Haploid molecular marker influencing sheep lumbar muscle thickness character and application

By detecting the genomic DNA of sheep, identifying haplotypes at CELF4-SNP1 and CELF4-SNP2 sites, and screening out haplotype molecular markers that affect the thickness of the lumbar muscle of Suffolk sheep, solving the problem of insufficient purebred resources of Suffolk sheep, and effectively identifying and enhancing the thickness traits of the lumbar muscle.

CN120464757AActive Publication Date: 2025-08-12INNER MONGOLIA AGRICULTURAL UNIVERSITY

Patent Information

Application Number
CN202510968985.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-15
Publication Date
2025-08-12
Estimated Expiration
2045-07-15

AI Technical Summary

Technical Problem

Currently, Suffolk sheep purebred resources in my country are insufficient, and some populations have inbreeding declines, which affects genetic diversity and lacks effective genomic association analysis methods to improve the thickness of lumbar muscles of Suffolk sheep.

Method used

By detecting the genomic DNA of sheep, we identified haplotypes at two sites, CELF4-SNP1 and CELF4-SNP2, and using genome-wide association analysis, we screened out haplotype molecular markers that affect the thickness of the lumbar muscle of Suffolk, and selected GGGG haplotype combination individuals as parents to increase the thickness of the lumbar muscle of offspring.

Benefits of technology

Effective identification and enhancement of the thickness of the lumbar muscle of Suffolk sheep was achieved, the thickness of the lumbar muscle of the offspring was improved, and the problem of insufficient purebred resources of Suffolk sheep was solved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464757A_ABST
    Figure CN120464757A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic breeding, and particularly relates to a haplotype molecular marker influencing the sheep lumbar muscle thickness character and application, and the haplotype molecular marker comprises two sites CELF4-SNP1-CELF4-SNP2; wherein the position of the gene where CELF4-SNP1 is located is that mutation from G to C occurs at 101bp of a nucleotide sequence as shown in SEQ ID NO.1; the position of the gene where CELF4-SNP2 is located is that mutation from G to C occurs at 101bp of the nucleotide sequence as shown in SEQ ID NO.2. The haplotype molecular marker can be used for identifying the lumbar muscle thickness character of sheep, and the lumbar muscle thickness of offspring is increased by selecting an individual of which the haplotype combination is GGGG as a male parent or a female parent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic breeding, and in particular to a haplotype molecular marker affecting sheep loin muscle thickness traits and an application thereof. Background Art

[0002] The Suffolk sheep is one of the world's most renowned meat sheep breeds, renowned for its exceptional meat production and adaptability. With increasing consumer demand for high-quality lamb, high-end Suffolk meat products hold a promising market. However, my country currently faces a shortage of purebred Suffolk sheep, with some populations experiencing inbreeding depression, impacting genetic diversity.

[0003] Body weight is a key indicator of Suffolk sheep carcass quality, reflecting overall growth and development. To further improve meat production in Suffolk sheep, it is crucial to identify haplotypes that influence this trait through genome-wide association analysis. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides a haplotype molecular marker affecting the psoas muscle thickness trait of sheep and its application, which is used to identify the psoas muscle thickness trait of Suffolk sheep and breed Suffolk sheep with thicker psoas muscles.

[0005] The present invention is achieved through the following technical solutions: In a first aspect, the present invention provides a haplotype molecular marker that affects the thickness of sheep psoas muscle, wherein the haplotype molecular marker comprises CELF4 -SNP1~ CELF4 -SNP2 has 2 sites in total.

[0006] in, CELF4 - The gene location of SNP1 is 101 bp in the nucleotide sequence shown in SEQ ID NO. 1, where a mutation from G to C occurs. The nucleotide sequence shown in SEQ ID NO. 1 is the 100 bp before and after the mutation site.

[0007] CELF4 - The gene location of SNP2 is 101 bp in the nucleotide sequence shown in SEQ ID NO. 2, where a mutation from G to C occurs. The nucleotide sequence shown in SEQ ID NO. 2 is the 100 bp before and after the mutation site.

[0008] The nucleotide sequences of SEQ ID NO. 1 are as follows: GGCACCAGTGGTATGAATGAGCACAGAAGAGGCAGTTATGGGATAAAAGGCTGCAGAAGGAGGAGCCCAGAAAAGTGACAGGTAGGATACGTTGACTAGG[G / C]TTGTTGAGTGATGGATACTGGAGTTGCCTCTCAAATGTTACCACTTTTTCTTTCTACAAACAGAATCAGAATGTAATTTGTGGATACAATGCACTCAGTT.

[0009] The nucleotide sequences of SEQ ID NO. 2 are as follows: TCCAGACAATTTTTTTTTTTTTTTGCAGGAAAGGCAAAAGGCCTGAAATCGCTATTTCATGGGAAAGAACCATCCTCAGACATGTCCTAATATAGAAT[G / C]AGTTCTTCCTGGTGATTCTTCTCCAGCTACTGACAAGGAAAGAGACTTATTCAATGCTGGAGCCACTGATCCATGTCTCTGCTGGAGCCTGAGATGGTGC.

[0010] In a second aspect of my invention, I provide the use of haplotype molecular markers that affect the sheep psoas muscle thickness trait in identifying the sheep psoas muscle thickness trait.

[0011] Preferably, the identification of sheep psoas muscle thickness comprises the following steps: Extract genomic DNA from sheep blood.

[0012] The genomic DNA is fragmented to obtain DNA fragments, and then a library is constructed using the DNA fragments. The library is sequenced to obtain sequencing data.

[0013] The sequencing data were used to identify and screen the variant sites, and the haplotype molecular markers of sheep were detected using genome-wide association analysis. CELF4 -The haplotype of SNP1 at 19500841bp on chromosome 23 is GG and CELF4 -When the haplotype of SNP2 at 19501174bp on chromosome 23 is GG, the psoas muscle thickness of sheep is greater than that of other haplotype combinations.

[0014] Preferably, the length of the DNA fragment is 320 bp to 380 bp.

[0015] Preferably, the threshold of the genome-wide association analysis is set to P=1 / 620054.

[0016] The third aspect of the present invention provides the application of haplotype molecular markers in sheep genetic breeding.

[0017] Preferably, the psoas muscle thickness of the offspring is increased by selecting individuals with the haplotype combination GGGG as parents.

[0018] Preferably, the sheep are Suffolk sheep.

[0019] Compared with the prior art, the present invention has the following beneficial effects: A haplotype molecular marker affecting the thickness of sheep psoas muscle, the haplotype molecular marker comprising CELF4 -SNP1~ CELF4 -SNP2 has 2 sites; among them, CELF4 -SNP1 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.1, where a G to C mutation occurs; CELF4 -SNP2 is located at a position 101 bp in the nucleotide sequence of SEQ ID NO. 2, where a G-to-C mutation occurs. The present invention, through methods such as genome sequencing, variant site identification, and genome-wide association analysis, screened for haplotype molecular markers containing two SNPs that affect the thickness of the loin muscle in Suffolk sheep. These markers are used to identify the loin muscle thickness trait in sheep. By selecting individuals with the GGGG haplotype combination as either sires or dams, the thickness of the loin muscle in offspring can be increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 The variation characteristics of the Suffolk population in this invention are as follows: Figure 1 In the figure, a is the whole-genome distribution of detected variants on 26 chromosomes of Suffolk sheep, the X-axis represents the 26 autosomes, and the Y-axis represents the number of variants; b is the whole-genome annotation of genetic variation in Suffolk sheep, the X-axis represents various functional regions, and the Y-axis represents the number of genetic variants in different functional regions; c is the SNP type distribution map of Suffolk sheep, the X-axis represents the mutation type, and the Y-axis represents the number of genetic variants.

[0022] Figure 2 This is the distribution diagram of SNPs in a 1Mb window of chromosome after quality control in the present invention. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.

[0023] Figure 3This is a visualization diagram of the IBS genetic distance matrix of the present invention.

[0024] Figure 4 This is the principal component analysis diagram of the present invention, with the first three explained variance percentages PC1, PC2, and PC3 as the X, Y, and Z axes.

[0025] Figure 5 Manhattan plots and QQ-plots of the present invention show the GWAS results of loin muscle thickness in Suffolk sheep, with genome-wide significant SNPs shown in red; Figure 5 In the figure, A is the Manhattan plot of the thickness of the loin muscle of Suffolk sheep, and B is the QQ plot of the thickness of the loin muscle of Suffolk sheep.

[0026] Figure 6 The present invention is on chromosome 23 CELF4 The results of the haplotype block analysis of two SNPs at 19500841bp and 19501174bp of the gene; A is the Suffolk sheep chromosome 23 CELF4 Visualization of the linkage disequilibrium of two SNPs at 19500841bp and 19501174bp of the gene; B is the Suffolk sheep chromosome 23 CELF4 Visualization of linkage disequilibrium between two SNPs at 19500841bp and 19501174bp of the gene 2 Figure; C shows the haplotype results of SNPs related to loin muscle thickness in Suffolk sheep. DETAILED DESCRIPTION

[0027] To facilitate understanding of the present invention, the present invention will be described more fully below, along with preferred embodiments of the present invention. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present invention.

[0028] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0029] The beneficial effects of the present invention are described below through specific examples.

[0030] Example 1 Source of experimental animals and phenotypes: The experimental sheep in this invention were all obtained from Sino Sheep Breeding Technology Co., Ltd. in Inner Mongolia Autonomous Region. Phenotypic records of the psoas muscle thickness trait were measured in live Suffolk sheep from 2020 to 2024, as shown in Table 1. Blood samples were collected from 300 Suffolk sheep. All samples were immediately stored at -80°C after collection, transported to the laboratory on dry ice, and then stored at -80°C for a long time.

[0031] Table 1 Description of body weight traits of Suffolk sheep

[0032] 1. Genomic DNA Extraction and Quality Inspection DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration, the absorption wavelength ratio of the highest absorption peaks of nucleic acids, proteins, and phenols (260 nm / 280 nm), and the absorption wavelength ratio of the highest absorption peak of carbohydrates (260 nm / 230 nm) were measured using a NanoDrop 2000 spectrophotometer. DNA quality was assessed by 1% agarose gel electrophoresis.

[0033] 2. Library Construction and Sequencing After processing qualified genomic DNA samples, the DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments were then subjected to end-repair, poly A addition, sequencing adapters, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and the effective concentration of the library was accurately quantified using qPCR to ensure library quality. After passing the library quality test, sequencing was performed using the BGI-T7 sequencing platform in PE150 mode.

[0034] 3. Identification, screening, and annotation of variant sites The raw sequencing data were quality controlled and preprocessed using fastp software version V0.20.0 to obtain clean reads data. A genome index was established for the reference genome, and the quality-controlled clean reads were aligned with the sheep reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version V0.7.17. The aligned sam files were converted into bam files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in the Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and SNP variation detection was performed using the HaplotypeCaller module in the GATK software. The obtained vcf files were filtered using the VariantFiltration module. The ANNOVAR software package is used to perform functional annotation on the detected genetic variants. Based on the location of the variant site on the reference genome and the gene position information on the reference genome, the region where the variant site occurs in the genome, such as the intergenic region, intron region or CDS region, and the impact of the variant, such as synonymous and non-synonymous mutations, can be obtained.

[0035] Whole genome resequencing was performed on 300 individuals of Suffolk sheep to establish a genotype database, generating a total raw read size of 17243.32 Gb and obtaining a total of 47506993 SNPs, such as Figure 1 Then, all detected variants in Suffolk sheep were annotated using the gene annotation file downloaded from the Ensembl database, and it was found that the most variants were found in intergenic regions (58.90%) and intronic regions (33.25%), as shown in Figure 1. Figure 1 As shown in Figure B, only 0.70% of them are located in the coding regions, including 139,877 synonymous mutations and 136,655 non-synonymous mutations. Figure 1 These potential functional variants provide valuable genetic resources for exploring the genetic structure and functional genes of Suffolk sheep.

[0036] 4. Data Quality Control and Population Stratification Correction Detection rate, English name is call rate; minimum allele frequency, English abbreviation is MAF; Hardy-Weinberg equilibrium, English abbreviation is HWE.

[0037] The obtained genotyping data were quality controlled using Plink software version V1.90, and SNPs with genotype detection rates <5% and Hardy-Weinberg equilibrium test P values <10 were excluded. -6 A total of 20,182,599 high-quality SNPs were identified in the Suffolk population. These sites were evenly distributed on the 26 pairs of autosomes in sheep, such as Figure 2 shown.

[0038] The population was analyzed based on the IBS genetic distance matrix using Plinkv1.90. The results are as follows Figure 3 As shown, Figure 3 Each small square in the figure represents the genetic distance between the first and last samples. The larger the value and the closer it is to blue, the more distant the relationship between the two individuals. Vice versa, it indicates that the relationship between the Suffolk sheep individuals is relatively distant. The first five principal components were calculated using the "--pca5" parameter of Plink software version V1.90. The PCA graph was drawn using R version V3.6.0. The results are shown below. Figure 4 As shown in the figure, there is population stratification in the experimental samples and the genetic correlation between individuals is high. The first five principal components need to be used as covariates to correct the population stratification phenomenon of Suffolk sheep.

[0039] 5. Genome-wide association analysis The association analysis between SNPs and body weight traits was performed using the fastGWA-mlm model in the GCTA software V1.94.0beta.

[0040] y=X snp β snp +X c β c +g+e Where y is the phenotype vector; X snp is the genotype vector, whose effect is β snp ;X c is the correlation matrix with sex, measurement year and the first five PCAs as fixed covariates, and the corresponding coefficient is β c ; g is the vector of total genetic effects captured by the SNP-derived genetic relationship matrix, g~N(0, ); π is the genetic relationship matrix vector derived from SNPs, where all off-diagonal elements are set to 0; e is the residual vector, e~N(0, ).

[0041] Because the Bonferroni correction method is used, the significance threshold of 0.05 / number of SNPs is too strict to determine the significance threshold of GWAS. After the linkage disequilibrium (LD), independent SNPs are obtained and used to calculate the threshold. The parameters are 50: window size, i.e., number of SNPs; 10: step length, i.e., number of SNPs; 0.2: r 2 value, delete one of the SNP pairs with LD greater than 0.2. The threshold for genome-wide significant association was adjusted to P=1 / 620054, where 620054 is the number of independent SNPs that have been screened by LD. The genomic expansion factor of the test statistic, λ, was calculated by the slope of the linear regression between the observed quantile and the theoretical quantile in R version V3.6.0. After calculation, the λ value of the weight trait was 1.033, indicating that there was no genomic expansion. Based on the resequencing data of 300 Suffolk sheep, 37 significant SNP sites associated with the psoas muscle thickness trait were detected. These sites were located on chromosomes 2, 3, 7, 12, 17, 18, 20, and 23, and gene annotation and enrichment analysis were performed on the significant SNPs. CELF4 Gene ID: 101114837 is associated with the sheep psoas muscle thickness trait, as shown in Table 2 and Figure 5 shown.

[0042] Table 2 Significant SNP sites associated with lumbar muscle thickness traits

[0043] six, CELF4 Gene haplotype combination construction Data statistics and analysis were performed based on the significant SNP sites obtained from GWAS. According to the calculation principles of parameters such as allele frequency, genotype frequency, homozygosity and heterozygosity, Excel functions were written to calculate population genetic parameters, and at the same time, whether the significant SNPs conformed to the Hardy-Weinberg equilibrium was tested, as shown in Table 3. Haplotypes were then constructed using Haploview software, and it was found that on chromosome 23 CELF4 The two SNPs at positions 19500841 and 19501174 of the gene constitute a haplotype block, and the two SNPs are marked as CELF4 -SNP1~ CELF4 -SNP2, this domain block includes two haplotypes, named D1 and D2, as shown in Table 4 and Figure 6 shown.

[0044] Table 3 Thickness of Suffolk sheep loin muscle CELF4 Intragenic SNPs population genetic parameters

[0045] Table 4 CELF4 Construction of different haplotypes of genes

[0046] seven, CELF4 Association analysis between gene haplotype combinations and loin muscle thickness traits in Suffolk sheep SAS9.2 software was used to analyze the relationship between haplotype combinations and lumbar muscle thickness traits in individuals. Table 5 lists CELF4 -SNP1~ CELF4 -Statistics of loin muscle thickness in Suffolk sheep under the haplotype combination of the SNP2 gene. CELF4 -SNP1~ CELF4 -The thickness of the lumbar muscle of the D1D1 haplotype combination of the SNP2 gene is significantly higher than that of the D2D2 combination. P <0.05, see Table 5. Therefore, select CELF4 D1D1 of the gene, i.e. CELF4 -The haplotype of SNP1 is GG and CELF4 The haplotype combination of the -SNP2 locus with the haplotype of GG is used as a screening marker for screening Suffolk sheep with excellent psoas muscle thickness trait.

[0047] Table 5 CELF4 Thickness of loin muscle in Suffolk sheep under different haplotype combinations

[0048] Note: Different letters indicate significant differences when performing variance analysis between haplotype combinations with "D" P <0.05, the same letter indicates no significant difference P >0.05.

[0049] In summary, the present invention provides a method for determining the thickness of the Suffolk sheep loin muscle. CELF4 -SNP1~ CELF4 -SNP2 locus, CELF4 -The haplotype of SNP1 is GG and CELF4 The haplotype combination of GG at the -SNP2 locus can be used as a screening marker for screening or detecting Suffolk sheep with excellent psoas muscle thickness traits; in addition, Suffolk sheep individuals with the haplotype combination of GGGG can be selected as sires or dams to increase the psoas muscle thickness trait of offspring Suffolk sheep.

[0050] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0051] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0052] The above-described embodiments merely represent several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent. A person skilled in the art would be able to make various modifications and improvements without departing from the spirit of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be based on the appended claims.

Claims

1. A haplotype molecular marker affecting the thickness of sheep psoas muscle, characterized in that: The haplotype molecular markers include CELF4 -SNP1~ CELF4 -SNP2 has 2 sites; in, CELF4 -SNP1 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.1, where a G to C mutation occurs; CELF4 -SNP2 is located at the 101bp position of the nucleotide sequence shown in SEQ ID NO.2, where a mutation from G to C occurs.

2. Use of the haplotype molecular marker affecting the sheep psoas muscle thickness trait as claimed in claim 1 in identifying the sheep psoas muscle thickness trait.

3. The use according to claim 2, characterized in that Described identification sheep psoas muscle thickness trait comprises the following steps: Extract genomic DNA from sheep blood; The genomic DNA is fragmented to obtain DNA fragments, and then a library is constructed using the DNA fragments. The library is sequenced to obtain sequencing data; The sequencing data were used to identify and screen the variant sites, and the haplotype molecular markers of sheep were detected using genome-wide association analysis. CELF4 -The haplotype of SNP1 at 19500841bp on chromosome 23 is GG and CELF4 -When the haplotype of SNP2 at 19501174bp on chromosome 23 is GG, the psoas muscle thickness of sheep is greater than that of other haplotype combinations.

4. The use according to claim 3, characterized in that The length of the DNA fragment is 320 bp to 380 bp.

5. The use according to claim 3, characterized in that The threshold for the genome-wide association analysis was set to P = 1 / 620054.

6. Use of the haplotype molecular marker according to claim 1 in sheep genetic breeding.

7. The use according to claim 6, characterized in that By selecting individuals with the haplotype combination GGGG as parents, the psoas muscle thickness of the offspring can be increased.

8. The use according to claim 2 or claim 6, characterized in that The sheep are Suffolk sheep.

Citation Information

Patent Citations

  • Sheep back fat trait-related SNP and application thereof

    CN101942438A

  • Haplotype combined molecular marker for Hu sheep weight selection and application of haplotype combined molecular marker

    CN111719000A

  • Methods and reagents for determining desirable meat eating quality traits in ovine animals and use of same in animal breeding

    WO2024000008A1

Cited By

  • Application of molecular marker related to weaning weight character of sheep

    CN121674585A