Application of soybean ZF-HD protein coding gene GmZFHD11 in aspect of influencing quality of soybean seeds

Abstract

The invention discloses an application of a soybean ZF-HD protein coding gene GmZFHD11 in the aspect of influencing the quality of soybean seeds. The nucleotide sequence of the soybean ZF-HD protein coding gene GmZFHD11 is as shown in SEQ ID NO. 1. The invention also discloses a preparation method of the soybean ZF-HD protein coding The constructed plant overexpression vector pBA002-GmZFHD11 is subjected to agrobacterium tumefaciens-mediated soybean genetic transformation to obtain a soybean receptor variety Jack, and it is found that compared with a receptor control group, the content of sulfur-containing amino acid in seeds is increased, the content of protein is increased, the content of beta-conglycinin (7S) is reduced, the content of glycinin (11S) is increased, and the 11S / 7S ratio is increased; and the quality of the overexpressed transgenic soybean strain seed protein is improved. Therefore, the gene can be introduced into plants as a target gene to improve the quality of soybean grain protein.

Description

Technical Field

[0001] The invention relates to application of soybean ZF-HD protein encoding gene GmZFHD11 and belongs to the field of genetic engineering. Background Art

[0002] Zinc finger homeodomain (ZF-HD) transcription factors are plant-specific and consist of a zinc finger (ZF) and a homeodomain (HD) (Tran et al., 2007). ZF-HD transcription factors play crucial roles in plant growth and development, including regulation of tissue development, seed filling, stress responses, and hormone signaling. Typical zinc fingers contain two pairs of conserved cysteine ​​and / or histidine residues, which bind to zinc ions to form a stable finger-like structure. Zinc finger homeodomain proteins are characterized by two highly conserved domains: a C-terminal HD domain and an N-terminal ZF domain, and therefore they are classified as part of the ZF-HD protein family (Takatsuji, 1999). The HD domain typically consists of a highly conserved 180 bp segment encoding approximately 60 amino acids ( et al., 2001; Islam et al., 2022). This domain functions as a transcription factor by regulating promoter sequences and affecting mRNA synthesis. Different numbers of ZF-HD genes have been identified in different plant species: 17 ZF-HD genes have been identified in Arabidopsis, 11 in rice (Xu et al., 2014), 37 in wheat (Liu et al., 2021), 60 in alfalfa (He et al., 2022), 49 in upland cotton (Xing et al., 2022), and 18 in pea (Shi et al., 2023).

[0003] Numerous studies have found that ZF-HD genes may be involved in plant growth, tissue organization, fruit development, and signal transduction. For example, in Arabidopsis, AtZHD5 influences floral architecture and leaf formation (Tan & Irish, 2006). In barley, HvZHD1 is highly expressed during flowering, mid-milky phase, late-milky phase, and early-waxy phase, suggesting its potential involvement in floral development and seed maturation (Saeid & Khaldoun, 2017). In rice, OsZHD1 and OsZHD2 control leaf curvature (Xu et al., 2014). In wheat, TaZFHD1 participates in the growth processes of flowering and pollination, as well as in the JA, ABA, and ET signal transduction pathways (Wang et al., 2014). The maize genome contains 24 ZF-HD genes, which play important roles in maize immature embryo development and floral growth (Islam et al., 2022).

[0004] In addition to regulating plant growth and development, studies in some model plants have found that ZF-HD genes play an important role in responding to abiotic and biotic stresses, and ZF-HD / ZHD proteins play a key role in alleviating the adverse effects of environmental stress (Sun et al., 2021; Yong et al., 2021; Shalmani et al., 2019). For example, barley HvZFHD1 expression is upregulated by dehydration, salinity, and heat stress (Saeid & Khaldoun, 2017); under drought and salt stress, the expression of the tomato gene SL-ZH13 / SlZHD13 increases (Khatun et al., 2017), and silencing the SlZH13 gene in tomato plants reduces the tolerance of tomatoes to drought and salt stress (Kazerooni et al., 2022; Zhao et al., 2018); and in Arabidopsis, the expression of the ZHD4 protein is upregulated by drought, salinity, and cold stress (Barth et al., 2009). In addition, AtZHD1 and AtZHD10 regulate hormone signaling and improve drought tolerance (Tran et al., 2007; Perrella et al., 2018); 10 ZHDs in wheat (Liu et al., 2021), 4 ZHDs in cucumber (Lai et al., 2021), and NtZHD21 in tobacco (Sun et al., 2021) are upregulated under abiotic stresses, such as drought, salt, and high temperature stress; in addition, a total of 24 ZF-HD genes that respond to drought or salt stress were found in the whole maize genome, among which ZmZHD11 and ZmZHD12 can respond to drought and high salt and play an important role in stress resistance (Islam et al., 2018). In rapeseed, the expression of BnZHDs (BnZHDs) in roots, stems, and leaves is significantly induced within the first 24 hours of exposure to various stresses. These genes may play important roles in rapeseed growth, development, and environmental adaptation (Xu et al., 2024). In soybean, GmZF-HD1 and GmZF-HD2 can activate GmCaM4 expression in response to pathogen stress (Park et al., 2007; Park et al., 2010). Zhang Xinnan (2018) found that GmZF-HD11 plays a role in influencing root hair development by heterologously expressing it in Arabidopsis thaliana. There are few studies on the functions of ZF-HD transcription factor family members in soybean, and there is currently no relevant research on the impact of ZF-HD transcription factor family members on the quality of seed storage materials.Therefore, the functional research of ZF-HD transcription factor family members in soybean needs further exploration.

[0005] The high quality of soybean protein makes it an important source of edible oil and protein for humans (Chatterjee et al., 2018). Based on the dry weight of mature seeds, soybeans contain 30%–46% protein (Huang et al., 2018). Different cultivation environments can lead to variations in the protein composition of soybeans. Although soybean seeds contain a high protein content, the content of sulfur-containing amino acids in soy protein is extremely low, falling below the recommended dietary intake for humans. Sulfur-containing amino acids are the primary limiting amino acids in soybean seed protein quality, making soy protein a less than ideal protein source. Therefore, increasing the sulfur-containing amino acid content in soybean seeds can improve their nutritional value.

[0006] Furthermore, genetic modification can alter the content and composition of soy protein (Natarajan et al., 2013). Soy protein contains two proteins: water-soluble proteins and globulins, with globulins being the primary protein component. Globulins can be separated into two major storage proteins: glycinin (11S) and β-conglycinin (7S), which account for 30% and 40% of soy protein, respectively (Sui et al., 2021). 7S globulin is a key factor in soy allergy and is the primary soy allergen causing allergies in humans and animals (Ogawa et al., 1995; Krishnan et al., 2009). Furthermore, 11S and 7S globulins differ in their amino acid composition, with 11S globulin having a higher content of sulfur-containing amino acids, which account for 3–4.5% of the total amino acid residues (Nielsen et al., 1989; Zarkadas et al., 2007). Since there is a significant negative correlation between 11S and 7S (Ogawa et al., 1989), obtaining low 7S globulin content and a high 11S / 7S ratio is a strategy to improve soybean plant quality by reducing allergenicity and increasing sulfur amino acid content. Summary of the Invention

[0007] The purpose of the present invention is to disclose the effect of a soybean ZF-HD protein encoding gene GmZFHD11 on the quality of soybean seed protein.

[0008] The purpose of the present invention can be achieved through the following technical solutions:

[0009] The soybean ZF-HD protein encoding gene GmZFHD11 has a nucleotide sequence of: SEQ ID NO.1.

[0010] The amino acid sequence of soybean ZF-HD protein is: SEQ ID NO.2.

[0011] A recombinant expression vector containing the soybean ZF-HD protein encoding gene GmZFHD11 of the present invention.

[0012] When constructing a plant expression vector using GmZFHD11, any enhancing or inducible promoter can be added before its transcriptional initiation nucleotide. To facilitate identification and screening of transgenic plant cells or plants, the plant expression vector can be modified, such as by adding a selectable marker gene (such as a BAR gene or a luciferase gene). For safety reasons, it is possible to omit the addition of any selectable marker gene and directly screen transformed plants based on phenotypic traits.

[0013] Plant expression vectors carrying the GmZFHD11 gene of the present invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transfection, and the transformed plant tissues can be cultivated into plants. The transformed plant hosts can be monocots such as sorghum, rice, wheat, and corn, as well as dicots such as peanuts, soybeans, rapeseed, tomatoes, poplars, turfgrasses, and alfalfa.

[0014] The soybean ZFHD protein encoding gene GmZFHD11 described in the present invention is used to increase the protein content of soybean seeds and improve the quality of soybean seeds through genetic engineering; preferably, increasing the expression of the soybean ZF-HD protein encoding gene GmZF-HD11 can increase the sulfur-containing amino acid content and protein content of soybean seeds, reduce the 7S globulin content, increase the 11S globulin content, improve the proportion of seed globulin components, and improve the protein quality phenotype of soybean seeds.

[0015] 1. The application of a recombinant expression vector overexpressing the soybean ZF-HD protein encoding gene GmZF-HD11 in increasing the protein content of soybean seeds and improving the quality of soybean seeds through genetic engineering, preferably in increasing the sulfur-containing amino acid content and protein content of soybean seeds, reducing the 7S globulin content and increasing the 11S globulin content, improving the proportion of seed globulin components, and improving the protein quality of soybean seeds.

[0016] Beneficial effects

[0017] This study discovered a new function of GmZFHD11 in improving soybean seed quality. A plant overexpression vector, pBA002-GmZFHD11, was constructed and overexpressed in the soybean recipient variety, jack. The screened T2 generation positive seedlings were identified, and the harvested mature grains were subjected to quality phenotype assessment. It was found that the sulfur amino acid content and protein content of the overexpressed soybean material were significantly increased, while the globulin composition of the soybean grains was significantly altered ( Figure 1 、 Figure 2 ), indicating that this gene can improve soybean seed quality phenotype. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Bar test strip positive identification of overexpressed transgenic soybean lines, 1 is the negative control; 2-11 are transgenic overexpression

[0019] Positive strains

[0020] Figure 2 Detection of target gene GmZFHD11 expression in overexpressing transgenic soybean lines

[0021] Figure 3 Comparison of grain quality traits (sulfur amino acids, protein) between the overexpressing transgenic soybean lines and the control recipient variety Jack

[0022] Figure 4 Changes in globulin components in mature grains of overexpressing transgenic soybean lines compared with grains of the control recipient variety Jack DETAILED DESCRIPTION

[0023] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0024] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0025] Example 1

[0026] 1) Construction of plant expression vector

[0027] The overexpression vector used in this study is driven by the cauliflower mosaic virus (CaMV) 35S promoter. The overexpression vector pBA002 was double-digested with MIU I and Sac I at 37°C for 120 min, followed by product purification. Specific primers were designed based on the CDS sequence of soybean GmZFHD11 and the MIU I and Sac I-digested linker. Primer sequences are shown in F1: GGG CCCAGGCCTACGCGTATGGACCTAACCTCCATCAG and F2: TCGGGGAAATTCGAGCTCCTAAGATGACATCTCATTAA. The CDS sequence of the soybean GmZFHD11 gene, cloned by Zhang Xinnan (2018), with a complete coding region of 1077 bp, was amplified using high-fidelity PCR. The PCR protocol was as follows: 35 cycles of pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 1 minute. Finally, the PCR product was incubated at 72°C for 5 minutes, followed by a constant temperature at 4°C. The PCR product was then gel-recovered and sequenced. The sequenced CDS sequence of GmZFHD11, containing the restriction endonuclease adapter, was cloned into the double-enzyme-digested pBA002 vector using homologous recombination. The ligation product was transformed into competent Escherichia coli DH5α cells, and the resulting single colonies were shaken and sequenced to confirm successful ligation. The plasmid was extracted from the successfully sequenced bacterial culture, named pBA002-GmZFHD11, and transformed into the Agrobacterium tumefaciens strain EHA105 by freeze-thaw method for later use.

[0028] 2) Obtaining transgenic plants

[0029] The Agrobacterium tumefaciens strain EHA105 containing the pBA002-GmZFHD11 vector obtained in step 1) was transformed into the soybean recipient variety jack through Agrobacterium tumefaciens-mediated soybean genetic transformation, overexpressing the pBA002 vector containing the 35S promoter, NOS terminator, and the BAR marker gene. The obtained transgenic plants were positively identified by BAR test strips using the BAR marker gene ( Figure 1) and target gene expression in positive transgenic soybean plants was analyzed by qRT-PCR. Real-time fluorescence quantitative qPCR primer sequences are shown in F2: GACGGGTTGGTCCAAGAGTT and R2: TTGTTCACACACGCATCATCT. Tubulin, a constitutively expressed soybean protein, was used as an internal reference. Primer sequences are shown in F3: GGAGTTCACAGAGGCAGAG and R3: CACTTACGCATCACATAGCA. Changes in GmZFHD11 gene expression in overexpressing transgenic lines were detected. Overexpressing plants that tested positive for the test strip and showed significantly increased GmZFHD11 expression were propagated in a greenhouse (25°C, 12h light / 12h dark). Subsequent phenotypic analysis of the T2 generation of overexpressing transgenic soybean seeds was performed.

[0030] The specific steps of soybean genetic transformation mediated by Agrobacterium tumefaciens are as follows:

[0031] (1) Seed sterilization. Carefully select mature Jack seeds with no defects on the seed coat surface and that are round and plump. Place them in a fume hood and sterilize the seed coat surface using chlorine gas produced by the chemical reaction of concentrated hydrochloric acid and sodium hypochlorite (volume ratio of 1:10) for 6 hours.

[0032] (2) Seed germination. After sterilization, the seeds were placed in a clean bench and incubated in SG4 (1 / 2MS) seed germination medium at 25°C in the dark for 12 h.

[0033] (3) Agrobacterium infection. Split the beans in half along the hilum, remove half of the radicle, and lightly draw multiple lines along the hypocotyl and radicle. Shake the Agrobacterium tumefaciens solution in a constant temperature incubator at 28°C and 200 rpm until the OD 600 When the OD600 is approximately 0.9, 25 mL of bacterial suspension is aspirated and centrifuged at 4000 rpm for 15 minutes at room temperature. The supernatant is discarded and the suspension is resuspended in CCM liquid medium to an OD600 of approximately 0.45. This bacterial suspension is then used to infect soybeans, incubating at 160 rpm for 40 minutes in a 28°C constant temperature incubator. The soybeans are then placed with the wound site facing downward on CCM solid medium covered with sterile filter paper and incubated for 5 days (25°C, 16 h light / 8 h dark).

[0034] (4) Sterilization. First, wash the soybeans several times with sterilized pure water, then wash them several times with Wash liquid medium, and finally discard the waste liquid. Place the soybeans in SIM solid medium without glufosinate and culture for 14 days to induce clustered buds (25°C, 16 h light / 8 h dark).

[0035] (5) Subculture and induction of bud elongation. The base of the sprouted soybean at the hypocotyl was cut open with a scalpel, and the wound was inserted into SIM solid medium containing 6 mg / L glufosinate and cultured for 14 days to continue inducing budding (25°C, 16 h light / 8 h dark); the yellowed cotyledons were removed and inserted into SEM solid medium containing 4 mg / L glufosinate and cultured for 14 days (25°C, 16 h light / 8 h dark). The yellowed cotyledons were removed and inserted into SEM solid medium containing 2.5 mg / L glufosinate and cultured for 14 days to allow elongation (25°C, 16 h light / 8 h dark).

[0036] (6) Rooting. When the shoots elongated into plantlets and grew three or more leaves, they were cut from the stems and transferred to RM rooting medium for 14 days (25°C, 16 h light / 8 h dark).

[0037] (7) Positive identification and transplanting. Transgenic positive plants should contain the resistance screening protein Bar. Use Bar transgenic detection paper to detect positive plants. Those that are confirmed to be positive are transferred to nutrient soil and placed in an artificial incubator (25°C, 16h light / 8h dark) to grow until harvest.

[0038] 3) Phenotypic Characterization of Overexpressing Transgenic Soybean Seeds (Seed Amino Acids, Protein Content, and Globulin Composition) The selected overexpressing transgenic lines were propagated in a greenhouse and planted in a 1:1 vermiculite / nutrient soil matrix at 25°C under 12h light / 12h dark conditions. The growth and development of the overexpressing transgenic soybean lines and their phenotypic traits were observed and recorded. Mature T2 seeds were harvested and the amino acid and protein content of the overexpressing transgenic soybean seeds was measured using a DA 7250 NIR analyzer (Perten Instruments, Sweden) by near-infrared reflectance (NIR) spectroscopy. The results showed significantly increased methionine and cysteine ​​content, as well as significantly increased protein content. Approximately 50 seeds from each line were analyzed and measured three times. The seed samples were then dried in a 28°C oven for 7 days and ground into flour. The 11S and 7S content of the seeds was determined using glycinin and β-conglycinin ELISA kits (Beijing Longke Ark Bioengineering Technology Co., Ltd., China). After competitive indirect ELISA, a standard curve was generated based on the absorbance of six standard samples at 450 and 630 nm using a microplate reader (Infnite M200, Tecan). The contents of 11S and 7S in soybean seeds were calculated by combining the absorbance values ​​of the samples at 450 nm and 630 nm with the standard curve, and the 11S / 7S ratio was calculated at the same time. The results showed that compared with the control receptor Jack, the sulfur-containing amino acid content (methionine, cysteine) and protein content of the seeds of the overexpressing transgenic soybean plants were significantly increased; in terms of soybean seed globulin components, the β-conglycinin content in the seeds of the overexpressing transgenic soybean plants was significantly reduced, the glycinin content was significantly increased, and the 11S / 7S ratio was significantly increased. This indicates that this gene can be introduced into soybean plants as a target gene to improve the protein composition of soybean grains and improve seed quality ( Figure 3 , Figure 4 ).

Claims

1. Application of the soybean ZF-HD protein encoding gene GmZF-HD11 in increasing the protein content of soybean seeds and improving the quality of soybean seeds through genetic engineering. The nucleotide sequence of the soybean ZF-HD protein encoding gene GmZFHD11 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that Increasing the expression of soybean ZF-HD protein encoding gene GmZF-HD11 can increase the sulfur amino acid content and protein content of soybean seeds, reduce the 7S globulin content, increase the 11S globulin content, improve the proportion of seed globulin components, and improve the protein quality phenotype of soybean seeds.

3. Application of a recombinant expression vector overexpressing the soybean ZF-HD protein encoding gene GmZF-HD11 in increasing the protein content of soybean seeds and improving the quality of soybean seeds through genetic engineering. The nucleotide sequence of the soybean ZF-HD protein encoding gene GmZFHD11 is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that The application of a recombinant expression vector overexpressing the soybean ZF-HD protein encoding gene GmZF-HD11 in increasing the sulfur amino acid content and protein content of soybean seeds, reducing the 7S globulin content, increasing the 11S globulin content, improving the proportion of seed globulin components, and improving the protein quality of soybean seeds.

Images