Interference sequence for improving drought tolerance of brassica napus and application thereof

By using RNA interference technology targeting the BnaA7.ARF17 gene in Brassica napus to reduce its expression level, the problem of growth limitation of Brassica napus under drought conditions was solved, drought resistance was improved and gene regulation was achieved, and the yield and quality of rapeseed in arid areas were enhanced.

CN120505312BActive Publication Date: 2026-07-24SOUTHWEST UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTHWEST UNIV
Filing Date
2025-05-19
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Brassica napus grows under drought conditions. Traditional breeding and molecular marker-assisted selection techniques are inefficient and difficult to precisely regulate specific genes. Existing gene editing technologies are not widely used in Brassica napus. The function of the ARF17 gene is unclear, which affects its drought resistance improvement.

Method used

By designing antisense sequences and RNA interference hairpin structures targeting the BnaA7.ARF17 gene in Brassica napus, the expression level of the gene was reduced. An RNA interference vector was constructed and introduced into the hypocotyl of Brassica napus using Agrobacterium tumefaciens-mediated transformation. Combined with screening and identification procedures, transgenic lines with significantly reduced expression levels of the BnaA7.ARF17 gene were obtained.

Benefits of technology

It significantly enhances the drought resistance of Brassica napus, improves yield and quality under drought conditions, and provides an efficient means of gene regulation and genetic improvement, suitable for large-scale gene function verification and plant genetic transformation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505312B_ABST
    Figure CN120505312B_ABST
Patent Text Reader

Abstract

The application discloses an interference sequence for improving drought resistance of Brassica napus and application thereof, wherein the interference sequence targets BnaA7.ARF17 gene in the Brassica napus, and the interference sequence can reduce the expression level of the gene, and the interference sequence is an antisense sequence or an RNA interference hairpin structure of SEQ ID NO:1. By targeting the BnaA7.ARF17 gene in the Brassica napus and using the antisense sequence or the RNA interference hairpin structure thereof, the expression level of the gene can be accurately and efficiently reduced, so that the drought resistance of the Brassica napus is significantly improved, an effective gene regulation strategy for coping with drought stress is provided, the yield and quality of the Brassica napus under drought conditions are improved, and the biological technology means for improving the drought resistance of Brassica plants is expanded.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and genetic engineering technology, specifically relating to a method for treating Brassica napus. BnaA7.ARF17 Interference sequences for genes, methods for constructing RNA interference vectors, methods for improving drought resistance in Brassica napus, and related applications. Background Technology

[0002] Brassica napus ( Brassica napus Brassica napus is one of the world's most important oilseed crops, with high oil content in its seeds, widely used in edible oil and biofuel production. Statistics show that my country's rapeseed planting area consistently exceeds 7 million hectares, accounting for one-third of the world's total planting area, and its rapeseed oil production accounts for approximately 47% of the country's total vegetable oil production. However, rapeseed is highly susceptible to drought stress during its growth process. Due to its high water requirement and poor drought resistance during its growth period, drought leads to reduced seedling establishment rate, slow growth, and leaf wilting, ultimately resulting in a significant decline in yield and quality. With the intensification of global climate change, the frequency and intensity of droughts are increasing year by year, further threatening the stable and high yields of rapeseed.

[0003] Currently, drought resistance improvement in Brassica napus mainly relies on traditional breeding and marker-assisted selection (MAG). However, traditional breeding is time-consuming, inefficient, and difficult to precisely regulate specific genes; while MAG relies heavily on natural variation, resulting in limited gene resources. In recent years, gene editing technologies (such as CRISPR-Cas9) and transgenic technologies have provided new avenues for crop stress resistance improvement, but related research has largely focused on model plants (such as Arabidopsis thaliana) or a few key genes (such as DREB and NAC transcription factors), and the exploration of specific regulatory networks in Brassica napus remains insufficient.

[0004] Auxin response factors (ARFs) are key transcription factors regulating plant growth, development, and stress responses. Among them, the ARF17 gene has been shown to negatively regulate drought tolerance in plants by inhibiting antioxidant enzyme activity and promoting the accumulation of reactive oxygen species (ROS). For example, overexpression of MdARF17 in apple trees leads to increased drought sensitivity, while knocking out this gene significantly improves drought resistance. However, the function of ARF17 in Brassica napus remains unclear, and the application of targeted regulation techniques for this gene (such as RNA interference) in improving drought tolerance is still lacking. Summary of the Invention

[0005] To address the aforementioned problems, this invention proposes for the first time to target the RNA interference in rapeseed. BnaA7.ARF17 Genes are used to reduce their expression levels, thereby enhancing the plant's drought resistance.

[0006] Through long-term exploration and experimentation, and continuous reform and innovation, the inventors have addressed the above-mentioned technical problems by providing an interference sequence that improves the drought resistance of Brassica napus. This interference sequence targets specific components of Brassica napus. BnaA7.ARF17 Genes, the ones mentioned BnaA7.ARF17 The nucleotide sequence of the gene is shown in SEQ ID NO:1. The interfering sequence can reduce the expression level of the gene and contains any of the following sequences or their functionally equivalent variants: (a) The antisense sequence of the nucleotide sequence shown in SEQ ID NO:1; (b) An RNA interference hairpin structure formed by connecting SEQ ID NO:1 and its antisense sequence through a spacer region.

[0007] Compared with the prior art, the beneficial effects of the present invention are as follows: By targeting rapeseed BnaA7.ARF17 By utilizing the antisense sequence or RNA interference hairpin structure of the gene, the expression level of the gene can be precisely and efficiently reduced, thereby significantly enhancing the drought resistance of Brassica napus. This provides an effective gene regulation strategy for coping with drought stress, helps to improve the yield and quality of Brassica napus under drought conditions, and expands the biotechnological means for improving the drought resistance of Brassica genus plants in the Brassicaceae family.

[0008] Further: the functionally equivalent variant is a nucleotide sequence that has at least 80% homology with SEQ ID NO:1 or its antisense sequence, and is capable of enabling... BnaA7.ARF17 The gene expression level is reduced to less than 50% of that of the wild type.

[0009] Furthermore, the interference sequence is inserted into the pFGC5941M vector via homologous recombination. The promoter of the vector is a 35S promoter, and the interference sequence is located after the promoter and before the spacer region, or after the spacer region and before the terminator.

[0010] The present invention also provides a method for constructing an RNA interference vector of the interference sequence, comprising the following steps: (1) Design primer pairs that specifically amplify the sense and antisense sequences of SEQ ID NO:1, wherein the primers contain BamHI and XbaI restriction sites; (2) Using rapeseed cDNA as a template, sense and antisense sequences were obtained by PCR amplification; (3) The sense and antisense sequences were inserted into the pFGC5941M vector using BamHI and XbaI restriction sites to form an RNA interference vector containing a 35S promoter. (4) The RNA interference vector was transformed into Agrobacterium tumefaciens strain GV3101.

[0011] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides an efficient method for constructing RNA interference vectors. By designing primer pairs containing specific restriction enzyme sites (BamHI and XbaI), PCR amplification is performed using *Brassica napus* cDNA as a template to obtain sense and antisense sequences, which are then inserted into the pFGC5941M vector to form an RNA interference vector containing a 35S promoter. This vector is then transformed into *Agrobacterium tumefaciens* strain GV3101. Compared with existing technologies, this method has the following significant advantages: First, careful primer design and selection of appropriate restriction enzyme sites ensure the accuracy of the amplified fragments and the high efficiency of directed cloning, thereby improving the success rate and stability of vector construction. Second, the *Agrobacterium tumefaciens*-mediated transformation method achieves efficient transformation and stable integration of the RNA interference vector into *Brassica napus*, providing a reliable tool for gene function research and crop genetic improvement. Finally, this method is simple to operate, low in cost, and easily reproducible, suitable for large-scale gene function verification and plant genetic transformation research, and is of great significance for promoting the development of drought resistance improvement in *Brassica napus* and related biotechnology fields.

[0012] This invention also provides a method for improving the drought resistance of Brassica napus, comprising the following steps: (1) The constructed RNA interference vector was introduced into the hypocotyl of Brassica napus via Agrobacterium tumefaciens-mediated transformation; (2) Infected hypocotyls were co-cultured in M1 medium without resistance, and then transferred to M2 and M3 for selection, callus induction, dedifferentiation and redifferentiation, and then transferred to M4 medium to induce rooting. (3) Detection of transgenic plants by qRT-PCR BnaA7.ARF17 Gene expression levels were assessed, and strains with expression levels 50% lower than the wild type were selected. (4) The selected strains were subjected to drought stress treatment, and drought-resistant strains with a survival rate at least 30% higher than that of wild-type J9709 were selected.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a method for improving the drought resistance of Brassica napus. The method involves introducing a constructed RNA interference vector into the hypocotyl of Brassica napus and utilizing a complete screening and identification process, including hygromycin screening, callus induction, shoot regeneration and rooting culture, as well as qRT-PCR detection and drought stress experiments, to accurately screen for... BnaA7.ARF17Transgenic lines with significantly reduced gene expression and significantly improved drought resistance. Compared with existing technologies, this method is not only highly efficient and stable, but also highly operable and reproducible. It significantly improves the drought resistance of Brassica napus, providing strong technical support for breeding new Brassica napus varieties adapted to arid environments. This method helps to improve the yield and quality of rapeseed in arid regions and is of great significance for ensuring my country's edible oil security and sustainable agricultural development.

[0014] Furthermore, the specific steps of the Agrobacterium tumefaciens-mediated method include: Hypocotyls of Brassica napus were cut into 0.8-1 cm segments and immersed in Agrobacterium tumefaciens solution with an OD600 of 0.8 for 7 minutes. The infected hypocotyls were then cultured in the dark on M1 medium for 24 hours. They were then transferred sequentially to M2 medium to induce callus, M3 medium to promote shoot regeneration, and M4 medium to induce rooting.

[0015] Furthermore: the primers used in the qRT-PCR detection are: BnaA7.ARF17-qPCR-F: 5'-AAGATGGCTATGGAGACTGA-3'; BnaA7.ARF17-qPCR-R: 5'-GTTTTGCAGAATTCTCAGGTTC-3'.

[0016] Furthermore, the drought stress treatment involved stopping watering for 4-6 days during the seedling stage, then re-watering and calculating the survival rate. Interference lines with a higher survival rate than wild-type J9709 were then screened.

[0017] The present invention also provides an application of the interference sequence in improving the drought resistance of Brassica plants in the Brassicaceae family, the application comprising introducing the interference sequence into plant cells to inhibit the expression of the ARF17 homolog gene.

[0018] Preferably, the Brassica genus plants of the Brassicaceae family include rapeseed.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: The application of the interference sequence provided by this invention in improving the drought resistance of Brassica plants (Brassica oleracea var. rubrum) in the Brassicaceae family: By introducing the interference sequence into plant cells to inhibit the expression of the ARF17 homologous gene, the drought resistance of plants is effectively enhanced, providing new gene resources and efficient technical means for drought-resistant breeding of Brassica oleracea plants.

[0020] The present invention also provides a plant cell in which the aforementioned interfering sequence is integrated, and the plant cell... BnaA7.ARF17 The gene expression level is lower than that of wild-type cells.

[0021] Compared with existing technologies, the beneficial effects of this technical solution are as follows: The plant cells containing interfering sequences provided by this invention achieve effective integration of interfering sequences to control plant cells containing interfering sequences. BnaA7.ARF17 Precise inhibition of gene expression, resulting in significantly lower expression levels than wild-type cells, provides a crucial cellular material basis for cultivating drought-resistant Brassica species and facilitates the efficient development of drought-resistant varieties. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.

[0023] Figure 1 yes BnaA7.ARF17 A gene visualization of the sequence. Figure 1 In the diagram, the yellow-labeled sequences are promoters and terminators, the red-labeled sequences are 5'UTRs, the green-labeled sequences are 3'UTRs, the gray-labeled sequences are introns, and the other sequences are exons.

[0024] Figure 2 Arabidopsis thaliana and rapeseed BnaA7.ARF17 Schematic diagram of overexpression and interference vector structure. Figure 2 In the middle, A. Arabidopsis thaliana and rapeseed BnaA7.ARF17 Schematic diagram of the overexpression vector structure; B. Rapeseed BnaA7.ARF17 Schematic diagram of the interference carrier structure.

[0025] Figure 3 It is Arabidopsis thaliana pro BnaA7.ARF17 :Schematic diagram of GUS expression vector structure.

[0026] Figure 4 yes BnaA7.ARF17 Subcellular localization map of transient expression in tobacco.

[0027] Figure 5 yes BnaA7.ARF17 Tissue-specific expression analysis diagram.

[0028] Figure 6 It is the overexpression of various Arabidopsis thaliana lines and the overexpression and interference lines of rapeseed. BnaA7.ARF17 The amount of expression. Figure 6 In the middle, A. Arabidopsis thaliana BnaA7.ARF17 Overexpression lines BnaA7.ARF17 Relative expression level; B. Rapeseed BnaA7.ARF17 Overexpression lines BnaA7.ARF17Relative expression level; C. Rapeseed BnaA7.ARF17 Interference strains BnaA7.ARF17 Relative expression level.

[0029] Figure 7 It is overexpression, interference BnaA7.ARF17 Statistical chart of the response and survival rate of genetically modified rapeseed to soil drought stress. Figure 7 In the image, A. Phenotypic diagram of the response of rapeseed overexpressing and interfering lines to soil drought stress; B. Statistical diagram of the survival rate of rapeseed Bna.A7.ARF17 overexpressing and interfering lines after drought.

[0030] Figure 8 This is a phenotypic diagram and survival rate statistics of Arabidopsis thaliana overexpression lines in response to soil drought stress. Figure 8 In the image, A. Phenotypic diagram of the response of Arabidopsis thaliana overexpression lines to soil drought stress; B. Statistical graph of the survival rate of Arabidopsis thaliana overexpression lines after drought. Detailed Implementation

[0031] The following description is based on specific embodiments.

[0032] In this invention, unless otherwise specified, all equipment and raw materials are available from the market or commonly used in the industry. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0033] Example 1 Rapeseed (Brassica napus) is an oilseed crop, and drought stress severely affects its growth, development, and yield. This embodiment aims to provide a method for targeting drought stress in rapeseed. BnaA7.ARF17 Interference sequences in the gene can enhance the drought resistance of Brassica napus by reducing the expression level of that gene. BnaA7.ARF17 Gene structure of sequence such as Figure 1 As shown. Based on the research results of our research group, BnaA7.ARF17 Overexpression of this gene reduces drought resistance in Brassica napus. Therefore, this gene was selected as a target gene, and interference sequences were designed to reduce its expression level.

[0034] The construction of the interference sequence includes: (1) Antonym sequence design: BnaA7.ARF17 Based on the nucleotide sequence of the gene (as shown in SEQ ID NO:1), its antisense sequence is designed. The antisense sequence can interact with... BnaA7.ARF17 The gene's mRNA complements and binds, preventing its translation process and thus reducing the gene's expression level.

[0035] (2) Construction of RNA interference hairpin structure: The sense and antisense sequences of SEQ ID NO:1 are connected by a spacer region to form an RNA interference hairpin structure. This hairpin structure can be recognized and processed into small interfering RNA (siRNA) in plant cells, specifically targeting... [[ID= The mRNA of a gene is degraded, thereby reducing the gene's expression level.

[0036] according to ​ Gene sequence-specific primers were designed, and the primer sequences are as follows: ​ -F7: GCCACTAGTATGTCCGCCGCCGCCGT (SpeI); ​ -R7: CTGGCGCGCCCATGCCTTGAGCA (Sgrl / AscI).

[0037] PCR amplification: Using rapeseed cDNA as a template, PCR amplification was performed using the primers described above to obtain... ​ Gene fragments.

[0038] In vitro transcription reaction: After purifying the PCR product, in vitro transcription was performed using an in vitro transcription kit (such as the T7 RiboMAX™ Express RNAi System, Promega) to synthesize RNA with interfering sequences.

[0039] By designing for ​ The interference sequence of the gene, including its antisense sequence and RNA interference hairpin structure, was obtained through in vitro transcription and verification. This successfully yielded an interference sequence that effectively reduced the gene's expression level. This lays the foundation for subsequently using this interference sequence to improve the drought resistance of Brassica napus. In subsequent embodiments, the interference sequence was inserted into an RNA interference vector and further introduced into Brassica napus plants through genetic transformation to improve its drought resistance.

[0040] Example 2 This embodiment aims to construct a target that incorporates the design of Embodiment 1. ​ An RNA interference vector containing a gene interference sequence will be used in subsequent research to improve the drought resistance of Brassica napus. By inserting the interference sequence into a suitable plant expression vector, stable expression of the interference sequence within plant cells can be achieved, thereby reducing... ​ The gene expression level enhances the drought resistance of Brassica napus.

[0041] (I) Selection and preparation of carrier The pFGC5941M vector was selected because it has a 35S promoter, which can drive the efficient expression of the inserted sequence in plants. Simultaneously, this vector contains a kanamycin resistance gene, facilitating subsequent screening of successfully transformed plants.

[0042] (II) Primer Design and Synthesis according to ​ Based on the gene sequence, primer pairs were designed to specifically amplify the sense and antisense sequences. The primers contain BamHI and XbaI restriction sites to insert the amplification product into the pFGC5941M vector. The primer sequences are as follows: Justice sequence primers: ​ -RNAi-F1; Antisense sequence primers: ​ -RNAi-R1.

[0043] (III) PCR Amplification Template preparation: Using rapeseed cDNA as a template.

[0044] PCR reaction system: A 50 μL system was used, containing 1 μL template cDNA, 10 μL 5×Buffer, 5 μL dNTPs (2.5 mM), 1 μL forward primer, 1 μL reverse primer, 1 μL Taq enzyme, and the remainder ddH2O.

[0045] Reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles; final extension at 72℃ for 10 min.

[0046] (iv) Enzyme digestion and ligation Enzyme digestion: The PCR product and pFGC5941M vector were digested with BamHI and XbaI, respectively, and reacted at 37℃ for 2 h.

[0047] Ligation reaction: The enzyme-digested sense and antisense sequences were ligated with the vector by adding T4 DNA ligase and ligating at 16°C for 2 h.

[0048] (v) Transformation and Screening E. coli transformation: The ligation product was transformed into competent E. coli cells, plated on LB agar plates containing kanamycin, and incubated at 37°C for 12-16 h.

[0049] Positive clone screening: Single colonies were picked for PCR identification and sequencing to confirm that the interfering sequence was correctly inserted into the vector.

[0050] This embodiment successfully constructed a system containing... ​ The RNA interference vector containing the interfering sequence was named pFGC5941M- ​ -RNAi. Verification by double enzyme digestion and sequencing showed that the interference sequence was correctly inserted into the vector after the 35S promoter, before the spacer region, or after the spacer region and before the terminator (see Figure 2 for the specific structure).

[0051] Arabidopsis transformation Transformation method: pFGC5941M- was transformed using the inflorescence staining method. ​ -RNAi vector was transformed into wild-type Arabidopsis thaliana.

[0052] Screening process: Transformed Arabidopsis seeds were sown on MS medium containing hygromycin, and positive seedlings were screened out.

[0053] Result: Multiple results obtained ​ The interference with Arabidopsis thaliana lines provided materials for subsequent studies on the effects of interference sequences on drought tolerance in Arabidopsis thaliana. See also ​ , ​ It is Arabidopsis thaliana pro ​ Schematic diagram of GUS expression vector structure: depicts the structure used for analysis ​ Structure of a GUS reporter gene vector with gene promoter activity. The figure shows... ​ The gene's promoter sequence is linked to the GUS reporter gene and positioned downstream of the 35S promoter for research purposes. ​ The expression patterns of the gene in different tissues and developmental stages of Arabidopsis thaliana provide important evidence for understanding the gene's function and regulatory mechanism.

[0054] Rapeseed plants obtained Construction of overexpression vectors: based on ​ Specific amplification primers were designed based on the gene CDS sequence, and these primers were inserted into the DsRed vector to construct an overexpression vector.

[0055] Construction of interference vectors: targeting ​ The interference sequence of the gene was inserted into the pFGC5941M vector to construct the interference vector.

[0056] Genetic transformation: Agrobacterium tumefaciens-mediated hypocotyl genetic transformation was used to transform the overexpression vector and interference vector into the Brassica napus variety J9709, respectively.

[0057] Screening and identification: Highly expressed overexpression lines and interference lines with good interference effects were obtained through DNA molecular positive identification and qRT-PCR detection.

[0058] This embodiment successfully constructed a target-containing...​ An RNA interference vector containing gene interference sequences was developed, and stable transformation of this vector in Arabidopsis thaliana and Brassica napus was achieved, providing a key material basis for subsequent research on using this interference sequence to improve the drought resistance of Brassica napus.

[0059] Example 3 This embodiment aims to utilize the targeted system constructed in Embodiment 2. ​ RNA interference vectors containing gene interference sequences were introduced into rapeseed plants through genetic transformation. Interference lines with improved drought resistance were then screened out, thus providing an effective technical means for improving the drought resistance of rapeseed.

[0060] (I) Plant materials and culture conditions Plant material: The rapeseed variety J9709 was selected as the recipient material.

[0061] Culture conditions: After sterilization, rapeseed seeds were sown in MS medium. The culture conditions were 22℃ / 16 h light and 20℃ / 8 h darkness, with a light intensity of 3000 lx.

[0062] (ii) Agrobacterium transformation Preparation of Agrobacterium strain: The RNA interference vector pFGC5941M- constructed in Example 2 was used... ​ -RNAi transformation was performed on Agrobacterium tumefaciens strain GV3101.

[0063] Agrobacterium culture: Select a single colony and inoculate it into YEB liquid medium containing kanamycin, and culture it in a shaker at 28°C until the OD600 is about 0.8.

[0064] (III) Preparation and Infection of Rapeseed Hypocotyl Preparation of hypocotyls: Seeds of Brassica napus J9709 were cultured in MS medium for 7 days to obtain hypocotyls.

[0065] Hypocotyl cutting and infection: Cut the hypocotyl into small segments of 0.8-1 cm, place them in a sterile petri dish, add the above-cultured Agrobacterium tumefaciens solution, and gently shake to infect for 7 minutes.

[0066] (iv) Screening and identification Screening process: Infected hypocotyls were placed in M1 medium and cultured in the dark for 24 hours, and then transferred sequentially to M2, M3, and M4 mediums to induce callus, shoot regeneration, and rooting, respectively. M1 and M4 mediums were free of resistance, while M2 and M3 mediums contained hygromycin.

[0067] Identification of positive plants: Detection of positive plants in transgenic plants by qRT-PCR. ​Gene expression levels were used to screen for strains with expression levels lower than 50% of the wild type.

[0068] (v) Drought stress treatment and drought tolerance assessment Drought stress treatment: The selected interference lines and wild-type rapeseed were subjected to drought stress treatment, that is, watering was stopped for 4-6 days during the seedling stage.

[0069] Drought tolerance assessment: Observe and record phenotypic changes in plants, including the degree of leaf wilting and drying. After rewatering, count the survival rate of plants to assess the drought tolerance of the affected lines.

[0070] III. Results and Validation (I) Obtaining and Identifying Transgenic Plants Screening of positive plants: Multiple positive plants were obtained through hygromycin screening and qRT-PCR detection. ​ Positive interference lines with gene expression levels lower than 50% of the wild type.

[0071] Gene expression level detection: qRT-PCR results showed that in the interference lines ​ The significantly reduced gene expression level indicates that the RNA interference vector successfully expressed the interference sequence in rapeseed plants and effectively suppressed the expression of the target gene.

[0072] (II) Results of drought resistance assessment Phenotypic observation: After drought treatment, the affected strains showed less wilting of leaves, a smaller area of ​​drying, and overall better growth than the wild-type plants.

[0073] Survival rate statistics: After rehydration, the survival rate of the disturbed strain was at least 30% higher than that of the wild type J9709, indicating that the disturbance... ​ Gene expression can significantly enhance the drought resistance of Brassica napus.

[0074] ​ It is overexpression, interference ​ Statistical chart of the response and survival rate of genetically modified rapeseed to soil drought stress. ​ A represents two overexpressing rapeseed lines OE- ​ -2、OE- ​ -5. Two interfering rapeseed lines Ri- ​ -6、Ri- ​ -7 Phenotypic diagram of wild-type rapeseed J9709 under drought and rehydration treatments. ​ Figure B is a statistical graph showing the survival rates of wild-type rapeseed, two overexpressing rapeseed lines, and two interference rapeseed lines after drought stress and rehydration treatments. The results further demonstrate the effectiveness of overexpression... ​ It will reduce the drought resistance of rapeseed; ​ Low expression of [a specific substance] can improve the drought resistance of rapeseed.

[0075] This embodiment utilizes the RNA interference vector constructed in Example 2, and successfully obtains [the desired result] through Agrobacterium-mediated genetic transformation. ​ Disruption lines of Brassica napus with reduced gene expression. These disruption lines showed significantly increased survival rates under drought stress, indicating that RNA interference technology can inhibit... ​ Gene expression is an effective method to improve the drought resistance of Brassica napus. This achievement provides important genetic resources and technical support for improving the drought resistance of Brassica napus.

[0076] Example 4 This embodiment describes in detail... ​ Gene cloning, ​ Arabidopsis transformation with overexpression vectors ​ The specific steps for obtaining rapeseed plants with overexpression and interference vectors are as follows.

[0077] I. Gene Cloning: (1) Trizol method for RNA extraction: Place the leaf sample into a 2ml centrifuge tube, add 3 steel balls, flash freeze in liquid nitrogen, and then sample twice using a sampler at 35Hz for 45s until the sample is fully broken down. Add 1ml of RNA isolater, vortex until a coffee-colored emulsion forms, and centrifuge at 12000rpm at 4℃ for 5 minutes. Transfer 900ul of supernatant to an RNase-free tube, add 180ul of chloroform, vortex to form an emulsion, and incubate on ice for 5 minutes to separate the layers. Centrifuge at 12000rpm at 4℃ for 15 minutes. Transfer 400ul of supernatant to an RNase-free centrifuge tube, add an equal volume of pre-chilled isopropanol, invert to mix, and incubate on ice for 10 minutes. Centrifuge at 12000rpm at 4℃ for 10 minutes. Discard the supernatant, add 1ml of 75% ethanol, wash by pipetting, and incubate on ice for 5 minutes. Centrifuge at 12000rpm at 4℃ for 5 minutes, and discard the supernatant. The precipitate was dried on ice for 2 min, and 50 μL of RNase-free ddH2O was added to dissolve the RNA. The concentration and purity of the extracted RNA were measured, and the extracted RNA was stored at -80°C.

[0078] (2) RNA reverse transcription The reverse transcription kit from Beijing Qingke Company was used.

[0079] a) Remove gDNA: Add the corresponding components according to the table below.

[0080]

[0081] b) Place the sample in a PCR instrument at 42°C for 2 min, and then place it on ice after completion; c) Reverse transcription reaction: Add the components according to the table below.

[0082]

[0083] d) Place the sample in the PCR instrument and process it according to the program of 37℃ for 15 min and 85℃ for 5 s. After completion, place the sample on ice. e) Detect whether the cDNA reverse transcription was successful, and store the successful cDNA in a -20°C freezer.

[0084] (3) PCR amplification was performed using cDNA from rapeseed leaves as a template. The amplification system is as follows: FastPfu DNA polymerase PCR reaction system

[0085] (4) Glue recycling Run the amplified product on a gel, and cut a piece of the target band into a test tube. Add Buffer B2 and heat in a water bath to solvent. Transfer the sol to an adsorption column, centrifuge at 12000 rpm for 1 min, and discard the liquid in the collection tube. Add Wash Solution, centrifuge at 12000 rpm for 1 min, discard the collection liquid, and repeat this step once. Discard the collection liquid and centrifuge for 1 min. Discard the collection tube, place the adsorption column into a centrifuge tube, add 20-30 μL of ddH2O to the adsorption column, centrifuge for 1 min, and preserve the gel recovery product.

[0086] (5) Enzyme digestion and ligation The gel-recovered product was digested with BamHI and speI and then ligated using T4 ligase. The product was then used for E. coli transformation.

[0087] The double enzyme digestion reaction system is as follows:

[0088] After adding the samples according to the above system, place them on a PCR instrument at 37℃ for 30 min for enzyme digestion. Then, perform agarose gel electrophoresis on the digested samples for detection and gel recovery. Connect the obtained products to the PCR instrument at 25℃ for 2 h according to the following system.

[0089] The connection system is as follows:

[0090] (6) Escherichia coli transformation The ligation product was mixed with competent cells and incubated on ice for 30 min, followed by heat shock at 42°C. After heat shock, the mixture was quickly incubated on ice for 2 min, and antibiotic-free LB medium was added. The mixture was then restored at 37°C for 1 h, centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the precipitate was thoroughly mixed and spread onto kanamycin-resistant LB medium and incubated at 37°C for 24 h. After plaque formation, the culture was transferred to kanamycin-resistant liquid LB medium, shaken until turbid, and then subjected to bacterial examination and sequencing. If the sequencing was correct, plasmid extraction was performed by shaking the culture.

[0091] (7) Plasmid extraction Centrifuge the shaken bacterial culture multiple times, discard the supernatant, add P1, mix well, add P2, mix well, add P3, mix gently, centrifuge at 12000 rpm for 10 min, aspirate the supernatant into the adsorption column, centrifuge at 12000 rpm for 1 min, discard the collected liquid, add PW, centrifuge and repeat this step once, discard the collected liquid, centrifuge empty once, then place the adsorption column into a new centrifuge tube, add 50 μL ddH2O, centrifuge, measure the concentration, and store the plasmid at -20℃.

[0092] (8) Agrobacterium transformation The plasmid was added to *Agrobacterium tumefaciens* competent cells GV3101 thawed on ice. The cells were then subjected to a 5-minute ice bath, followed by a 5-minute liquid nitrogen shock, a 5-minute heat shock at 37°C, and a 5-minute ice bath. Antibiotic-free YEB was then added, and the cells were incubated at 28°C for 3 hours. The recovered bacterial culture was centrifuged and plated onto kanamycin-resistant YEB medium. After incubation at 28°C for 48 hours, plaques were picked for bacterial testing. Cultures with correct bacterial counts were shaken, and glycerol was added for storage at -80°C.

[0093] ​ Arabidopsis transformation with overexpression vector (1) Construction of overexpression vectors: Will ​ The gene was inserted into the DsRed vector, digested with AscI + speI enzymes, and then... ​ -F7 and ​ -R7 was used for PCR amplification, and then the vector was constructed to obtain... ​ Gene overexpression vectors.

[0094] (2) Add the bacterial culture after bacterial testing to 10 ml of kanamycin LB medium and shake overnight to activate. Take the shaken bacterial culture and add it to kanamycin LB medium overnight and shake again. Centrifuge at 4000 rpm for 15 min, discard the supernatant, resuspend in resuspending solution and adjust the OD value to about 0.8 for later use. The preparation of resuspending solution is shown in the table below.

[0095]

[0096] (3) Cut off the siliques and fully open flowers of the flowering wild-type Arabidopsis thaliana, infect it by flower immersion for 2 minutes, treat it in the dark for 24 hours, and then move it to the light for culture. A second infiltration was performed one week later to increase the positive rate.

[0097] (4) After the seeds mature, harvest them, disinfect them as usual, and sow them on MS solid medium containing hygromycin resistance for screening. One week later, transplant the Arabidopsis seedlings into the soil for culture and extract DNA using gene primers. ​ F7 and ​ PCR amplification was performed using R7 and universal primers on the expression vector. The PCR products were then identified positively by agarose gel electrophoresis. The positive seedlings were then collected and passaged to a homogenate for subsequent experiments.

[0098] ​ Rapeseed plants overexpressing and interfering with vectors were obtained (1) Construction of overexpression and interference vectors Construction of overexpression vectors: Will ​ The gene was inserted into the DsRed vector, digested with AscI + speI enzymes, and then... ​ -F7 and ​ -R7 was used for PCR amplification, and then the vector was constructed to obtain... ​ Gene overexpression vectors.

[0099] Construction of the interference vector: based on ​ Design specific amplification primers based on the gene's CDS sequence: ​ -RNAi-F1 and ​ -RNAi-R1.

[0100] Will BnaA7.ARF17 The gene was inserted into the pFGC5941M vector, digested with BamHI+XbaI restriction enzymes, and then... BnaA7.ARF17 -RNAi-F1 and BnaA7.ARF17 RNAi-R1 was amplified by PCR, and the vector was constructed to obtain a sample containing the sense fragment. BnaA7.ARF17 Gene interference expression vector. This vector was digested with NcoI and AatII enzymes, and the resulting linear vector was ligated with the gene fragment digested with the same enzymes to obtain a vector simultaneously containing both sense and antisense fragments. BnaA7.ARF17 Gene interference expression vector.

[0101] (2) Overexpression and interference with the genetic transformation of rapeseed a) Sowing: Pour an appropriate amount of prepared and sterilized MO medium into a glass dish in the sowing box and allow it to solidify. Place an appropriate amount of J9709 seeds into a 5ml centrifuge tube, add 75% alcohol and shake for 2 minutes in a clean bench. Discard the alcohol, add half of the 84 disinfectant solution, and shake vigorously for 3 minutes to disinfect the seeds. Discard the half of the 84 disinfectant solution and add sterile ddH2O to wash the seeds 3-4 times. Sow the washed seeds into the solidified MO medium and incubate in the dark for 7 days.

[0102] b) Shaking culture: Preserving at -80℃ BnaA7.ARF17 Gene overexpression and interference vector Agrobacterium tumefaciens solution were shaken overnight in a clean bench with liquid YEB medium containing antibiotics. The next day, the bacterial solution was shaken twice in gradients of 1:100, 1:500, and 1:1000 until the OD value was about 0.4.

[0103] c) Rapeseed explant infection: Add 18 ml of DM solution to a sterilized culture dish. Use sterile scissors to cut rapeseed hypocotyls into 0.8-1 cm segments and place them into the culture dish. Take 2 ml of the twice-shaken bacterial solution, centrifuge at 10000 rpm for 2 min, discard the supernatant, add DM solution to resuspend, centrifuge again, discard the supernatant, add DM solution to resuspend again. Add the resuspended bacterial solution to a glass dish containing hypocotyls, gently shake to infect for 7 min, aspirate the bacterial solution, and place the hypocotyls on filter paper to air dry. Use sterile, red-hot forceps to transfer the dried hypocotyls to M1 medium and incubate in the dark for 24 h. After 24 h, transfer the hypocotyls from M1 medium to M2 medium and incubate under light for 20 days.

[0104] d) M3 subculture: Transfer the hypocotyl from M2 medium to M3 medium and subculture every 14 days until true leaves emerge.

[0105] e) M4 culture: Transfer the hypocotyls that have grown true leaves in M3 medium to M4 medium to promote rooting. After they have grown to a suitable size and rooted, remove them for hydroponics. Once the roots have grown relatively vigorously, transplant them into soil for further cultivation.

[0106] IV. Observation of drought phenotypes The obtained Arabidopsis thaliana overexpression lines, rapeseed overexpression lines, and interference lines were quantitatively analyzed by qRT-PCR. The quantitative primers were: BnaA7.ARF17 -qPCR-F and BnaA7.ARF17 -qPCR-R.

[0107] Select BnaA7.ARF17 High expression levels of Arabidopsis thaliana overexpression lines, rapeseed overexpression lines, and BnaA7.ARF17 Drought phenotypes were observed in rapeseed interference lines with low expression levels.

[0108] Observation of Arabidopsis thaliana drought phenotype: Nutrient soil and vermiculite were mixed evenly, and an appropriate amount of water was added to moisten the mixture. The mixture was then divided into small pots, with each pot containing approximately the same amount of soil. Overexpressing Arabidopsis thaliana OE- at the four-leaf stage and with uniform growth were then placed in MS solid medium. BnaA7.ARF17- 37. OE- BnaA7.ARF17 -67、OE- BnaA7.ARF17 -71 and WT were transplanted into small pots. They were cultured normally until bolting. The condition before drought treatment was photographed and recorded. Drought stress was applied for 4-6 days, and the condition after drought was photographed and recorded. After recording, the plants were rehydrated, and photographed and recorded again 1-2 days later. Results are as follows... Figure 8 As shown.

[0109] Observation of rapeseed phenotype under drought: Mix nutrient soil and vermiculite evenly, add an appropriate amount of water to moisten, fill the basket, divide the basket into five parts, and transplant the seedlings in sequence onto paper J9709 and OE- which had germinated earlier and were growing at the same rate. BnaA7.ARF17 -2、OE- BnaA7.ARF17 -5、Ri- BnaA7.ARF17 -6、Ri- BnaA7.ARF17 -7 Rapeseed. Cultivate normally until five true leaves, and photograph the condition before drought treatment. Perform drought stress treatment for 4-6 days, and photograph the condition after drought. Rewater after recording, and photograph again 1-2 days later. Results are as follows. Figure 7 As shown.

[0110] Figure 7 and Figure 8 Overexpression and interference were demonstrated respectively. BnaA7.ARF17 Statistical results of the response and survival rate of Arabidopsis thaliana and rapeseed lines under drought stress.

[0111] Figure 8 It is hyperexpression BnaA7.ARF17 Statistical chart of the response and survival rate of transgenic Arabidopsis to soil drought stress. Figure 8 A represents the overexpression of three Arabidopsis thaliana strains OE- BnaA7.ARF17 -37、OE- BnaA7.ARF17 -67、OE- BnaA7.ARF17 -71 and wild-type WT phenotypic figures under drought and rehydration treatments. Figure 8 B in the middle refers to WT and OE respectively. BnaA7.ARF17 -37、OE- BnaA7.ARF17 -67、OE- BnaA7.ARF17 -71 Statistical graph showing the survival rates of three overexpression Arabidopsis lines after drought stress and rehydration treatments. The results further demonstrate the effectiveness of overexpression. BnaA7.ARF17 It will reduce the drought resistance of Arabidopsis thaliana.

[0112] V. BnaA7.ARF17 Subcellular localization of transient expression in tobacco according to BnaA7.ARF17Design specific amplification primers based on the CDS sequence of the gene. BnaA7.ARF17 -PEGAD-HR-F and BnaA7.ARF17 -PEGAD-HR-R.

[0113] Will BnaA7.ARF17 The coding region was inserted into the pEGAD expression vector, and digestion with EcoRI+HindIII was performed. Primers were used... BnaA7.ARF17 -PEGAD-HR-F and BnaA7.ARF17 PCR amplification was performed using PEGAD-HR-R, and then 35S was constructed according to the vector construction procedure. BnaA7.ARF17 -YFP fusion expression vector. The constructed vector plasmid was transformed into Agrobacterium. After spot testing to confirm correct bacterial count, the culture was incubated overnight with shaking. Simultaneously, the empty vector control Agrobacterium and the nuclear marker control Agrobacterium were shaken once. After overnight incubation, a second incubation was performed based on the bacterial concentration. The bacterial culture was added to 50 mL of YEB liquid medium at a specific ratio and incubated at 28°C for 6-8 hours. Once the bacterial culture turned orange-yellow, it was centrifuged at 5000 rpm for 10 minutes. The supernatant was discarded, and resuspended buffer was added to adjust the OD to 0.8-1.0. The culture was then allowed to stand for 3 hours. The nuclear marker and empty vector were mixed as a control group. BnaA7.ARF17 The gene subcellular localization vector mixture served as the experimental group. The bacterial solution was injected into tobacco using a syringe, and after 24 hours of dark incubation, it was cultured under light for 1 day. The lower epidermis of the tobacco leaves from the injected area was then removed, and fluorescence observation and photography were performed using a laser confocal microscope. The protein localization was determined based on the fluorescence localization results. Results are as follows: Figure 4 As shown.

[0114] Figure 4 yes BnaA7.ARF17 Subcellular localization map of transient expression in tobacco. (Constructed) BnaA7.ARF17 A subcellular localization recombinant vector was used, which was then chemically transformed into Agrobacterium tumefaciens strain GV3101. Agrobacterium was then injected into tobacco leaf epidermal cells for transient expression. The results showed that... BnaA7.ARF17 The fluorescence signal of the protein localization coincides with that of the nuclear localization maker protein, i.e. BnaA7.ARF17 The protein is located in the cell nucleus. Subcellular localization results show that... BnaA7.ARF17 The fluorescence signal of the protein localization coincides with that of the nuclear localization maker protein, i.e. BnaA7.ARF17 The protein is located in the cell nucleus.

[0115] VI. BnaA7.ARF17 Promoter activity and expression characteristics according to BnaA7.ARF17Specific amplification primers BnaA7.ARF17proHR-F1 and BnaA7.ARF17proHR-R1 were designed based on the gene promoter sequence.

[0116] Will BnaA7.ARF17 The gene was inserted upstream of the GUS reporter gene in the pCAMBIA1305.1 vector and digested with EcoRI+NcoI. PCR amplification was performed using designed primers, and then the pro gene was constructed using the aforementioned vector. BnaA7.ARF17 GUS expression vector. Transformed into Arabidopsis thaliana using the inoculation method, and seeds were harvested. Seeds were sown on MS solid medium resistant to hygromycin, and positive plants were selected. Positive seedlings were transplanted into soil, and DNA was extracted for identification. Positive seedlings were then harvested for seed. Gus staining was applied to positive seedlings, and after incubation in aluminum foil at 37°C in the dark for 24 hours, the stain was decolorized with anhydrous ethanol, and the results were observed. BnaA7.ARF17 The staining patterns during the seedling stage and in different tissue sites were used to determine... BnaA7.ARF17 The promoter activity and expression characteristics. For example... Figure 5 As shown.

[0117] Figure 5 yes BnaA7.ARF17 Tissue-specific expression analysis diagram. a: [Image showing pro] BnaA7.ARF17 Gus staining image of Arabidopsis seedlings transformed with GUS expression vector at stage 7 (d). Gus staining shows that... BnaA7.ARF17 It was expressed in all parts of Arabidopsis seedlings. bh: Gus staining results showed that pro BnaA7.ARF17 Leaves, roots, siliques, and silique pericarps of Arabidopsis thaliana transformed with the GUS expression vector were stained, but seeds were not. (Note:) BnaA7.ARF17 The expression was observed in the leaves, roots, siliques, and silique pericarps of Arabidopsis thaliana, but not in the seeds. Staining results showed that the eye color of the root primordia of Arabidopsis thaliana was darker than that of other parts, indicating... BnaA7.ARF17 It is expressed more in Arabidopsis root primordia.

[0118] Gus staining results showed that BnaA7.ARF17 It is expressed in all parts of Arabidopsis seedlings; it is expressed in Arabidopsis leaves, roots, siliques, and silique pericarps; especially in root primordia where the expression level is high.

[0119] Overexpression BnaA7.ARF17 Analysis of negative regulation of drought tolerance in Arabidopsis thaliana lines: BnaA7.ARF17 Phenotypic observation of overexpressing Arabidopsis thaliana lines after drought stress treatment at the seedling stage revealed that both overexpressing and wild-type lines exhibited wilting, but the degree of wilting in the overexpressing lines was significantly lower than that in the wild-type. After rehydration, wild-type lines (WT) could recover normal growth, while the overexpressing lines recovered more slowly, with some even dying. The results of overexpression studies were statistically analyzed. BnaA7.ARF17Survival rates of Arabidopsis thaliana and wild-type Arabidopsis thaliana lines under drought treatment showed that the survival rate of wild-type WT plants was significantly higher than that of Arabidopsis thaliana. BnaA7.ARF17 Overexpression lines, i.e., overexpression BnaA7.ARF17 Arabidopsis strains are less drought tolerant than wild-type Arabidopsis strains.

[0120] Figure 6 It is the overexpression of various Arabidopsis thaliana lines and the overexpression and interference lines of rapeseed. BnaA7.ARF17 The expression levels were determined. Overexpression lines with high expression levels and interference lines with low expression levels were selected for subsequent drought stress experiments.

[0121] right BnaA7.ARF17 Phenotypic observations of overexpressing and interfering rapeseed under drought stress during the seedling stage revealed that before drought, the growth status of overexpressing, interfering, and wild-type J9709 lines was consistent with no significant differences. After drought treatment, all three lines exhibited varying degrees of wilting, with the overexpressing lines showing the most severe wilting, exhibiting leaf dehydration, curling, and drying, indicating an overall state of extreme drought. Wild-type J9709 also showed significant wilting, with most leaves drying out, but its overall survival rate was better than that of the overexpressing lines. Interfering lines showed the least wilting, exhibiting overall wilting with a few leaves drying out. After rehydration, most of the overexpressing rapeseed remained wilted until death. Wild-type J9709, after rehydration, showed mostly wilting but with a small number surviving. Interfering rapeseed, after rehydration, mostly recovered to normal growth. The overexpressing lines were statistically analyzed. BnaA7.ARF17 rapeseed strains, interference BnaA7.ARF17 Survival rates of rapeseed lines and wild-type rapeseed J9709 were found to be significantly lower under drought treatment, with reduced disturbance... BnaA7.ARF17 The survival rate of the rapeseed lines was much higher than that of wild-type rapeseed J9709 and overexpression. BnaA7.ARF17 The survival rate of wild-type rapeseed J9709 strain was higher than that of overexpression strains. BnaA7.ARF17 Rapeseed lineage. This indicates overexpression. BnaA7.ARF17 Rapeseed lines are less drought-tolerant and more susceptible to disturbance compared to wild-type rapeseed. BnaA7.ARF17 Rapeseed varieties are more drought-resistant than wild-type rapeseed.

[0122] In the description of this invention, it should be understood that "-" and "~" represent a range between two values, and this range includes the endpoints. For example, "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0123] In the description of this invention, the term "and / or" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, A and / or B can represent three cases: A exists alone, A and B exist simultaneously, and B exists alone.

[0124] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An interfering molecule for improving drought resistance in Brassica napus, characterized in that, The interfering molecule targets the BnaA7.ARF17 gene in Brassica napus, the nucleotide sequence of which is shown in SEQ ID NO:

1. The interfering molecule can reduce the expression level of this gene. The interfering molecule is an RNA interference hairpin structure formed by connecting the positive and negative sequences of the positive and negative sequences obtained by PCR amplification using the positive and negative sequences of the BnaA7.ARF17 gene as a template and the positive and negative sequences of the positive sequence with a spacer region.

2. The interfering molecule according to claim 1, characterized in that, The interfering molecule is inserted into the pFGC5941M vector via homologous recombination. The promoter of the vector is a 35S promoter, and the interfering molecule is located after the promoter and before the spacer region, or after the spacer region and before the terminator.

3. A method for constructing an RNA interference vector for the interference molecule of claim 1 or 2, characterized in that, Includes the following steps: (1) Using the BnaA7.ARF17 gene shown in SEQ ID NO:1 as a template, PCR amplification was performed using the positive strand primers shown in SEQ ID NO:4 and the antisense strand primers shown in SEQ ID NO:5 to obtain the positive and antisense sequences; (2) The sense and antisense sequences were inserted into the pFGC5941M vector using BamHI and XbaI restriction sites to form an RNA interference vector containing a 35S promoter. (3) The RNA interference vector was transformed into Agrobacterium tumefaciens strain GV3101.

4. A method for improving the drought resistance of Brassica napus, characterized in that, Includes the following steps: (1) The RNA interference vector constructed in claim 3 was introduced into the hypocotyl of Brassica napus via Agrobacterium tumefaciens-mediated transformation; (2) Infected hypocotyls were co-cultured in M1 medium without resistance, and then transferred to M2 and M3 for selection, callus induction, dedifferentiation and redifferentiation, and then transferred to M4 medium to induce rooting. (3) The expression level of the BnaA7.ARF17 gene in transgenic plants was detected by qRT-PCR, and lines with expression levels lower than 50% of the wild type were screened. (4) The selected strains were subjected to drought stress treatment, and drought-resistant strains with a survival rate at least 30% higher than that of wild-type J9709 were selected.

5. The method according to claim 4, characterized in that, The specific steps of the Agrobacterium tumefaciens-mediated method include: Hypocotyls of Brassica napus were cut into 0.8-1 cm segments and immersed in Agrobacterium tumefaciens solution with an OD600 of 0.8 for 7 minutes. The infected hypocotyls were then cultured in the dark on M1 medium for 24 hours. They were then transferred sequentially to M2 medium to induce callus, M3 medium to promote shoot regeneration, and M4 medium to induce rooting.

6. The method according to claim 4, characterized in that, The primers used in the qRT-PCR detection are: BnaA7.ARF17-qPCR-F: 5'-AAGATGGCTATGGAGACTGA-3'; BnaA7.ARF17-qPCR-R: 5'-GTTTTGCAGAATTCTCAGGTTC-3'.

7. The method according to claim 4, characterized in that, The drought stress treatment involved stopping watering for 4-6 days during the seedling stage, followed by rehydration, and then calculating the survival rate to screen for interference lines with a higher survival rate than the wild type J9709.

8. The application of the interfering molecule as described in claim 1 or 2 in improving the drought resistance of Brassica napus, characterized in that, The application includes introducing the interfering molecule into Brassica napus cells to inhibit the expression of the BnaA7.ARF17 gene.

Citation Information

Patent Citations

  • Brassica napus drought-tolerant gene BnaC04ARL and application thereof

    CN118834886A