Marker closely linked with corn smut disease resistance and application thereof

Abstract

The invention discloses a marker closely linked with corn smut resistance and application of the marker, and belongs to the technical field of molecular marker assisted breeding. According to the invention, two markers, namely qSB1 and qSB5, which are closely linked with the corn anti-tumor smut disease are found for the first time, and the qSB1 is located at the 24428166 site of the No.1 chromosome; qSB5 is located at the site 220156746 of the chromosome 5; when the basic groups marked as qSB1 and qSB5 are T and C respectively, the corn shows high resistance to the corn smut disease; the invention further provides a KASP primer for detecting two markers which are closely linked with the corn anti-tumor smut disease, and the sequence of the KASP primer of the qSB1 marker is as shown in SEQ ID NO.3-SEQ ID NO.5; a KASP primer sequence marked by the qSB5 is as shown in SEQ ID NO. 6 to SEQ ID NO. 8; the provided marker closely linked with the corn anti-tumor smut disease and the related KASP primer for detecting the marker can be used for breeding the corn anti-tumor smut disease variety and identifying the anti-tumor smut disease performance, and have important significance for saving the breeding cost, improving the breeding efficiency and shortening the breeding period.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker-assisted breeding, in particular to a marker tightly linked to corn smut resistance and an application thereof. Background Art

[0002] Corn smut, also known as powdery mildew or smut, is a worldwide fungal disease of corn caused by the fungus Ustilago maydis that limits corn production. It is a locally invasive disease that spreads on air currents. The pathogen causes swelling and tumor formation in affected tissues, which can occur at any time throughout the corn crop's growth period. It can affect all above-ground tender tissues and organs, including stems, leaves, flowers, tassels, ears, and aerial roots. Corn smut occurs in over 100 countries and regions worldwide, and according to relevant statistics, it causes yield losses of between 2% and 20% annually.

[0003] Corn smut nodules have a white to reddish-red surface, later turning to a thin, off-white to gray-black pith. Eventually, the outer membrane ruptures, releasing a dark brown powder (the pathogen's chlamydospores). Nodules on leaves and sheaths are typically small, producing little or no smut. Larger nodules on nodes and ears can cause plant stem distortion, stunted growth, and short stature. Early infestations result in small ears or even failure to produce fruit. When only individual florets are infected and develop nodules, the remaining unaffected parts can still produce fruit.

[0004] Ustilago overwinters as thick-walled spores in the soil and on diseased plant debris, becoming the primary source of infection the following year. Under natural conditions, clumped chlamydospores have a longer lifespan than dispersed spores. Even when mixed in manure, chlamydospores can still germinate, so compost mixed with diseased and damaged tissue is also a source of primary infection. As temperatures rise in spring and humidity levels become appropriate, the chlamydospores of the pathogen that overwintered on the soil surface, in shallow soil layers, on straw, or in compost germinate and produce basidiospores. These are carried by air currents and gradually cause disease in corn seedlings and mature plants. Chlamydospores on early-stage lesions can also be repeatedly infected by air currents or other media, spreading the disease.

[0005] Breeding highly resistant corn smut is the most cost-effective and fundamental method for controlling corn smut. Applying marker-assisted selection (MAS) to corn breeding offers the advantages of cost-saving, rapid, and environmentally friendly breeding. It can significantly improve breeding efficiency, shorten breeding years, and reduce the workload. This makes MAS crucial for selecting high-quality, highly resistant materials, cultivating smut-resistant varieties, and advancing research on corn smut. Therefore, identifying genes associated with smut resistance and developing linked SNP and KASP molecular markers are crucial for breeding smut-resistant varieties. Summary of the Invention

[0006] The purpose of the present invention is to provide a marker tightly linked to corn smut resistance and its application, so as to facilitate the breeding and identification of smut-resistant varieties and the study of related molecular mechanisms.

[0007] To achieve the above objectives, the present invention provides markers tightly linked to corn tumor smut resistance, namely qSB1 and qSB5; qSB1 is located at position 24428166 of chromosome 1; qSB5 is located at position 220156746 of chromosome 5; the sequence of the marker qSB1 site and its upstream 100 bp and downstream 100 bp is shown in SEQ ID NO.1; the sequence of the marker qSB5 site and its upstream 100 bp and downstream 100 bp is shown in SEQ ID NO.2.

[0008] Preferably, when the bases of markers qSB1 and qSB5 are T and C respectively, corn exhibits high resistance to corn smut.

[0009] A kit for detecting corn smut resistance comprises primers for detecting the marker closely linked to corn smut resistance.

[0010] Preferably, the primer is a KASP primer or other primer that can amplify the marker closely linked to corn smut resistance.

[0011] Preferably, the sequences of the KASP primers labeled with qSB1 are shown as SEQ ID NO.3 to SEQ ID NO.5; the sequences of the KASP primers labeled with qSB5 are shown as SEQ ID NO.6 to SEQ ID NO.8.

[0012] The invention relates to an application of a marker tightly linked to corn smut resistance as described above in corn variety breeding, wherein the corn variety is a variety highly resistant to corn smut.

[0013] A kit for detecting corn smut resistance as described above is used in corn variety breeding, wherein the corn variety is a variety with high resistance to corn smut.

[0014] Use of a marker tightly linked to corn smut resistance as described above in identifying corn smut resistance.

[0015] A use of the above-mentioned kit for detecting corn smut resistance in identifying corn smut resistance.

[0016] Therefore, the markers tightly linked to corn smut resistance and their applications provided by the present invention have the following specific technical effects:

[0017] (1) The present invention discovered for the first time two markers closely linked to corn smut resistance, namely qSB1 and qSB5. qSB1 is located at position 24428166 on chromosome 1, and qSB5 is located at position 220156746 on chromosome 5. When the bases of markers qSB1 and qSB5 are T and C, respectively, corn exhibits high resistance to corn smut.

[0018] (2) The present invention also provides KASP primers for detecting two markers closely linked to maize tumor smut resistance. The sequences of the KASP primers for the qSB1 marker are shown in SEQ ID NO.3 to SEQ ID NO.5; the sequences of the KASP primers for the qSB5 marker are shown in SEQ ID NO.6 to SEQ ID NO.8.

[0019] (3) The markers closely linked to corn smut resistance and the related KASP primers of the detection marker provided by the present invention can be used for the breeding of corn smut-resistant varieties and the identification of smut-resistant properties, which is of great significance for saving breeding costs, improving breeding efficiency, and shortening breeding years.

[0020] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0022] Figure 1 is the genotyping result in Example 1 of the present invention; wherein A is the qSB1 marker; B is the qSB5 marker;

[0023] Figure 2 is the result of the association analysis between the genotyping information and the evaluation criteria for corn seedling resistance to smut in Example 2 of the present invention; *** indicates a significant difference at the 0.001 probability level;

[0024] Figure 3 This is the result of the multiple comparison analysis in Example 3 of the present invention; A is a pie chart of the proportions of the four haplotypes; B is a violin plot of the four haplotypes;

[0025] Figure 4These are the typing results of the known highly resistant and highly susceptible maize inbred lines to smut using two markers in Example 4 of the present invention; wherein A is the typing diagram of the qSB1 marker for the five highly resistant inbred lines; B is the typing diagram of the qSB5 marker for the five highly resistant inbred lines; C is the typing diagram of the qSB1 marker for the five highly susceptible inbred lines; and D is the typing diagram of the qSB5 marker for the five highly susceptible inbred lines.

[0026] Figure 5 This is a field photo of the 10 corn inbred lines in Example 4 of the present invention, wherein A represents 5 highly resistant inbred lines, namely 8982, DM07, Q1261, e220 and P25 from left to right; B represents 5 highly susceptible inbred lines, namely 3189, LH132, Q381, D88 and P136 from left to right. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0028] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.

[0029] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources; the methods and steps not described in detail in the examples are conventional techniques in the art.

[0030] Example 1

[0031] Maize plants were genotyped using markers qSB1 and qSB5 as follows:

[0032] (1) Marker qSB1 is located at position 244281660 of chromosome 1, and marker qSB5 is located at position 220156746 of chromosome 5. The sequence of marker qSB1 and its upstream and downstream 100 bp were obtained from the Maize Genome Database (http: / / www.maizegdb.org) as shown in SEQ ID NO. 1, and the sequence of marker qSB5 and its upstream and downstream 100 bp are shown in SEQ ID NO. 2.

[0033] SEQ ID NO.1:

[0034] AGCTGCGCGTTGCCGGAGGCGGAGAAGAACCCAGTCGCCCACTTGATAGG TGATCGAACGATGAGCCCGATCATAGTGGCGCTTCTGCACCGCCTGGGCC[C / T]GCTCTAGTCGTAGACAGATGTCCTCCATGGTTCTAGCTATGGCAGCGACC CGCGTCTCGCCCTATTCATAGGATCGAATGGACGGGGGGCATGACCATAC

[0035] SEQ ID NO.2:

[0036] AATATCCATGCTGAAATCACTGTCATTCATCGTATGATTTTGCAACTCAAACT CAATTTCAAATAGACTGTCACTGAGGTGAGAGATACCACAGTCCTAT[C / T]TAGCCACTTGGTATGGGCTGCCAGGGTGTAGGACAAGGGCATGATGAAGAA TCCCAACAAACTAATTAGTGCCATGTGCTTCAGGGTACGAAAACTGATG

[0037] The KASP primers for amplifying qSB1 and qSB5 markers are shown in Table 1 , each including two upstream typing primers A and B (targeting two alleles, respectively) and a downstream universal primer C. The KASP primer sequence information in Table 1 was sent to the company for primer synthesis, and the primers were dissolved according to the instructions attached to the primers.

[0038] Table 1 KASP primer information for amplifying markers qSB1 and qSB5

[0039]

[0040]

[0041] (2) Genomic DNA was extracted from 167 maize inbred lines that had been bred in both China and the United States and provided by the Hebei Branch of the National Maize Improvement Center of Hebei Agricultural University. (The 167 maize inbred lines are heterotic groups of Chinese maize inbred lines, which widely represent the germplasm resource base of China's main maize producing areas. For detailed information on the 167 inbred lines, please refer to Yin Bingyu's 2024 master's thesis at Hebei Agricultural University. The title of the thesis is: Identification of candidate genes for maize seedling resistance to smut based on transcriptome and GWAS analysis.) After electrophoresis and Nanodrop detection, a DNA solution of good quality was selected as a template. The KASP primers shown in Table 1 were used according to the following steps: 1.5 μL DNA, 0.75 μL 2× Mastermix (KASPV4.02X Mastermix96 / 384, item number: KBS-1016-012, brand: LGC), 0.0417 μL primers, and ddH2O. The reaction system was prepared with 0.75 μL and a total volume of 3 μL. A high-throughput PCR instrument was used for PCR amplification. The amplification program was as follows: 94°C for 15 min; 94°C for 20 s, 61-55°C (gradient annealing, decreasing 0.6°C per cycle) for 60 s, 10 cycles; 94°C for 20 s, 55°C for 60 s, 26 cycles; 94°C for 20 s, 57°C for 60 s, 5 cycles.

[0042] After the PCR reaction, the fluorescence signal was converted to an analyzable value using an Omega fluorescence reader and Araya. Genotyping was then performed using Kraken™ analysis software provided by LGC (Laboratory of the Government Chemist). The results were visualized using SNPviewer software. The specific principles for determining genotypes are as follows:

[0043] If the test material shows a blue fluorescent signal at the qSB1 marker site, its genotype is homozygous CC; if it shows a deep red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is TC; black dots represent NTC empty tube controls; pink and purple indicate unknown. If the test material shows a blue fluorescent signal at the qSB5 marker site, its genotype is homozygous CC; if it shows a deep red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is TC; black dots represent NTC empty tube controls; pink and purple indicate unknown.

[0044] The results of PCR amplification using mixed primers 1-A, 1-B and 1-C (qSB1 marker) are shown in Figure 2. Figure 1As shown in A, if the primer combination completely matches the genomic DNA, the fluorescent signal of the test result is red, indicating that the tested plant is a homozygous TT genotype; if the fluorescent signal of the test result is blue, it indicates that the tested plant is a homozygous CC genotype; if the fluorescent signal of the test result is green, it indicates that the tested plant is a heterozygous CT genotype.

[0045] The results of PCR amplification using mixed primers 2-A, 2-B and 2-C (qSB5 marker) are shown in Figure 2. Figure 1 As shown in B, if the primer combination completely matches the genomic DNA, the fluorescent signal of the test result is red, indicating that the tested plant is a homozygous TT genotype; if the fluorescent signal of the test result is blue, it indicates that the tested plant is a homozygous CC genotype; if the fluorescent signal of the test result is green, it indicates that the tested plant is a heterozygous TC genotype.

[0046] Example 2

[0047] Ustilago maydis SG200 was kindly provided by Academician Regine Kahmann of the Max Planck Institute for Terrestrial Microbiology in Germany. After engineering (see Brefort T, Doehlemann G, Mendoza-Mendoza A, et al. Ustilago maydis as a Pathogen [J]. Annual Review of Phytopathology, 2009, 47: 423-445.), Ustilago maydis SG200 is able to form infectious hyphae without prior haploid mating of different genotypes. Therefore, it can infect seedling corn in the greenhouse and form nodules after disease onset (Lanver D, Tollot M, Schweizer G, et al. Ustilago maydis effectors and their impact on virulence [J]. Nature Reviews. Microbiology, 2017, 15(7): 409-421.).

[0048] Table 2 shows the disease classification of corn seedling smut, which is currently recognized by those skilled in the art. The disease index of each plant was calculated using Formula I (Pataky J K. Production of Cuitlacoche [Ustilago maydis (DS) Corda] on Sweet Corn [J]. Hort Science, 1991, 26 (11): 1374-1377.).

[0049] Disease index = 100 × ∑ (number of diseased plants at each level × disease level) / (total number of plants surveyed × highest disease level) (Formula I).

[0050] Table 2 Disease classification of corn smut at seedling stage

[0051]

[0052] The evaluation criteria for corn resistance to smut at the seedling stage are shown in Table 3.

[0053] Table 3 Evaluation criteria for corn resistance to smut at the seedling stage

[0054] Disease index resistance abbreviation 0-15.0 Highly disease-resistant (High resistance, HR) 15.1-30.0 disease resistance (Anti, R) 30.1-50.0 Moderately disease-resistant (Medium resistance, MR) 50.1-70.0 sickness (Sensation, S) 70.1-100.0 Highly susceptible (High Sensitivity, HS)

[0055] According to the evaluation criteria for corn resistance to smut at the seedling stage shown in Table 3, the genotyping information of the two markers qSB1 and qSB5 obtained in Example 1 was associated with the evaluation criteria for corn resistance to smut at the seedling stage. The results are shown in Tables 4 and Figure 2 As shown, the genotype of chromosome 1 locus 244281660 was determined to be CC or TT based on the fluorescence signal of the qSB1-KASP marker. The average disease index of corn seedlings containing the T gene was 0.3453, and the average disease index of corn seedlings containing the C gene was 0.5228. The genotype of chromosome 5 locus 220156746 was determined to be TT or CC based on the fluorescence signal of the qSB5-KASP marker. The average disease index of corn seedlings containing the T gene was 0.4401, and the average disease index of corn seedlings containing the C gene was 0.3032.

[0056] Table 4 Effects of markers qSB1 and qSB5 on maize smut resistance

[0057]

[0058] Materials with a disease index ≤ 0.3 were considered to be resistant to smut. The selection rates of markers qSB1 and qSB5 for resistant materials were evaluated (the selection rate represents the proportion of samples with a disease index ≤ 0.3 in materials carrying different allelic variations), and the size of the disease index of materials carrying excellent genotypes was analyzed. The results are shown in Table 4. The selection rates of materials with a disease index ≤ 0.3 were 49.5% and 54.5%, respectively, while the proportions of materials carrying relative genotypes were 20% and 28.9%, respectively. The above results indicate that the developed KASP markers qSB1 and qSB5 are effective in selecting materials resistant to smut.

[0059] Example 3

[0060] A study (Zill P, Büttner A, Eisenmenger W, et al. Single nucleotide polymorphism and haplotype analysis of a novel tryptophan hydroxylase isoform (TPH2) gene in suicide victims [J]. Biological psychiatry, 2004, 56(8): 581-586.) showed that using a combination of markers is more accurate than using a single marker to identify target traits. The two markers qSB1 and qSB5 provided by the present invention can form four major haplotype combinations as shown in Table 5.

[0061] Table 52 Haplotype combinations of markers

[0062] Tag Name Hap1 Hap2 Hap3 Hap4 qSB1 T T C C qSB5 T C T C

[0063] The four haplotype combinations shown in Table 5 were used to conduct multiple comparative analysis on the 167 maize inbred lines in Example 1. The results are as follows: Figure 3 As shown in Table 6, 56 accessions belonged to haplotype combination 1, with an average disease index of 0.413; 35 accessions belonged to haplotype combination 2, with an average disease index of 0.213; 14 accessions belonged to haplotype combination 3, with an average disease index of 0.519; 9 accessions belonged to haplotype combination 4, with an average disease index of 0.480; and the remaining accessions were missing genes. This indicates that different haplotype combinations have a significant effect on maize smut resistance, with haplotype combination 2 being highly resistant to smut and potentially useful for smut resistance testing and variety breeding.

[0064] Table 6 Effects of different haplotype combinations on resistance

[0065]

[0066]

[0067] Example 4

[0068] The primers in Table 1 were used to analyze the loci qSB1 and qSB5 of the currently known highly resistant maize inbred lines DM07, Q1261, e220, P25 and 8982 and the highly susceptible (non-resistant) maize inbred lines D88, P136, LH132, 3189 and Q381 (for information on highly resistant and non-resistant maize inbred lines, see Yin Bingyu's 2024 master's thesis at Hebei Agricultural University, titled "Identification of candidate genes for maize seedling resistance to maize smut based on transcriptome and GWAS analysis"), using the same method as in Example 1. The results are as follows: Figure 4 As shown in Table 7, the results for marker qSB1 of the five highly resistant inbred lines showed that all five had the TT genotype. The results for marker qSB5 showed that four had the CC genotype and one had the TT genotype. The results for marker qSB1 of the five highly susceptible inbred lines showed that two had the TT genotype and three had the CC genotype. The results for marker qSB5 showed that all five had the TT genotype.

[0069] In single-marker testing, the screening rates for the dominant gene in highly resistant inbred lines using two markers were 100% (TT) and 80% (CC), respectively. The screening rate for the multi-marker approach was 80% (TC). The screening rates for the dominant gene in highly susceptible inbred lines using two markers were 60% (CC) and 100% (TT), respectively. The multi-marker approach had a screening rate of 60% (CT). Therefore, markers qSB1 and qSB5 have a certain degree of screening ability for both highly resistant and highly susceptible inbred lines and can be used in subsequent screening for disease-resistant inbred lines.

[0070] Five highly resistant inbred lines and five highly susceptible inbred lines were tested in the field. Figure 5 As shown, the five highly resistant inbred lines showed no disease or slight discoloration, while the five highly susceptible inbred lines showed severe disease, which proved the accuracy and practicability of the marker.

[0071] Table 7 Bases of qSB1 and qSB5

[0072]

[0073] Therefore, the present invention discovered for the first time two markers closely linked to corn tumor smut resistance, namely qSB1 and qSB5, wherein qSB1 is located at position 24428166 of chromosome 1; qSB5 is located at position 220156746 of chromosome 5; when the bases of markers qSB1 and qSB5 are T and C, respectively, corn exhibits high resistance to corn tumor smut; also provided are KASP primers for detecting the two markers closely linked to corn tumor smut resistance, the KASP primer sequences of the qSB1 marker are shown as SEQ ID NO.3 to SEQ ID NO.5; the KASP primer sequences of the qSB5 marker are shown as SEQ ID NO.6 to SEQ ID NO.8; the provided markers closely linked to corn tumor smut resistance and the related KASP primers for detecting the markers can be used for breeding corn tumor smut-resistant varieties and identifying tumor smut resistance, and are of great significance for saving breeding costs, improving breeding efficiency, and shortening breeding years.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A marker tightly linked to maize smut resistance, characterized in that: Markers are qSB1 and qSB5; qSB1 is located at position 24428166 of chromosome 1; qSB5 is located at position 220156746 of chromosome 5; the sequence of the marker qSB1 site and its upstream and downstream 100 bp are shown in SEQ ID NO. 1; The sequence of the marker qSB5 site and its upstream 100 bp and downstream 100 bp is shown in SEQ ID NO.

2.

2. The marker tightly linked to corn tumor smut resistance according to claim 1, characterized in that: When the bases of markers qSB1 and qSB5 are T and C respectively, corn shows high resistance to corn smut.

3. A kit for detecting resistance to corn smut, characterized in that: The invention comprises primers for detecting the marker tightly linked to the corn tumor-resistant smut according to claim 1 or 2.

4. A kit for detecting resistance to corn smut according to claim 3, characterized in that: The primers are KASP primers or other primers that can amplify markers closely linked to corn smut resistance.

5. A kit for detecting resistance to corn smut according to claim 4, characterized in that: The sequences of the KASP primers labeled with qSB1 are shown in SEQ ID NO.3 to SEQ ID NO.5; the sequences of the KASP primers labeled with qSB5 are shown in SEQ ID NO.6 to SEQ ID NO.

8.

6. Use of a marker tightly linked to resistance to corn smut according to claim 1 or 2 in corn variety breeding, characterized in that: The corn variety is highly resistant to smut.

7. Use of the kit for detecting resistance to corn smut according to any one of claims 3 to 5 in corn variety breeding, characterized in that: The corn variety is highly resistant to smut.

8. Use of the marker tightly linked to corn smut resistance as claimed in claim 1 or 2 in identifying corn smut resistance.

9. Use of the kit for detecting corn smut resistance according to any one of claims 3 to 5 in identifying corn smut resistance.

Images