Lateral chromatography test strip for synchronously detecting haemophilus parasuis and actinobacillus pleuropneumoniae based on dual signal amplification and application of lateral chromatography test strip

Abstract

The invention discloses a lateral chromatography test strip for synchronously detecting haemophilus parasuis and actinobacillus pleuropneumoniae based on dual signal amplification and application of the lateral chromatography test strip, and belongs to the technical field of biology. According to the invention, pathogen detection can be completed within 115 minutes by combining a lateral chromatography test strip detection technology of a dual signal amplification mechanism. The whole reaction is incubated under a room temperature condition, is not limited by a large expensive instrument, and is suitable for a scene in which the infection state needs to be quickly judged. Compared with the common detection technology at present, the method has the advantages that the haemophilus parasuis and the actinobacillus pleuropneumoniae in related samples of the porcine respiratory tract can be detected more sensitively, quickly and conveniently while high specificity and low detection limit are ensured, the dependence on professional technicians and laboratory precise instruments is avoided, and the method is suitable for popularization and application. The method is of great significance to rapid and accurate identification, monitoring and early prevention and treatment of porcine bacterial respiratory diseases.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a lateral flow test strip for synchronously detecting Haemophilus parasuis and Actinobacillus pleuropneumoniae based on dual signal amplification and an application thereof. Background Art

[0002] Bacterial respiratory diseases in pigs, particularly infections caused by Haemophilus parasuis (GPS) and Actinobacillus pleuropneumoniae (APP), have become a major bottleneck restricting the high-quality development of the pig farming industry. GPS, an opportunistic pathogen, often secondary to viral diseases, leads to high piglet mortality; APP, in turn, causes acute fibrinous pleuropneumonia, which spreads rapidly and has a high mortality rate. Co-infection between the two exacerbates pathological damage, and clinical symptoms are highly overlapping, making it difficult to differentiate using traditional observation alone, further exacerbating economic losses. Therefore, it is of great significance to establish a sensitive and efficient detection platform for the simultaneous detection of GPS and APP.

[0003] Currently, traditional methods for detecting GPS and APP have their own shortcomings. Classic microbial culture and identification techniques are time-consuming and labor-intensive, with detection times of up to 3-5 days, which greatly limits their promotion and application. Polymerase chain reaction has high requirements for operators and laboratory conditions, and the results are easily affected by the food matrix. The batch variation and cost of enzyme-linked immunosorbent assay are high, and the types of antibodies are limited. Therefore, there is an urgent need to develop a platform that can simultaneously detect GPS and APP with low cost, simple operation, rapid sensitivity, and suitable for on-site real-time quantification.

[0004] Lateral flow strips (LFA) are an important tool for rapid on-site detection of swine respiratory pathogens due to their readability and ease of operation. However, traditional LFA relies on colloidal gold (Au NPs) as a signal marker, and its sensitivity is easily affected by sample matrix interference, making it difficult to meet the needs of low-abundance pathogen detection. In contrast, nucleic acid isothermal amplification technologies (such as RPA and HCR) can significantly improve detection sensitivity (LOD reaches the single copy level) through exponential amplification of target sequences, but they rely on fluorescence reading devices or electrochemical detection, making them difficult to adapt to grassroots scenarios. Hybridization chain reaction (HCR), as an enzyme-free, isothermal nucleic acid self-assembly technology, forms long-chain DNA polymers through cascade extension of hairpin probes, combined with high-density signal markers (such as biotin), which can break through the sensitivity bottleneck of traditional LFA while retaining the portability of test strips.

[0005] Existing signal amplification strategies have significant contradictions: physical enhancement labels (such as quantum dots and fluorescent microspheres) require precision equipment; enzyme-driven amplification (such as CRISPR-Cas12a) is susceptible to nonspecific shear interference. The present invention combines the nucleic acid amplification ability of HCR with the optical signal enhancement properties of streptavidin-latex microspheres (SA-LMs) to propose a dual amplification mechanism of "cascade triggering-signal clustering": the high-density biotin-labeled DNA polymer generated by the HCR reaction specifically binds to SA-LMs, and the specific complex of GPS and APP is synchronously captured through dual detection lines (T1 / T2), thereby improving detection sensitivity. Summary of the Invention

[0006] The purpose of the present invention is to provide a lateral flow test strip and its application based on dual signal amplification for the simultaneous detection of Haemophilus parasuis and Actinobacillus pleuropneumoniae, so as to solve the problems existing in the above-mentioned prior art. The present invention can complete pathogen detection within 115 minutes by combining the lateral flow test strip detection technology with a dual signal amplification mechanism, is not limited by large and expensive instruments, and is suitable for scenarios that require rapid judgment of infection status.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a primer combination for hybridization chain reaction for synchronously detecting Haemophilus parasuis and Actinobacillus pleuropneumoniae, comprising a primer group for detecting Haemophilus parasuis and a primer group for detecting Haemophilus parasuis;

[0009] The primer set for detecting Haemophilus parasuis includes DNA hairpin probes shown as SEQ ID NO.1 and SEQ ID NO.2, a priming chain shown as SEQ ID NO.3, a target sequence shown as SEQ ID NO.4, and a capture probe shown as SEQ ID NO.5; the primer set for detecting Haemophilus parasuis includes DNA hairpin probes shown as SEQ ID NO.6 and SEQ ID NO.7, a priming chain shown as SEQ ID NO.8, a target sequence shown as SEQ ID NO.9, and a capture probe shown as SEQ ID NO.10.

[0010] Optionally, the 5' end of the capture probe shown in SEQ ID NO. 5 is modified with fluorescein, and the 5' end of the capture probe shown in SEQ ID NO. 10 is modified with digoxigenin.

[0011] The present invention also provides a lateral flow test strip for synchronously detecting Haemophilus parasuis and Actinobacillus pleuropneumoniae based on dual signal amplification, characterized in that the lateral flow test strip is composed of a nitrocellulose membrane, a sample pad, a conjugate pad and an absorption pad sequentially connected and fixed on a bottom plate;

[0012] The conjugate pad is coated with a TCBPE-labeled Escherichia coli O157:H7 detection antibody;

[0013] The nitrocellulose membrane is coated with detection lines T1, T2 and quality control line C which are separated from each other in sequence;

[0014] The detection line T1 is coated with anti-FAM antibody;

[0015] The detection line T2 is coated with anti-DIG antibody;

[0016] The quality control line C is coated with a biotin-BSA conjugate.

[0017] Optionally, the concentration of the anti-FAM antibody is 0.6 mg / mL, and the concentration of the anti-DIG antibody is 0.3 mg / mL.

[0018] Optionally, the detection lines T1 and T2 are parallel to the quality control line C and are spaced apart by the same width, and the space is 4 mm.

[0019] Optionally, the sample pad is pretreated with SSC buffer;

[0020] The SSC buffer contained 3% BSA and 0.07% Tween-20.

[0021] The present invention also provides application of the lateral flow test strip in preparing a product for synchronously detecting Haemophilus parasuis and Actinobacillus pleuropneumoniae.

[0022] Optionally, the detection includes the following steps:

[0023] Extracting RNA from the sample to be tested, performing HCR reaction using the primer combination to obtain an HCR product, and mixing the HCR product with streptavidin-latex microspheres and SSC buffer to obtain a mixed solution;

[0024] The mixed solution is tested using a lateral flow test strip, and the result is determined by color development of T1, T2 and C lines;

[0025] The SSC buffer contained 3% BSA and 0.07% Tween-20.

[0026] Optionally, the HCR reaction time is 15 min;

[0027] The volume ratio of the HCR product to streptavidin-latex microspheres and SSC buffer was 20:0.5:120.

[0028] Optionally, if the C line does not show color, it is judged as invalid;

[0029] If T1, T2 and C lines all show color, the result is positive, and it is determined that the sample contains both Haemophilus parasuis and Actinobacillus pleuropneumoniae.

[0030] If T1 and C lines develop color, the result is positive, and it is determined that the sample contains Actinobacillus pleuropneumoniae;

[0031] If the T2 and C lines show color, the result is positive, indicating that the sample to be tested contains Haemophilus parasuis.

[0032] If only line C is colored, the result is negative, indicating that the sample to be tested does not contain Haemophilus parasuis and Actinobacillus pleuropneumoniae.

[0033] The present invention discloses the following technical effects:

[0034] 1. This lateral flow strip test technology, combined with a dual signal amplification mechanism, can complete virus detection within 115 minutes. The entire reaction is incubated at room temperature, unconstrained by large, expensive instruments. It is suitable for scenarios requiring rapid assessment of infection status, such as epidemic screening during emergencies and rapid clinical diagnosis.

[0035] 2. SA-LMs combine with biotin in the HCR amplification product. Based on the precisely designed nucleic acid signal amplification capability of the hairpin probes (H1 / H2) in the HCR system and the optical signal amplification characteristics of LMs, the signal is exponentially enhanced, ensuring that the test strip can detect extremely low concentrations of target bacterial nucleic acid. It has high detection sensitivity and can still accurately detect at low bacterial concentrations.

[0036] 3. The present invention has low requirements on the operating environment and does not require special experimental equipment. Testing can be carried out at room temperature, which is convenient for on-site large-scale testing.

[0037] 4. A dual-detection line lateral flow test strip system has been constructed, enabling simultaneous detection of GPS and APP. The signals from the T1 and T2 detection lines are independent and free of cross-interference, allowing for simultaneous capture of both pathogens in mixed infection samples. The system is highly tolerant to complex matrices (such as mucin and proteases), exhibits improved sensitivity compared to traditional colloidal gold test strips, and covers a wider linear detection range, enabling rapid, simultaneous on-site testing.

[0038] In summary, the present invention provides a highly reliable solution for rapid and simultaneous on-site detection of GPS and APP, has good application prospects, and provides a convenient tool for disease monitoring in farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0040] Figure 1 PAGE electrophoresis results for feasibility verification of the APP HCR system; 1: 500bp DNA marker; 2: Initiator alone; 3: H1 alone; 4: H2 alone; 5: H1 and H2 coexistence system; 6: HCR system with initiator, H1, and H2 coexistence;

[0041] Figure 2 PAGE electrophoresis results for feasibility verification of the GPS HCR system; 1: 500bp DNA marker; 2: Initiator alone; 3: H1 alone; 4: H2 alone; 5: H1 and H2 coexistence system; 6: HCR system with initiator, H1, and H2 coexistence;

[0042] Figure 3 Schematic diagram of the working principle of the lateral flow platform for simultaneous detection of APP and GPS based on dual signal amplification technology, showing the color development mechanism of the HCR amplification product after binding to SA-LMs and capture by anti-FAM antibodies;

[0043] Figure 4 Results of feasibility validation of a lateral flow platform for simultaneous detection of APP and GPS based on dual signal amplification technology. From left to right: positive for both APP and GPS, positive for APP, positive for GPS, and negative for GPS.

[0044] Figure 5 The sensitivity verification results of the detection platform; A: APP linear fitting curve (R 2 >0.99; B: GPS linear fitting curve (R 2 >0.99); C: Color gradient of the test strips with different concentrations of APP and GPS targets (2.5pM-500nM);

[0045] Figure 6 Results of the specificity evaluation of the multiplex detection platform: from left to right: APP+GPS positive, Pasteurella multocida, Streptococcus, and Escherichia coli;

[0046] Figure 7 These are the test strip stability test results. From left to right, they are the color signal results after storage at room temperature for 0 days, 5 days, 15 days, and 30 days. DETAILED DESCRIPTION

[0047] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0048] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0049] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0050] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0051] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0052] Example 1

[0053] This invention constructs a dual-signal detection platform that combines nucleic acid amplification with optical enhancement by designing a hybridization chain reaction (HCR) system targeting conserved regions of the 16S rRNA of GPS and APP, using SA-LMs as optical signal markers and a dual-detection line lateral flow strip. The constructed lateral flow strip, based on dual signal amplification technology, is used to simultaneously detect GPS and APP, providing a simple, rapid, and sensitive method for simultaneous detection of GPS and APP. This method can also provide a reference for the development of on-site rapid multiplex detection platforms for other pathogens.

[0054] The targets and DNA hairpin probes in the APP HCR system provided by the present invention are shown in Table 1, and the targets and DNA hairpin probes in the GPS HCR system are shown in Table 2.

[0055] Table 1 Design sequence of HCR system for detecting APP

[0056]

[0057] Table 2 Design sequence of HCR system for detecting GPS

[0058]

[0059]

[0060] First, specific capture probes (CP) and priming strands (RP) were designed targeting the conserved regions of 16S rRNA for GPS and APP. Highly specific target sequences were screened through NCBI BLAST comparison to ensure detection specificity.

[0061] The APP target sequence is:

[0062] AGGGCTACACACGTGCTACAATGGCGTATACAGAGGGAAGCAAG (SEQ ID NO. 4), GPS target sequence is:

[0063] TAGGGCTACACACGTGCTACAATGGTGCATACAGAGGGTGACGA (SEQ ID NO. 9).

[0064] The 3' end of the capture probe (CP) was extended with polythymine (T) to enhance binding stability, and the 3' end was modified with fluorescein (FAM, for APP detection) and digoxigenin (DIG, for GPS detection), respectively.

[0065] The stem-loop structures of hairpin probes H1 and H2 were optimized using NUPACK simulation software to ensure stability when untriggered (free energy ΔG < -20 kcal / mol). The 5' ends were modified with biotin for signal labeling. They were stored in TE buffer (pH 8.0) until use.

[0066] When target RNA is present in the sample, the capture probe (CP) binds to the target through complementary base pairing, forming a CP-target complex. Subsequently, the initiator strand (RP) binds to the sticky ends of the complex, triggering the HCR cascade reaction. The RP first binds to the hidden sequence of H1, forcing the H1 hairpin to unfold and exposing new sticky ends. The newly exposed sequence then pairs with the H2 probe, triggering the unfolding of the H2 hairpin, forming alternating double-stranded DNA polymers. Each DNA polymer is densely modified with biotin molecules, forming a high density of signal-labeling sites. Amplification efficiency is ensured by systematically optimizing reaction conditions, including initiator concentration, incubation time, and buffer pH. Gradient experiments (100 nM to 1 μM) showed that product accumulation was maximized at 300 nM RP, with minimal hairpin probe residue. Within the 15-120 min range, product molecular weight uniformity was optimal at 90 min. Neutral conditions (pH 7.5) produced the narrowest product distribution, while acidic (pH ≤ 6.5) or alkaline (pH ≥ 8.5) environments resulted in product dispersion.

[0067] Example 2

[0068] The core components of the lateral flow test strip include a nitrocellulose membrane (NC membrane), a sample pad, a conjugate pad, and an absorbent pad. The NC membrane uses Millipore NC 90 membrane, whose larger pore size allows for smooth migration of latex microspheres (LMs) and complexes, resulting in enhanced colorimetric signal intensity compared to NC 140 membrane. The sample pad is made of polyester BX-03 fiber, soaked in blocking solution and then dried to effectively reduce nonspecific adsorption. The NC membrane is sprayed with anti-FAM antibody (T1 line, 0.6 mg / mL) and anti-DIG antibody (T2 line, 0.3 mg / mL) as test lines, and the control line (C line) is sprayed with 1 mg / mL biotin-BSA conjugate, with a line spacing of 4 mm. The components are stacked on a PVC backing in the following order: sample pad (pretreated with 25% SSC buffer (containing 3% BSA and 0.07% Tween-20)), conjugate pad, NC membrane, and absorbent pad, with a 3 mm overlap to ensure continuous chromatographic fluid flow. The cutting machine cuts the test strips into a standard size of 5 cm × 0.3 cm.

[0069] Example 3

[0070] In order to achieve simultaneous detection of GPS and APP, the problems of probe competition and signal interference need to be solved. The optimal antibody concentration ratio was determined to be T1:T2=1:2 (0.6 mg / mL anti-FAM: 0.3 mg / mL anti-DIG) through gradient experiments. Excessive anti-FAM antibody will inhibit the color development of the T2 line. The detection line spacing is set to 4 mm to balance the fluid diffusion and signal separation requirements and avoid cross-chromatographic fronts. The sample volume is optimized to 120 μL (containing 20 μL HCR product) to ensure that the complex fully migrates to the detection line while avoiding clogging of the membrane pores. The buffer solution uses 25% SSC buffer (containing 3% BSA, 0.07% Tween-20) to provide appropriate ionic strength and reduce surface tension, so that LMs are evenly dispersed.

[0071] Example 4 Detection Procedure

[0072] The sample RNA was extracted and reacted with the HCR system (in the reaction system, the concentrations of the priming chains (RP) of GPS and APP were both 300 nM, the concentrations of the hairpin probes (H1 / H2) were both 1 μM, and the cells were incubated at 37°C for 90 min. The extracted RNA and the capture probe (CP) at a concentration of 0.6 μM were then added and reacted with the HCR system at room temperature for 15 min) to generate HCR products (biotin-labeled DNA polymers).

[0073] Mix 20 μL of HCR product with 0.5 μL of streptavidin-latex microspheres (SA-LMs) and 120 μL of 25% SSC buffer (containing 3% BSA, 0.07% Tween-20), and drip the mixture vertically onto the sample pad. The liquid flow migrates along the direction of capillary action, and the chromatography process is completed within 10 minutes. The LMs-HCR complex is captured by the T-line antibody to form a red strip, and the results are determined by T1, T2, and C-line color development. The result interpretation criteria are: T1 and / or T2 lines are colored and C line is colored as positive; only C line color is determined as negative; C line does not color, and it is judged to be invalid and the test needs to be repeated. Specifically: if C line does not color, it is judged to be invalid;

[0074] If T1, T2 and C lines all show color, the result is positive, and it is determined that the sample contains both Haemophilus parasuis and Actinobacillus pleuropneumoniae.

[0075] If T1 and C lines develop color, the result is positive, and it is determined that the sample contains Actinobacillus pleuropneumoniae;

[0076] If the T2 and C lines show color, the result is positive, indicating that the sample to be tested contains Haemophilus parasuis.

[0077] If only the C line is colored, the result is negative, and it is determined that the sample does not contain Haemophilus parasuis and Actinobacillus pleuropneumoniae. Figure 4 ).

[0078] Example 5 Sensitivity, specificity and actual sample testing

[0079] Sensitivity test results are as follows Figure 5 As shown, the bacterial solution was diluted by gradient (10 2 -10 8 CFU / mL) to verify the sensitivity of the platform, and the corresponding bacterial liquid concentrations from left to right are: 10 8 CFU / mL, 10 7 CFU / mL, 10 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL and negative, the results showed that the visual detection limit (LOD) was 10 2 CFU / mL, the linear fitting LOD was 3 CFU / mL (GPS) and 7 CFU / mL (APP), and the linear range covered 10 2 -10 8 CFU / mL(R 2 >0.99).

[0080] Specific test results such as Figure 6 As shown, the platform had no cross-reaction to Escherichia coli, Streptococcus, and Pasteurella multocida, and only APP and GPS positive samples triggered T-line color development.

[0081] In the actual sample (pig oral swab) test, the spike recovery rate was 89.13%-110.66% (RSD <13.06%), confirming its strong tolerance to complex matrices. After the test strips were stored at room temperature for 30 days, the color signal intensity remained stable and the chromatography time did not change significantly, indicating that the platform has good stability ( Figure 7 , Table 3).

[0082] Table 3 Dual signal amplification technology for simultaneous detection of GPS and APP contaminated pig oral swab samples (n=3)

[0083]

[0084] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A primer combination for simultaneous detection of Haemophilus parasuis and Actinobacillus pleuropneumoniae by hybridization chain reaction, characterized in that: It includes a primer set for detecting Haemophilus parasuis and a primer set for detecting Haemophilus parasuis; The primer set for detecting Haemophilus parasuis includes DNA hairpin probes shown as SEQ ID NO.1 and SEQ ID NO.2, a priming chain shown as SEQ ID NO.3, a target sequence shown as SEQ ID NO.4, and a capture probe shown as SEQ ID NO.5; the primer set for detecting Haemophilus parasuis includes DNA hairpin probes shown as SEQ ID NO.6 and SEQ ID NO.7, a priming chain shown as SEQ ID NO.8, a target sequence shown as SEQ ID NO.9, and a capture probe shown as SEQ ID NO.

10.

2. The primer combination according to claim 1, wherein The 5' end of the capture probe shown in SEQ ID NO. 5 is modified with fluorescein, and the 5' end of the capture probe shown in SEQ ID NO. 10 is modified with digoxigenin.

3. A lateral flow test strip for simultaneous detection of Haemophilus parasuis and Actinobacillus pleuropneumoniae based on dual signal amplification, characterized in that: The lateral flow test strip is composed of a nitrocellulose membrane, a sample pad, a conjugate pad and an absorption pad which are sequentially connected and fixed on a bottom plate; The conjugate pad is coated with a TCBPE-labeled Escherichia coli O157:H7 detection antibody; The nitrocellulose membrane is coated with detection lines T1, T2 and quality control line C which are separated from each other in sequence; The detection line T1 is coated with anti-FAM antibody; The detection line T2 is coated with anti-DIG antibody; The quality control line C is coated with a biotin-BSA conjugate.

4. The lateral flow test strip according to claim 3, wherein The concentration of the anti-FAM antibody was 0.6 mg / mL, and the concentration of the anti-DIG antibody was 0.3 mg / mL.

5. The lateral flow test strip according to claim 3, wherein The detection lines T1 and T2 are parallel to the quality control line C and are spaced apart by the same width, with the spacing being 4 mm.

6. The lateral flow test strip according to claim 3, wherein The sample pad is first pretreated with SSC buffer; The SSC buffer contains 3% BSA and 0.07% Tween-20.

7. Use of the lateral flow test strip according to any one of claims 3 to 6 in the preparation of a product for the simultaneous detection of Haemophilus parasuis and Actinobacillus pleuropneumoniae.

8. The use according to claim 7, characterized in that The detection comprises the following steps: Extracting RNA from a sample to be tested, performing an HCR reaction using the primer combination of claim 1 to obtain an HCR product, and mixing the HCR product with streptavidin-latex microspheres and SSC buffer to obtain a mixed solution; The mixed solution is tested using a lateral flow test strip, and the result is determined by color development of T1, T2 and C lines; The SSC buffer contains 3% BSA and 0.07% Tween-20.

9. The use according to claim 8, characterized in that The HCR reaction time is 15 min; The volume ratio of the HCR product to streptavidin-latex microspheres and SSC buffer was 20:0.5:

120.

10. The use according to claim 8, characterized in that If the C line does not show color, it is judged as invalid; If T1, T2 and C lines all show color, the result is positive, and it is determined that the sample contains both Haemophilus parasuis and Actinobacillus pleuropneumoniae. If T1 and C lines develop color, the result is positive, and it is determined that the sample contains Actinobacillus pleuropneumoniae; If the T2 and C lines develop color, the result is positive, and it is determined that the sample to be tested contains Haemophilus parasuis; If only line C is colored, the result is negative, indicating that the sample to be tested does not contain Haemophilus parasuis and Actinobacillus pleuropneumoniae.

Images