Mixed vaccine for expressing brucella multiple antigens as well as preparation method and application of mixed vaccine

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a mixed vaccine for expressing Brucella multiple antigens and a preparation method and application thereof, and the mixed vaccine is obtained by encapsulating active mRNA by lipid nanoparticles; the nucleotide sequence of the active mRNA is at least one of SEQ ID NO. 1 to SEQ ID NO. 8. The mixed vaccine is prepared by independently encapsulating mRNA (messenger Ribonucleic Acid) of eight key antigens of Brucella by using LNP (Lipoprotein Natriuretic Peptide). According to the mixed vaccine, the problem of antigen competition is avoided, the mixed vaccine can be efficiently delivered to an immune system, and each antigen can initiate balanced immune response.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a mixed vaccine expressing multiple Brucella antigens, and a preparation method and application thereof. Background Art

[0002] Brucellosis is caused by Brucella Brucella ) is a zoonotic infectious disease caused by intracellular parasites. This genus includes multiple species, which can not only cause reproductive disorders in ruminants and cause losses to the livestock industry, but can also infect humans through direct contact or foodborne routes. If human infection is not promptly and effectively intervened, about 20% of cases may develop into chronic infections, involving multiple system organs. The clinical manifestations are often non-specific, such as recurrent fever, sweating, arthritis, and hepatosplenomegaly. Some cases can even lead to irreversible organic damage. Brucella achieves immune escape through complex mechanisms such as interfering with the host cell autophagy pathway and masking surface antigen epitopes, making it difficult for the host to completely eliminate the pathogen.

[0003] At present, the prevention and control of brucellosis relies heavily on live attenuated vaccines. Although live attenuated vaccines have a good immune effect, their residual virulence cannot be ignored. They may cause miscarriage in vaccinated pregnant livestock, and there is a risk of live bacteria excreting toxins into the environment. Subunit vaccines, as a safer type of vaccine, have also been explored in the research of brucellosis vaccines, but their application faces challenges, mainly due to insufficient antigen presentation efficiency. They mainly activate Th2 humoral immune responses and often cannot induce a sufficiently strong CD8 + T lymphocyte response, so its protection effect against virus is usually weaker than that of live attenuated vaccines. The immune escape mechanism of Brucella is extremely complex, and the homology of the main outer membrane proteins between different serotypes is limited, which makes it difficult for vaccines prepared with a single antigen to provide broad-spectrum effective protection. Studies have shown that the use of a combination of multiple key antigenic epitopes can significantly improve the efficiency of antigen presentation by antigen-presenting cells, but when using traditional technology to prepare vaccines containing multiple antigens, there are still challenges in efficient and stable co-delivery. Even if multiple antigens can be delivered to the immune system, it is difficult to ensure that each antigen can trigger a balanced immune response. It may happen that the immune response induced by some antigens is too strong, while the immune response induced by some antigens is too weak, resulting in an unbalanced immune protection of the body against different pathogens, and the expected effect of the combination vaccine cannot be achieved. Summary of the Invention

[0004] The present invention provides a mixed vaccine expressing multiple Brucella antigens, which is used for efficiently, stably and balanced co-expression of multiple Brucella antigens.

[0005] The technical solution adopted in the present invention is: The present invention provides a mixed vaccine expressing multiple Brucella antigens, wherein the mixed vaccine is obtained by encapsulating active mRNA in lipid nanoparticles; The nucleotide sequence of the active mRNA is at least one of SEQ ID NO.1 to SEQ ID NO.8.

[0006] The second aspect of the present invention provides a method for preparing the mixed vaccine, comprising the following steps: Synthesize the sequences shown in SEQ ID NO. 1 to SEQ ID NO. 8, and clone them into expression vectors to obtain recombinant vectors; PCR amplification was performed using the recombinant vector as a template to obtain a linearized DNA template; The linearized DNA template was used for in vitro transcription and purification to obtain an in vitro transcription product, in which pseudouridine was substituted for natural uridine during in vitro transcription; The in vitro transcription products were encapsulated using lipid nanoparticles to obtain 8 different mRNA-lipid nanoparticles; The mixed vaccine is obtained by mixing 8 different mRNA-lipid nanoparticles.

[0007] Preferably, the expression vector is pcDNA3.1.

[0008] Preferably, the process of encapsulating the in vitro transcription product using lipid nanoparticles comprises the following steps: The ionizable cationic lipid, the helper lipid, the cholesterol and the PEGylated lipid are dissolved in ethanol respectively and then mixed to obtain a lipid ethanol phase; The in vitro transcription products were dissolved in sodium acetate buffer to obtain mRNA aqueous phase; The lipid ethanol phase and the mRNA aqueous phase pass through a microfluidic device to achieve the encapsulation of in vitro transcription products by lipid nanoparticles.

[0009] Preferably, the molar ratio of the ionizable cationic lipid, the helper lipid, the cholesterol and the PEGylated lipid is 50:10:38.5:1.5.

[0010] Preferably, the ionizable cationic lipid is SM102; The helper lipid is DSPC; The PEGylated lipid is DMG-PEG2000.

[0011] Preferably, when the lipid ethanol phase and the mRNA aqueous phase are encapsulated by the microfluidic device, the flow rate ratio of the lipid ethanol phase to the mRNA aqueous phase is 1:3.

[0012] The third aspect of the present invention provides a use of the mixed vaccine, wherein the mixed vaccine is used to prepare a medicament for preventing and / or treating brucellosis.

[0013] Preferably, the formulation of the drug is as follows: The mixed vaccine is dissolved in a Tris-HCl buffer solution having a pH of 7.4 and mixed to obtain the drug.

[0014] Preferably, the drug is suitable for any one of cattle, sheep and mice.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a hybrid vaccine expressing multiple Brucella antigens, wherein the hybrid vaccine is obtained by encapsulating active mRNA with lipid nanoparticles; the nucleotide sequence of the active mRNA is at least one of SEQ ID NO.1 to SEQ ID NO.8. The present invention discloses a method for preparing a Brucella multi-antigen mRNA-LNP hybrid vaccine and a preparation method thereof, wherein mRNA encoding eight key Brucella antigens is independently encapsulated in LNPs and mixed in proportion before immunization. The hybrid vaccine of the present invention not only avoids the problem of antigen competition, but can also be efficiently delivered to the immune system, and each antigen can trigger a balanced immune response.

[0016] In addition, the present invention also has the following beneficial effects: Improve the efficiency of multi-antigen expression: By independently encapsulating the mRNA encoding different Brucella antigens and then mixing them, it is ensured that each target antigen can be effectively expressed in the host cells, thereby inducing a broader, more balanced and more potent immune response against multiple antigen epitopes, overcoming the problem of narrow protection spectrum of single antigen vaccines.

[0017] Reduced immunogenicity: The active mRNA molecule contains pseudouridine modifications, which improves stability and translation efficiency and reduces its inherent immunogenicity.

[0018] Enhanced vaccine safety: As a non-replicating, non-integrating nucleic acid vaccine, the mRNA-LNP vaccine of the present invention fundamentally avoids the risk of residual virulence inherent in traditional live attenuated vaccines and has higher biosafety.

[0019] Optimized LNP delivery and potential immune regulation: The specific LNP formula used in the present invention and the uniform LNP particles prepared by microfluidic technology not only ensure the efficient encapsulation rate and stability of mRNA, but also optimize its in vivo pharmacokinetic behavior, target cell uptake efficiency and key endosomal escape process by regulating the physicochemical properties of LNP, which is particularly important for effectively activating cellular immunity against intracellular bacteria such as Brucella.

[0020] Simplified preparation process, easy standardization and scalable production, and reduced costs: The in vitro transcription preparation process for mRNA vaccines is relatively mature and easy to scale up. The present invention's "separate encapsulation and pre-use mixing" strategy allows for independent production and quality control of each mRNA-LNP component, simplifying the preparation and quality control process of multivalent vaccines and making them easier to standardize and scale up. This is expected to reduce the cost per unit vaccine, making it more suitable for large-scale animal immunization needs in the livestock industry.

[0021] Providing a flexible vaccine design platform for brucellosis prevention and control: The strategy of the present invention allows for flexible adjustment of the types and combination ratios of antigens in mixed vaccines based on the antigenic variation of prevalent strains or the immunization needs of different animal species, providing strong technical support for the precise prevention and control of brucellosis and the continuous optimization of vaccines.

[0022] This invention will utilize novel mRNA vaccine technology, based on classic brucellosis antigen proteins, to determine the process, quality control standards, technical parameters, safety, and effectiveness of candidate brucellosis mRNA vaccines. Simultaneously, it will advance the optimization of brucellosis mRNA vaccine antigen screening, structure, and delivery systems. The development of this invention is of great significance to the high-quality development of animal husbandry and human health. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the particle size distribution diagram of B1 mRNA-LNP.

[0024] Figure 2 This is the particle size distribution diagram of B2 mRNA-LNP.

[0025] Figure 3 This is the particle size distribution diagram of B3 mRNA-LNP.

[0026] Figure 4 This is the particle size distribution diagram of B4 mRNA-LNP.

[0027] Figure 5 This is the particle size distribution diagram of B5 mRNA-LNP.

[0028] Figure 6 This is the particle size distribution diagram of B6 mRNA-LNP.

[0029] Figure 7 This is the particle size distribution diagram of B7 mRNA-LNP.

[0030] Figure 8 This is the particle size distribution diagram of B8 mRNA-LNP.

[0031] Figure 9 Schematic diagram of the immunization scheme of the present invention.

[0032] Figure 10 Schematic diagram of the body weight changes of Balb / c mice during the immunization experiment.

[0033] Figure 11 is the OD of IgG antibody against Brucella B3 antigen in the serum of mice in different treatment groups 450 Value comparison chart.

[0034] Figure 12 is the OD of IgG antibody against Brucella B4 antigen in the serum of mice in different treatment groups 450 Value comparison chart.

[0035] Figure 13 is the OD of IgG antibody against Brucella B1~B4 mixed antigens in the serum of mice in different treatment groups 450 Value comparison chart.

[0036] Figure 14 is the OD of IgG antibody against Brucella B5~B8 mixed antigens in the serum of mice in different treatment groups 450 Value comparison chart. DETAILED DESCRIPTION

[0037] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0038] The inventive concept of the present invention is as follows: In recent years, messenger RNA vaccine technology has developed rapidly. However, in the field of brucellosis vaccine research, the application of mRNA technology is still in the exploratory stage, especially in the development of strategies that can effectively present multiple Brucella antigens to induce comprehensive immune protection, which requires further research. In addition, lipid nanoparticles, as the main delivery vehicle for mRNA, are still not optimized for intracellular bacteria such as Brucella. Traditional LNP formulations, such as those containing DMG-PEG2000, may also face problems such as accelerated clearance from the body and insufficient targeting of key immune organs. These factors may affect the effective delivery of antigens and the ultimate immune effect.

[0039] Currently, the research and development of brucellosis vaccines faces three core contradictions: (1) the trade-off between the biosafety risks of live attenuated vaccines and their immune efficacy, and the dilemma of the generally insufficient immune efficacy of non-live vaccines; (2) the contradiction between the limited protection range of a single antigen and the bottleneck of effective co-delivery technology for multiple antigens; and (3) the gap between the cost limitations of traditional vaccine preparation processes and the urgent need for large-scale animal immunization.

[0040] Therefore, there is an urgent need to develop a new vaccine strategy that can effectively co-express and synergistically deliver multiple Brucella antigens and adapt to the immune escape characteristics of Brucella, so as to achieve a synergistic breakthrough in immune protection while ensuring safety, and provide a more ideal solution for the prevention and control of brucellosis.

[0041] The mRNA-LNP vaccine platform, with its ability to directly translate and express antigens with natural conformation in the host cell cytoplasm, has the potential to simultaneously activate Th1 cellular immunity and humoral immunity that produces neutralizing antibodies, providing a new perspective for solving the above-mentioned problems.

[0042] Based on this, the present invention provides a mixed vaccine expressing multiple Brucella antigens, which is as follows: 1. The process of preparing multi-antigen mRNA-LNP.

[0043] Antigen selection: Eight key Brucella antigens were screened, designated B1–B8, encompassing the following: secretory protein VirB5, membrane protein OMP19, membrane protein OMP16, ribosomal protein L7 / L12, metabolic protein MDH, metabolic protein Cu / Zn SOD, membrane protein OMP31, and secretory protein VirB2, covering diverse immune epitopes. Detailed information on these eight antigens is provided in Table 1.

[0044] Table 1 Detailed information of 8 antigens

[0045] Independent encapsulation: Each antigen's mRNA is individually encapsulated into lipid nanoparticles to avoid translation interference caused by co-encapsulation of multiple sequences and ensure uniform expression efficiency of each antigen.

[0046] 2. Preparation process optimization.

[0047] Codon optimization and modification: Codons for eight antigens were optimized for bovine, ovine, and mouse hosts; whole-gene synthesis and cloning into the pcDNA3.1 vector were performed; and pseudouridine was substituted for natural uridine throughout the in vitro transcription process to improve mRNA stability and translation efficiency.

[0048] LNP formulation and encapsulation: Lipid nanoparticles were prepared with SM102, DSPC, cholesterol, and DMG-PEG2000 at a molar ratio of 50:10:38.5:1.5. mRNA aqueous phase:lipid ethanol phase were encapsulated through a microfluidic chip at a flow rate ratio of 3:1. Dynamic light scattering verified that eight mRNA-LNPs with particle sizes of 80 nm to 100 nm were obtained, with an encapsulation efficiency of >90%.

[0049] 3. Mixed immunization strategy.

[0050] Aliquoting and storage: Add 5% w / v sucrose protective agent to each antigen mRNA-LNP, aliquot into 0.35 mL / tube, 250 ng / μL, and store at -80℃ for long-term storage.

[0051] Vaccine mixing: Before immunization, mix the 8 antigen mRNA-LNPs in equal mass or equimolar ratio.

[0052] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.

[0053] The abbreviations of the present invention are shown in Table 2.

[0054] Table 2 Abbreviations

[0055] Example 1 The preparation method of the mixed vaccine expressing multiple Brucella antigens is as follows: 1. Optimize the codons encoding 8 antigens and construct recombinant vectors.

[0056] The present invention selected eight key Brucella antigens, B1 to B8, and codon-optimized the gene sequences encoding these antigens. The optimized codon sequences of B1 to B8 correspond to SEQ ID NO. 1 to SEQ ID NO. 8, respectively. The optimized gene sequences were synthesized by GenScript Biotech and cloned into the pcDNA3.1 expression vector to obtain eight recombinant vectors. Each of these eight recombinant vectors contains a T7 promoter, a 5' untranslated region (UTR), the target gene, a 3' untranslated region (UTR), and a poly(A) tail.

[0057] B1, VirB5, SEQ ID NO.1: ATGAAGAAGATCATCCTGAGCTTCGCCTTCGCCCTGACCGTGACATCTACCGCCCATGCTCAGCTGCCTGTGACAGATGCTGGCAGCATCGCCCAGAATCTGGCCAACCACCTGGAGCAGATGGTGAAGTTTGCCCAGCAGATTGAGCAGCTGAAGCAGCAGTTTGAGCAGCAGAAAATGCAGTTTGACGCCCTGACAGGCAATAGAGGCCTGGGCGATATTCTGAGGGACCCTACCCTGAGAAGCTACCTGCCCCACAATTGGAGGGACCTGTACGAGGCCGTGATGTCTGGAGGCTATCTGGCTGCTGCTGGCGAAACAGCCAATCTGCTCAGAAAGAGCCAGGTGTACGACCCATGTGCTAGCATCTCTGATAAGGACCAGAGAATCGCCTGCGAAGCCAAGGTGGTGAAGCCTGTGCAGGACAAGGTGATGACCAGCAAAGCCTACGACGCCACCGATAAACGGCTCCAGGAGATCGAGAGCCTGATGCAGGAGATCAACAAGACAGGCGACCCTAAGGCCATTGCCGAGCTGCAGGGCAGAATTGAGAGCGAGAATGCCATGATCCAGAATGAGGATACCAGGCTGCACCTGTATCAGCAGATGGCCGAGGCCCAGGATAAGCTGCTGGATGAAAGACAGCACGAGCTGGACGCCAAGGATAACGCCAGAAGAGGCTACCCACAGCCTAAGGCCCTGGAGGCCGCCTACTGA。

[0058] B2,OMP19,SEQ ID NO.2: ATGGAGAACCTGATGGGCATCTCTAAGGCCTCTCTGCTGTCTCTGGCCGCCGCTGGAATTGTGCTGGCTGGCTGTCAGAGCAGCAGGCTGGGAAACCTGGACAATGTGTCTCCACCACCTCCTCCTGCTCCTGTGAATGCTGTGCCTGCCGGAACAGTGCAGAAAGGCAATCTGGATAGCCCTACCCAGTTTCCTAATGCCCCTAGCACCGATATGTCTGCTCAATCTGGAACACAGGTGGCTTCTCTGCCACCAGCTTCTGCCCCTGATCTGACACCTGGAGCTGTGGCTGGAGTGTGGAATGCTTCTCTGGGCGGACAGAGCTGCAAGATCGCCACACCCCAGACAAAATATGGACAGGGATATAGAGCCGGCCCACTGAGATGTCCTGGAGAGCTGGCTAATCTGGCTTCTTGGGCCGTGAATGGAAAACAGCTGGTGCTGTATGACGCTAATGGCGGCACAGTGGCTAGCCTGTACAGCTCTGGCCAGGGCAGATTCGATGGCCAGACAACCGGCGGCCAAGCCGTGACCCTGAGCAGATGA。

[0059] B3,OMP16,SEQ ID NO.3: ATGCGGAGGATTCAGAGCATCGCCAGAAGCCCCATCGCCATTGCCCTGTTTATGTCTCTGGCCGTGGCTGGCTGTGCCAGCAAGAAAAACCTGCCTAATAATGCCGGCGATCTGGGCCTGGGAGCTGGAGCCGCCACACCTGGATCTAGCCAGGATTTCACCGTGAATGTGGGCGATAGAATCTTCTTCGATCTGGATTCTAGCCTGATCAGAGCTGATGCCCAGCAGACCCTGAGCAAGCAGGCTCAGTGGCTGCAGAGATACCCTCAGTACAGCATCACCATCGAAGGCCACGCCGATGAAAGAGGCACCAGAGAGTACAATCTGGCCCTGGGACAGCGGAGAGCCGCTGCCACAAGAGATTTTCTGGCCTCTAGGGGCGTGCCTACAAATAGAATGAGAACAATCAGCTATGGCAACGAGAGGCCAGTGGCTGTGTGTGACGCCGACACCTGTTGGAGCCAGAATAGAAGAGCCGTGACCGTGCTGAACGGCGCCGGCAGGTGA。

[0060] B4,L7 / L12,SEQ ID NO.4: ATGGCCGACCTGGCCAAGATCGTGGAGGACCTGTCTGCCCTGACCGTGCTGGAAGCCGCCGAGCTGTCTAAGCTGCTGGAGGAGAAATGGGGCGTGTCTGCCGCTGCTCCTGTGGCTGTGGCTGCTGCCGGAGGAGCCGCTCCTGCTGCAGCTGCCGAAGAAAAAACAGAATTTGATGTGGTGCTGGCTGATGGAGGAGCTAATAAAATTAATGTGATTAAAGAGGTGAGAGCCCTGACAGGCCTGGGCCTGAAGGAGGCCAAAGATCTGGTGGAAGGCGCCCCTAAAGCCGTGAAGGAGGGCGCCAGCAAGGACGAGGCCGAGAAGATCAAGGCCCAGCTGGAGGCCGCCGGCGCCAAGGTGGAGCTGAAGTGA。

[0061] B5,MDH,SEQ ID NO.5: ATGAGAAAGGAAACCATCATGGCCAGGAACAAGATCGCCCTGATCGGCTCTGGCATGATTGGCGGCACCCTGGCTCATCTGGCTGGCCTGAAAGAGCTGGGAGATGTGGTGCTGTTTGATATCGCTGAGGGCACACCACAGGGAAAAGGCCTGGATATTGCCGAGAGCTCTCCTGTGGATGGCTTCGACGCCAAGTTTACAGGAGCCAATGATTACGCCGCCATTGAAGGAGCCGATGTGGTGATCGTGACAGCCGGCGTGCCTAGAAAACCCGGCATGAGCAGAGACGATCTGCTGGGCATCAATCTGAAGGTGATGGAGCAGGTGGGAGCCGGCATTAAGAAGTATGCCCCTGAGGCCTTCGTGATCTGCATCACCAATCCTCTGGACGCTATGGTGTGGGCTCTGCAGAAATTCAGCGGATTACCTGCCCACAAAGTGGTGGGCATGGCTGGCGTGCTGGATAGCGCCAGGTTCAGATACTTCCTGAGCGAGGAGTTTAACGTGTCTGTGGAGGATGTGACCGCCTTCGTGCTGGGAGGACATGGCGATTCTATGGTGCCTCTGGCCAGATATTCTACAGTGGCCGGCATCCCACTGTCTGATCTGGTGAAAATGGGCTGGACCAGCCAGGATAAGCTGGACAAGATCATCCAGCGGACCAGAGACGGAGGAGCTGAGATTGTGGGCCTGCTGAAAACAGGCTCTGCCTTTTATGCTCCTGCCGCCAGCGCCATCCAGATGGCCGAATCTTACCTGAAGGATAAGAAGAGAGTGCTGCCTGTGGCCGCACAGCTGTCTGGACAGTACGGAGTGAAGGATATGTACGTGGGAGTGCCAACCGTGATTGGCGCTAATGGCGTGGAGAGGATCATCGAGATCGACCTGGACAAGGACGAGAAAGCCCAGTTTGACAAGAGCGTGGCCTCTGTGGCCGGCCTGTGTGAAGCCTGTATCGGCATCGCCCCCAGCCTGAAGTGA。

[0062] B6,Cu / Zn SOD,SEQ ID NO.6: ATGAAGAGCCTGTTCATCGCCAGCACCATGGTGTTGATGGCCTTTCCCGCCTTTGCCGAGAGCACCACCGTGAAGATGTATGAGGCCCTGCCTACAGGACCAGGCAAGGAGGTGGGCACAGTGGTGATCTCTGAGGCCCCAGGAGGCCTGCACTTTAAGGTGAATATGGAGAAGCTGACACCAGGCTATCATGGCTTTCATGTGCACGAGAATCCTTCTTGTGCCCCTGGAGAGAAGGATGGAAAGATCGTGCCTGCTCTGGCTGCCGGAGGCCATTACGATCCAGGCAATACCCACCACCACCTGGGCCCTGAAGGCGATGGACACATGGGCGATCTGCCAAGGCTGTCTGCTAATGCTGATGGAAAAGTGTCTGAAACAGTGGTGGCCCCTCATCTGAAAAAACTGGCCGAGATCAAGCAGAGAAGCCTGATGGTGCACGTGGGCGGAGACAATTACAGCGACAAGCCTGAGCCTCTGGGAGGCGGAGGCGCCAGATTCGCCTGCGGCGTGATCGAGTGA。

[0063] B7,OMP31,SEQ ID NO.7: ATGAAGAGCGTGATCCTGGCCAGCATCGCCGCCATGTTTGCCACATCTGCCATGGCCGCCGATGTGGTGGTGTCTGAACCTTCTGCTCCTACAGCTGCTCCAGTGGACACCTTTAGCTGGACAGGCGGCTACATTGGCATTAACGCCGGCTACGCCGGCGGCAAATTCAAGCACCCCTTTAGCAGCTTCGATAAAGAGGATAATGAACAGGTGAGCGGAAGCCTGGATGTGACAGCCGGAGGATTTGTGGGAGGCGTGCAGGCCGGATACAATTGGCAGCTGGATAATGGAGTGGTGCTGGGCGCTGAAACCGACTTTCAGGGATCTAGCGTGACAGGCTCTATTTCTGCCGGCGCCTCTGGCCTGGAGGGAAAGGCCGAAACAAAAGTGGAATGGTTTGGAACAGTGAGAGCTAGGCTGGGATACACCGCCACAGAGAGGCTGATGGTGTATGGCACAGGAGGCCTGGCTTACGGCAAAGTGAAATCTGCCTTCAATCTGGGCGACGATGCTTCTGCCCTGCACACATGGAGCGATAAGACCAAAGCCGGCTGGACCCTGGGAGCCGGAGCCGAGTATGCCATCAACAATAATTGGACCCTGAAGAGCGAGTATCTGTACACCGACCTGGGCAAGAGGAACCTGGTGGACGTGGACAACAGCTTCCTGGAGAGCAAGGTGAATTTCCACACCGTGAGAGTGGGCCTGAATTACAAGTTTTGA。

[0064] B8,VirB2,SEQ ID NO.8: ATGAAGACCGCCAGCCCTAGCAAGAAGAGCCTGAGCAGGATTCTGCCCCACCTGCTGCTGGCCCTGATCGTGAGCATCGCCGCCATCGAGCCCAACCTGGCCCACGCCAATGGAGGCCTGGATAAAGTGAATACATCTATGCAGAAGGTGCTGGATCTG CTGTTCTGGCGTGTCTATTACAATCGTGACCATTGCCATCATCTGGTCTGGCTACAAGATGGCCTTCAGGCACGCCAGATTCATGGACGTGGTGCCTGTGCTGGGAGGAGCCCTGGTGGTGGGAGCCGCCGCCGAGATCGCCAGCTACCTGCTGAGATGA.

[0065] 2. Prepare linearized DNA template.

[0066] To obtain linearized DNA templates for in vitro transcription, PCR amplification was performed on each of the eight constructed recombinant vectors to obtain the genes for the eight antigens. The PCR system for preparing linearized DNA templates is shown in Table 3, and the procedure is shown in Table 4.

[0067] Table 3 System for preparing linearized DNA template by PCR

[0068] Table 4 Procedure for preparing linearized DNA template by PCR

[0069] In Table 4, “-” indicates that this item does not exist.

[0070] After PCR amplification, the PCR product was purified using the NucleoSpin Gel and PCR clean-up kit and eluted with 30 μL of nuclease-free water. The concentration and purity of the purified PCR product were determined using a Nanodrop spectrophotometer.

[0071] 3. In vitro transcription of mRNA.

[0072] Each of the eight linearized DNA templates obtained above was used for in vitro transcription to synthesize mRNA. The IVT reaction system, using 20 μL as an example, is shown in Table 5.

[0073] Table 5 IVT reaction system

[0074] After the preparation is completed according to Table 5, the mixture is placed in a 37°C water bath for 2 h to obtain the IVT product.

[0075] After the reaction, 1 μL of IVT product was retained for subsequent agarose gel analysis; 1 μL of DNase I was added to the remaining 19 μL of IVT product and incubated at 37°C for 15 min to digest and remove DNA.

[0076] 4. mRNA purification.

[0077] To the DNase I-digested IVT sample, add 80 μL of Solution D, 250 μL of anhydrous ethanol, and 80 μL of ultrapure distilled water and mix gently. Place the purification column containing the IVT sample in a collection tube and centrifuge at 1100 g for 1 minute. Discard the flow-through. Add 70% v / v ethanol to the purification column and centrifuge at 1100 g for 1 minute. Discard the flow-through. Repeat this wash step once. Place the purification column in a collection tube and centrifuge at 1100 g for 1 minute to remove residual ethanol. Place the purification column in a new, clean collection tube, add 80 μL of nuclease-free water to the center of the column membrane, let it stand at room temperature for 2 minutes, and then centrifuge at 1100 g for 1 minute to elute. Eight different mRNAs were obtained through these steps. The concentration of the eluted mRNA solution was determined using a Nanodrop spectrophotometer, and the A260 / A280 ratio, A260 / A230 ratio, and A260 absorbance were recorded.

[0078] Mix 1 μL of mRNA sample with 1 μL of 2× RNA loading buffer, denature at 70°C for 10 minutes, and immediately cool on ice before performing electrophoresis on a 1% w / v agarose gel to check mRNA integrity. The gel electrophoresis conditions were: 1× TAE, 170 V, and 25 minutes.

[0079] The antigen mRNAs with an A260 / A280 ratio of 1.8 to 2.1 and a clear single main band without obvious degradation as shown by agarose gel electrophoresis were aliquoted for later use.

[0080] 5. Quality testing before mRNA encapsulation: To ensure that the mRNA used for LNP encapsulation meets the quality requirements, the purified mRNA of each antigen needs to be tested for dsRNA content, protein expression capacity, and mRNA purity and integrity.

[0081] 5.1. dsRNA content detection.

[0082] The double-stranded RNA content was measured using a dsRNA (modification) quantitative detection kit purchased from Vazyme. The procedure is briefly described as follows: The kit and the mRNA to be tested were equilibrated at room temperature for about 30 minutes before the experiment.

[0083] Dilute the mRNA to be tested 200-fold. For example, mix 2 μL of mRNA sample with 38 μL of the diluent provided in the kit. Then, add 38 μL of this mixture to a new EP tube and add 342 μL of the diluent. Mix thoroughly and place on ice. A gradient dilution can be used to improve accuracy. Simultaneously, dilute the standard sample according to the kit instructions to prepare a standard curve.

[0084] Load the sample into a 96-well plate according to the kit instructions, including the diluted sample and standard.

[0085] Dilute the concentrated wash buffer provided with the kit with Invitrogen Ultra Pure Water to prepare at least 400 mL of working concentration of wash buffer.

[0086] Follow the kit instructions for antibody incubation, plate washing, color development, and microplate reader detection. Calculate the dsRNA content in the sample based on the standard curve.

[0087] 5.2. Protein expression ability detection.

[0088] By transfecting 293T cells in vitro, the ability of mRNA to translate and express the target protein is detected. Here, HA-tagged protein is used as an example for schematic detection. In practice, Brucella antigens or their reporter tags should be detected.

[0089] 293T cells were plated in 12-well plates one day in advance to ensure that the cell confluency reached approximately 80% at the time of transfection.

[0090] Use Lipofectamine 2000 for mRNA transfection: 1 μg of the mRNA to be tested and 2.5 μL of Lipofectamine 2000 were diluted with serum-free medium and mixed, incubated at room temperature for 20 minutes to form a transfection complex, and then added to the wells containing cells.

[0091] Collect cell samples 24 hours after transfection: aspirate the culture supernatant, resuspend the cells in PBS, and centrifuge at 500g for 5 minutes to collect the cells. Discard the supernatant and add RIPA lysis buffer. Incubate on ice for 2 minutes, then centrifuge at 12,000g at 4°C for 10 minutes and collect the supernatant.

[0092] Detect HA-tagged protein expression by Western blot: Submit the supernatant for SDS-PAGE electrophoresis and transfer to a PVDF membrane. Block with skim milk powder and incubate with a primary antibody and then an HRP-conjugated secondary antibody. Develop with ECL chemiluminescence. Observe for the appearance of a HA-tagged protein band of the appropriate molecular weight.

[0093] The mRNA of the present invention contains a Hibit tag during construction. 10 μL of supernatant can be taken, diluted 20-fold with 190 μL of DPBS, and Nano Glo substrate is added. The chemiluminescent signal is detected using a microplate reader in a 96-well white microplate to quantitatively evaluate the protein expression level.

[0094] 5.3. Further analysis of mRNA purity and integrity.

[0095] Use the Agilent 5200 Bioanalyzer to more accurately assess the purity and integrity of mRNA samples, such as using RIN values ​​or percent integrity. Load and analyze samples according to the instrument and Agilent RNA 6000 Nano Kit instructions.

[0096] Only after passing the above quality inspection, mRNA batches with low dsRNA content, positive target protein expression, high purity and good integrity can be used for subsequent LNP encapsulation.

[0097] 6. Independent encapsulation of mRNA-lipid nanoparticles: The eight different mRNAs prepared above were independently encapsulated using lipid nanoparticles.

[0098] The lipid components of LNP include ionizable cationic lipid SM102, auxiliary lipid DSPC, cholesterol and PEGylated lipid DMG-PEG2000. The molar ratio of SM102, DSPC, cholesterol and DMG-PEG2000 is 50:10:38.5:1.5.

[0099] The concentrations of the ethanol stock solutions of the lipids were: 20 mg / mL for SM102, 10 mg / mL for DSPC, 20 mg / mL for cholesterol, and 5 mg / mL for DMG-PEG2000.

[0100] Preparation of mRNA aqueous phase: 8 types of mRNA were dissolved in 25 mM sodium acetate buffer at pH 5.0 and the mRNA concentration was adjusted.

[0101] Preparation of lipid ethanol phase: According to the above molar ratio, accurately measure the ethanol stock solution of each lipid and mix them evenly.

[0102] LNP encapsulation was performed using a Precision Nanosystems NanoAssemblr Benchtop instrument. The mRNA aqueous phase and lipid ethanol phase were mixed at a flow rate ratio of 3:1 through the microfluidic chip, and the LNP suspension was collected and stored at 4°C.

[0103] The LNP suspension was subjected to tangential flow ultrafiltration (TFF) to remove ethanol and replace the buffer. Subsequently, the suspension was concentrated using ultrafiltration centrifuge tubes to obtain eight different mRNA-LNPs, namely B1-NSH to B8-NSH, which were stored at 4°C awaiting quality control.

[0104] 7. mRNA-LNP quality inspection and packaging.

[0105] The quality of each single antigen mRNA-LNP was characterized: the average particle size, polydispersity index and Zeta potential were measured using a dynamic light scattering instrument to ensure that the particle size was in the range of 80nm~100nm and the PDI value was less than 0.2. The mRNA encapsulation efficiency was determined using the RiboGreen fluorescent dye method to ensure that the encapsulation efficiency was greater than 80%. According to the tabular data, the encapsulation efficiency of each single antigen mRNA-LNP was between 80% and 97%, and the results are shown in Table 6. B1-NSH~B8-NSH correspond to the mRNA-LNPs of B1~B8 respectively. Particle size distribution diagram is shown in Figures 1 to 8 .

[0106] Finally, qualified single antigen mRNA-LNPs were added with 5% w / v sucrose as a cryoprotectant, and the mRNA concentration was adjusted to 250 ng / μL. After sterile filtration, the mRNAs were aliquoted and frozen at -80°C.

[0107] Table 6 Encapsulation efficiency

[0108] 8. When in use, mix equal volumes of 8 qualified single antigen mRNA-LNPs to obtain the mRNA-LNP mixed vaccine expressing Brucella multi-antigens.

[0109] Example 2 Application of mixed vaccines expressing multiple Brucella antigens.

[0110] This example evaluated the ability of the mixed vaccine prepared by the present invention to induce a humoral immune response in a Balb / c mouse model. The details are as follows: 1. Vaccine dilution and mixing.

[0111] Preparation of the low-dose mixed vaccine: 0.3 mL of each 250 ng / μL mRNA-LNP stock solution of a single antigen was diluted to 150 ng / μL with 0.2 mL of Tris-HCl buffer, pH 7.4. Then, 0.15 mL of each 150 ng / μL mRNA-LNP solution was diluted to 50 ng / μL with 0.3 mL of Tris-HCl buffer, pH 7.4. Eight different mRNA-LNP working solutions of the single antigen, each at a concentration of 50 ng / μL, were mixed in equal volumes. The final mixed injection solution contained 1 μg of mRNA for each antigen and 8 μg of mRNA in total. Each mouse was injected intramuscularly with 160 μL of this mixed vaccine.

[0112] Preparation of the high-dose mixed vaccine: 0.3 mL of a 250 ng / μL mRNA-LNP stock solution of each single antigen was diluted to 150 ng / μL with 0.2 mL of Tris-HCl buffer, pH 7.4. Eight different mRNA-LNP working solutions of the single antigen, each at a concentration of 150 ng / μL, were then mixed in equal volumes. The final mixed injection contained 3 μg of mRNA for each antigen and 24 μg of mRNA in total. Each mouse was injected intramuscularly with 160 μL of this mixed vaccine.

[0113] 2. Evaluation of the immunogenicity of mRNA-LNP mixed vaccine in mice.

[0114] Eight-week-old female Balb / c mice were selected and, after one week of adaptive feeding, randomly divided into four groups of six: a low-dose group, a high-dose group, a GFP group, and a PBS group. The low-dose group was given the low-dose mixed vaccine described above; the high-dose group was given the high-dose mixed vaccine described above; the GFP group was given 8 μg of cationic liposome-encapsulated green fluorescent protein (GFP)-LNP per mouse; and the PBS group was given an equal volume of normal saline.

[0115] According to the immunization schedule, the primary immunization was performed on day 0, and the booster immunization was performed on day 21. Each group of mice was injected intramuscularly on both sides of the hind legs, with a total injection volume of 160 μL per mouse. During and after the immunization, the mental state, behavior, diet, and weight changes of the mice were observed and recorded daily. Figure 9 .

[0116] The results of weight change are shown in Figure 10After the initial immunization, all groups of mice showed growth levels consistent with normal physiological conditions, indicating that the initial immunization process did not significantly interfere with the normal growth and development of the mice, reflecting the good biocompatibility of the vaccine in the initial immunization stage. After the booster immunization, the weight of the mice decreased slightly, but within the 48-hour observation period, the weight of the mice was able to quickly return to normal levels. This result strongly proves that the vaccine has a high safety during the booster immunization process. The short-term decrease in weight may be a short-term stress response of the body to the booster immunization, but the rapid recovery to normal levels shows that the body can effectively cope with this response and no lasting adverse effects have occurred.

[0117] Blood was collected from the orbital venous plexus 14 days after the primary immunization, 7 days after the booster immunization, and 14 days after the booster immunization. After blood coagulation at room temperature, serum was separated by centrifugation at 3000 rpm for 10 minutes at 4°C and stored in aliquots at -80°C.

[0118] The indirect ELISA method was used to detect the levels of specific IgG antibodies against Brucella antigens B3, B4, B1-B4 and B5-B8 in serum.

[0119] ELISA procedure: Coat the corresponding antigen on a 96-well ELISA plate at 4°C overnight. Wash the plate the next day and block with 5% w / v skim milk powder at 37°C for 2 hours. After washing the plate, add the serum to be tested in gradient dilutions and incubate at 37°C for 1 hour. After washing the plate, add HRP-labeled goat anti-mouse IgG and incubate at 37°C for 1 hour. After washing the plate, add TMB substrate solution for color development and 2M sulfuric acid to terminate the reaction. Use an enzyme-linked microplate reader to read the absorbance value at 450nm. The antibody titer is defined as the ability to produce an OD value higher than the negative control. 450 The highest serum dilution factor was 2.1 times the mean.

[0120] ELISA results Figures 11 to 14 The results showed that compared with the PBS group and the GFP group, the low-dose group and the high-dose group were able to induce mice to produce significantly increased specific IgG antibodies against each test antigen after booster immunization, P < 0.01. This antibody response was very obvious 7 days after the booster immunization, and remained at a high level 21 days after the booster immunization, showing good immune strength and a certain degree of persistence. No specific antibody response to Brucella antigens was detected in the PBS group and the GFP group during the entire experimental process. These results confirm that the mRNA-LNP mixed vaccine prepared by the present invention has good immunogenicity. At the same time, the present invention also tested the IgG antibody levels against B1, B2 and B5~B8 antigens, and the results were consistent with those of the control group. Figure 11 and Figure 12 The results are similar and are not listed separately in the present invention.

[0121] The above results show that the mixed vaccine described in the present invention not only avoids the problem of antigen competition and can be efficiently delivered to the immune system, but also each antigen can induce a balanced immune response.

[0122] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0123] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A mixed vaccine expressing multiple Brucella antigens, characterized in that: The mixed vaccine is obtained by encapsulating active mRNA in lipid nanoparticles; The nucleotide sequence of the active mRNA is at least one of SEQ ID NO.1 to SEQ ID NO.

8.

2. The method for preparing the mixed vaccine according to claim 1, wherein The following steps are involved: Synthesize the sequences shown in SEQ ID NO. 1 to SEQ ID NO. 8, and clone them into expression vectors to obtain recombinant vectors; PCR amplification was performed using the recombinant vector as a template to obtain a linearized DNA template; The linearized DNA template was used for in vitro transcription and purification to obtain an in vitro transcription product, in which pseudouridine was substituted for natural uridine during in vitro transcription; The in vitro transcription products were encapsulated using lipid nanoparticles to obtain 8 different mRNA-lipid nanoparticles; The mixed vaccine is obtained by mixing 8 different mRNA-lipid nanoparticles.

3. The preparation method according to claim 2, wherein The expression vector is pcDNA3.

1.

4. The preparation method according to claim 2, wherein The process of encapsulating in vitro transcription products using lipid nanoparticles includes the following steps: The ionizable cationic lipid, the helper lipid, the cholesterol and the PEGylated lipid are dissolved in ethanol respectively and then mixed to obtain a lipid ethanol phase; The in vitro transcription products were dissolved in sodium acetate buffer to obtain mRNA aqueous phase; The lipid ethanol phase and the mRNA aqueous phase pass through a microfluidic device to achieve the encapsulation of in vitro transcription products by lipid nanoparticles.

5. The preparation method according to claim 4, wherein The molar ratio of the ionizable cationic lipid, the auxiliary lipid, the cholesterol and the PEGylated lipid is 50:10:38.5:1.

5.

6. The preparation method according to claim 4, wherein The ionizable cationic lipid is SM102; The helper lipid is DSPC; The PEGylated lipid is DMG-PEG2000.

7. The preparation method according to claim 4, wherein When the lipid ethanol phase and the mRNA aqueous phase are encapsulated through the microfluidic device, the flow rate ratio of the lipid ethanol phase and the mRNA aqueous phase is 1:

3.

8. The use of the mixed vaccine according to claim 1, characterized in that: The mixed vaccine is used for preparing medicines for preventing and / or treating brucellosis.

9. The use according to claim 8, characterized in that The formula of the drug is as follows: The mixed vaccine is dissolved in a Tris-HCl buffer solution having a pH of 7.4 and mixed to obtain the drug.

10. The use according to claim 8, characterized in that The medicine is suitable for any one of cattle, sheep and mice.

Images