ID NO. 1 is CC; b) The genotype at the 101bp site of SEQ ID NO. 3 is CC.
4. Use according to claim 2 or claim 3, wherein the compound is of formula (I) ###0001### (I) or a pharmaceutically acceptable salt thereof. The genomic DNA is derived from the blood of sheep.
5. The use as claimed in claim 2 or claim 3, wherein, The extraction method of the genomic DNA is phenol chloroform method.
6. The use according to claim 1, wherein The sheep is Suffolk sheep.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) marker influencing early growth traits of down producing goats and application of SNP marker
CN118726617A
Molecular marker influencing sheep weight traits and application thereof
CN120464759A
Sheep single nucleotide polymorphism (SNP) molecular marker and use thereof in detecting resistance to brucellosis in sheep
US20250122583A1
Molecular marker related to body weight traits of hu sheep and application
US20250333798A1
Cited By
Application of haplotype molecular marker related to mutton sheep weight traits
CN121951086A
Application of molecular marker influencing sheep body length character
CN122060874A