Gene combination for increasing stachyose content of potatoes, recombinant expression vector and construction method and application of recombinant expression vector

Abstract

The invention discloses a gene combination for increasing the stachyose content of potatoes, a recombinant expression vector as well as a construction method and application of the gene combination and the recombinant expression vector, and belongs to the technical field of biology. The gene combination comprises a GalE gene, a GS gene and an STS gene. In addition, the invention also provides a recombinant expression vector which comprises the gene combination. In addition, the invention also provides a construction method of the recombinant expression vector, which comprises the following steps: carrying out enzyme digestion on a skeleton vector by using Eco31I, and connecting a target gene and a regulatory element to the vector to form the recombinant expression vector pNK2-GalE-STS-GS. In addition, the invention also provides an application of the gene combination or the recombinant expression vector in increasing the stachyose content in potato tubers. The three genes GalE, GS and STS provided by the invention are specifically expressed in the potato tubers, so that the stachyose content in the potato tubers is increased by 16 times to the maximum extent.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gene combination for increasing the stachyose content of potatoes, a recombinant expression vector, and a construction method and application thereof. Background Art

[0002] Stachyose, a tetrasaccharide naturally occurring in plants, is widely used in the food, health supplement, and biopharmaceutical industries due to its stable physicochemical properties and excellent physiological activity. Stachyose is found in a wide range of plants, including Leguminosae and Lamiaceae, such as caddisfly, Rehmannia glutinosa, and soybeans. Currently, the main method for industrial production of stachyose is extraction from plants like caddisfly, but the naturally occurring stachyose content in plants is low, significantly limiting its yield.

[0003] Potatoes are annual plants belonging to the Solanaceae family and are widely cultivated for their edible tubers rich in starch. Potato tubers are easy to digest and contain a variety of nutrients such as vitamin C, vitamin B1, vitamin B3 and protein. They are one of the world's major food crops. The main carbohydrate in potato tubers is starch, but the stachyose content is low. If the stachyose content in potato tubers can be increased and potato tubers with high stachyose content are used as stachyose production raw materials, it will help the development of the stachyose industry. Therefore, there is an urgent need for a method to increase the stachyose content in potato tubers.

[0004] With the rapid development of biotechnology, it has become a reality to synthesize natural products in plants using synthetic biology technology. This technology has promoted the advancement of related technologies, improved production efficiency and reduced costs.

[0005] However, how to increase the stachyose content in potato tubers is still a technical problem that needs to be solved in the existing technology. Summary of the Invention

[0006] The purpose of the present invention is to overcome the above technical deficiencies and provide a gene combination, a recombinant expression vector and a construction method and application thereof for increasing the stachyose content in potatoes, thereby solving the technical problem of how to increase the stachyose content in potato tubers in the prior art.

[0007] The present invention provides a method for specifically overexpressing three genes, GalE, GS and STS, in potato tubers by modifying the potato stachyose synthesis pathway, thereby increasing the stachyose content in potato tubers.

[0008] To achieve the above technical objectives, the technical solution of the present invention provides a gene combination for increasing the stachyose content of potatoes, including the GalE gene, the GS gene and the STS gene.

[0009] In any embodiment, the GalE gene is derived from the Escherichia coli UDP-glucose 4-epimerase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number WP_074488048.1; the GS gene is derived from the Arabidopsis thaliana galactinol synthase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number NP_172406.1; the STS gene is derived from the Arabidopsis thaliana stachyose synthase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number NP_192106.3.

[0010] In addition, the present invention also provides a recombinant expression vector comprising the above gene combination.

[0011] In any embodiment, the promoter and terminator for regulating the expression of the GalE, GS, and STS genes are:

[0012] The promoter of the GalE gene is MCPI, and the terminator is hsp;

[0013] The promoter of the STS gene is GBSS, and the terminator is rbcS-E9;

[0014] The promoter of the GS gene is class I patatin and the terminator is NOS.

[0015] In any embodiment, the GalE, GS, and STS genes are inserted into a backbone vector and ligated using restriction endonuclease Eco31I and 2×Seamless Cloning Mix recombinase.

[0016] In any embodiment, the backbone vector is vector pNK2.

[0017] In addition, the present invention also provides a method for constructing the above-mentioned recombinant expression vector, comprising the following steps:

[0018] S1. Use KOD One™ PCR Master Mix to amplify the GalE, GS, and STS genes, the MCPI, GBSS, and classI patatin promoters, and the hsp, rbcS-E9, and NOS terminators.

[0019] S2. Use Eco31I to cut the backbone vector, connect the target gene and regulatory elements to the vector, and form the recombinant expression vector pNK2-GalE-STS-GS.

[0020] In addition, the present invention also proposes the use of the above gene combination or the above recombinant expression vector in increasing the stachyose content in potato tubers.

[0021] In any embodiment, the recombinant expression vector is transformed into Agrobacterium GV3101 competent cells, and then the cells are used to infect potato explants.

[0022] Compared with the prior art, the beneficial effects of the present invention include: the three genes GalE, GS and STS proposed in the present invention are specifically expressed in potato tubers, increasing the stachyose content in potato tubers by a maximum of 16 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the structure of the pNK2-GalE-STS-GS vector constructed in Example 1 of the present invention.

[0024] Figure 2 This is a graph showing the detection results of the stachyose content in potato tubers of the GalE-STS-GS triple gene overexpression strain of Example 3 of the present invention. DETAILED DESCRIPTION

[0025] The "range" disclosed in this application is defined in the form of a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, and the selected lower limit and upper limit define the boundaries of a particular range. The range defined in this way can be inclusive or exclusive of the end values, and can be arbitrarily combined, i.e., any lower limit can be combined with any upper limit to form a range. For example, if a range of 60 to 120 and 80 to 110 is listed for a particular parameter, it is understood that a range of 60 to 110 and 80 to 120 is also expected. In addition, if the minimum range values 1 and 2 are listed, and if the maximum range values 3, 4 and 5 are listed, the following ranges can all be expected: 1 to 3, 1 to 4, 1 to 5, 2 to 3, 2 to 4 and 2 to 5. In this application, unless otherwise specified, the numerical range "a to b" represents an abbreviation of any real number combination between a and b, wherein a and b are both real numbers. For example, a numerical range of "0-5" indicates that all real numbers between "0-5" are listed herein, and "0-5" is simply an abbreviation for these numerical combinations. Furthermore, stating that a parameter is an integer ≥ 2 is equivalent to disclosing that the parameter is, for example, an integer of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0026] Unless otherwise specified, the terms "include" and "comprising" used in this application may be open-ended or closed-ended. For example, "include" and "comprising" may mean that other components not listed may also be included or that only the listed components are included.

[0027] Unless otherwise specified, the term "or" is used in this application to be inclusive. For example, the phrase "A or B" means "A, B, or both A and B." More specifically, the condition "A or B" is satisfied if any of the following conditions are met: A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); or both A and B are true (or exist).

[0028] This specific embodiment provides a gene combination for increasing the stachyose content of potatoes, including the GalE gene, the GS gene and the STS gene.

[0029] In some embodiments, the GalE gene is derived from the Escherichia coli UDP-glucose 4-epimerase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number WP_074488048.1; the GS gene is derived from the Arabidopsis thaliana galactinol synthase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number NP_172406.1; the STS gene is derived from the Arabidopsis thaliana stachyose synthase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number NP_192106.3.

[0030] This specific embodiment also provides a recombinant expression vector comprising the above gene combination.

[0031] In some embodiments, the promoter and terminator regulating the expression of the GalE, GS, and STS genes are:

[0032] The promoter of the GalE gene is MCPI, and the terminator is hsp;

[0033] The promoter of the STS gene is GBSS, and the terminator is rbcS-E9;

[0034] The promoter of the GS gene is class I patatin and the terminator is NOS.

[0035] In some embodiments, the GalE, GS, and STS genes are inserted into a backbone vector and ligated using restriction endonuclease Eco31I and 2×Seamless Cloning Mix recombinase.

[0036] In some embodiments, the backbone vector is vector pNK2.

[0037] This specific embodiment also proposes a method for constructing the above-mentioned recombinant expression vector, comprising the following steps:

[0038] S1. Use KOD One™ PCR Master Mix to amplify the GalE, GS, and STS genes, the MCPI, GBSS, and classI patatin promoters, and the hsp, rbcS-E9, and NOS terminators.

[0039] S2. The backbone vector was cut with Eco31I, and the target gene and regulatory elements were connected to the vector by seamless cloning technology to form the recombinant expression vector pNK2-GalE-STS-GS.

[0040] This specific embodiment also proposes the use of the above gene combination or the above recombinant expression vector in increasing the stachyose content in potato tubers.

[0041] In some embodiments, the recombinant expression vector is transformed into Agrobacterium GV3101 competent cells, and then the cells are used to infect potato explants.

[0042] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0043] In the present invention, references to “some embodiments”, “this embodiment”, examples, etc. describe a subset of all possible embodiments, but it can be understood that “some embodiments” may be the same subset or different subsets of all possible embodiments, and may be combined with each other without conflict.

[0044] If similar descriptions of "first / second" appear in the application documents, the following explanation is added. In the following description, the terms "first\second\third" are merely used to distinguish similar objects and do not represent a specific order of the objects. It can be understood that "first\second\third" can be interchanged with the specific order or sequence where permitted, so that the embodiments described herein can be implemented in an order other than that illustrated or described herein.

[0045] In this embodiment, the term "and / or" is merely a description of the association relationship between associated objects, indicating that three relationships may exist. For example, object A and / or object B may represent three situations: object A exists alone, object A and object B exist at the same time, and object B exists alone.

[0046] Below, the embodiment of the present application is described. The embodiment described below is exemplary and is only used to explain the present application, and is not to be construed as limiting the present application. Where specific techniques or conditions are not specified in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Reagents or instruments used that do not specify the manufacturer are conventional products that can be obtained commercially.

[0047] Example 1 Construction of recombinant expression vector

[0048] 1. Gene cloning

[0049] (1) UDP-glucose 4-epimerase: derived from Escherichia coli, with the UniProt database number WP_074488048.1. This example uses GalE for ease of description.

[0050] (2) Galactinol synthase: derived from Arabidopsis thaliana, with the UniProt database number of NP_172406.1. This example uses GS for ease of description.

[0051] (3) Stachyose synthase: derived from Arabidopsis thaliana, with the UniProt database number NP_192106.3. This example uses STS for ease of description.

[0052] The above genes were cloned and amplified using KOD One™ PCR Master Mix. For relevant operation methods, please refer to the corresponding instructions.

[0053] 2. Promoter and terminator cloning

[0054] Promoter: MCPI, GBSS, class I patatin

[0055] Terminator: hsp, rbcS-E9, NOS

[0056] The GalE gene was expressed using the MCPI promoter and hsp terminator, the STS gene was expressed using the GBSS promoter and rbcS-E9 terminator, and the GS gene was expressed using the class I patatin promoter and NOS terminator.

[0057] The aforementioned promoters and terminators were amplified using KOD One™ PCR Master Mix using laboratory-preserved plasmids as templates. For the relevant operating procedures, please refer to the corresponding instructions.

[0058] 3. Enzyme Digestion, Ligation and Transformation

[0059] (1) Use restriction endonuclease Eco31I to digest the backbone vector pNK2, and use 2×Seamless Cloning Mix recombinase to connect the target gene fragment and the linearized pNK2;

[0060] (2) Take 10 μl of the ligation product and transform it into E. coli competent DH5a. The transformation method is 42℃ heat shock method. Specifically, take 100 μL of E. coli DH5a competent cells, add 10 μL of the ligation product, and place on ice for 30 minutes; incubate in a 42℃ water bath for 90 seconds, and place on ice for 2 minutes; add to 500 μL of LB non-resistant liquid medium, and culture at 37℃, 220 rpm for 1 hour; then spread the bacterial liquid on LB solid medium containing kanamycin resistance and culture overnight.

[0061] 4. Verification of recombinant vector

[0062] Eight single clones were selected for colony PCR verification. Two positive clones were selected and plasmids were extracted using the Axygen plasmid DNA miniprep kit and sent for sequencing. The sequencing results were analyzed using Snapgene software to verify and confirm that the recombinant vector (i.e., recombinant expression vector) had been successfully constructed. It was named pNK2-GalE-STS-GS. The vector structure diagram is shown in the figure. Figure 1

[0063] Example 2 Genetic transformation of potato

[0064] 1. Agrobacterium Preparation

[0065] Add 1µL of plasmid to 50µL of GV3101 competent Agrobacterium cells, mix thoroughly, and transfer to an electroporation cuvette. After electroporation, add 1mL of LB liquid medium, mix thoroughly, and transfer to a 1.5mL centrifuge tube. Incubate on a shaker at 30°C, 180 rpm, for 30 minutes. 50µL of the activated Agrobacterium culture was inoculated onto the LB solid medium containing the recombinant vector described in Example 1 and incubated in the dark at 30°C for 48 hours. Single Agrobacterium colonies were selected, and PCR amplification was performed using the synthesized primers SEQ ID NO. 1 and SEQ ID NO. 2. Transfection of the recombinant expression vector into the competent cells was verified by agarose gel electrophoresis. SEQ ID NO. 1: The forward primer sequence for Agrobacterium testing is GATGGATTGCACGCAGGTTC; SEQ ID NO. 2: The reverse primer sequence for Agrobacterium testing is TAAAGCACGAGGAAGCGGTC.

[0066] 2. Potato genetic transformation

[0067] (1) Explant preparation

[0068] Select 3-4 week old test tube seedlings, cut 0.2-0.5 cm stem segments with a scalpel as explant material, inoculate into pre-culture medium, and culture in the dark at 23°C for 2-3 days:

[0069] (2) Agrobacterium infection and co-cultivation

[0070] Pick up Agrobacterium and place it in the infection solution. Prepare an Agrobacterium suspension with an OD600 of 0.2-0.5. Inoculate the explants into the Agrobacterium suspension and infect for 10 minutes. Spread the infected explants onto sterile filter paper and let them dry. Then, inoculate the co-culture medium and incubate at 23°C in the dark for 48-72 hours.

[0071] (3) Screening

[0072] The co-cultivated explants were inoculated on the screening medium and cultured at 25°C with 16 / 8h light intensity for 14 days.

[0073] (4) Screening / differentiation

[0074] The explants were inoculated on screening / differentiation medium, with 30 explants per dish, cultured at 25°C with 16 / 8h light intensity, and the medium was changed every 20 days.

[0075] (5) Rooting culture

[0076] The differentiated buds were inoculated into rooting medium and cultured at 25°C with 16 / 8h photoperiod until roots formed.

[0077] (6) Detection

[0078] The potato genomic DNA was extracted by CTAB method and PCR detection was performed using primers SEQ ID NO.1 and SEQ ID NO.2.

[0079] (7) Planting

[0080] The potato seedlings that tested positive were planted in nutrient soil and cultured at 22°C with 16 / 8h photoperiod until the tubers were harvested and the planting was completed.

[0081] Example 3 Detection of Stachyose Content in Potato Tubers

[0082] The potato tubers obtained from the planting in Example 2 were placed in a 2 mL EP tube and frozen in liquid nitrogen for at least 15 min. A 96-well grinder plate was pre-frozen in liquid nitrogen, two steel balls were added, and the sample was ground at 60 Hz for 2 min.

[0083] 0.1 g of ground potato sample was added to 1000 μL of extract (methanol:acetonitrile:water, volume ratio 2:2:1, containing 0.5 μg / mL 2-chlorophenylalanine as internal standard). The sample was vortexed for 30 seconds, sonicated for 30 minutes, and allowed to stand at -20°C for 30 minutes. The sample was centrifuged at 12,000 rpm for 15 minutes at 4°C, filtered through a 0.22 μm filter, and the supernatant was transferred to a vial and frozen at -80°C until analysis. HPLC-MS was performed using a Waters BEH Amide column (1.7 μm, 2.1 × 100 mm). Mass spectrometry was performed on an Orbitrap Exploris 120 using DDMS2 acquisition mode and an m / z scan range of 85–1250. Stachyose in the sample was identified by the retention time and mass spectrum of the stachyose standard. Data analysis and quantification were performed using Xcalibur software.

[0084] The quantitative analysis results are as follows Figure 2As shown. The results showed that compared with the control group (content 0.041 mg / kg), the stachyose content in the potato tubers of the overexpressing lines was significantly increased. Among them, the stachyose content in the potato tubers of line #27 increased the most, reaching 0.67 mg / kg, a maximum increase of 16 times. In addition, the stachyose content in the tubers of the four lines #24, #37, #42, and #45 also increased, reaching 0.432 mg / kg, 0.336 mg / kg, 0.222 mg / kg, and 0.443 mg / kg, respectively. It should be noted that the control group was wild-type potato, and #24, #27, #37, #42, and #45 were positive seedlings.

[0085] The technical solution provided by the present invention can increase the stachyose content of tubers without affecting their normal growth and development.

[0086] The specific embodiments of the present invention described above do not limit the scope of protection of the present invention. Any other corresponding changes and modifications made based on the technical concept of the present invention should be included in the scope of protection of the claims of the present invention.

Claims

1. A gene combination for increasing the stachyose content of potatoes, characterized in that: Including GalE gene, GS gene and STS gene.

2. The gene combination according to claim 1, characterized in that The GalE gene is derived from the Escherichia coli UDP-glucose 4-epimerase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number WP_074488048.1; the GS gene is derived from the Arabidopsis thaliana galactinol synthase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number NP_172406.1; the STS gene is derived from the Arabidopsis thaliana stachyose synthase gene, and its nucleotide sequence is such as the coding sequence corresponding to the UniProt database number NP_192106.

3.

3. A recombinant expression vector, characterized in that: Comprising the gene combination according to any one of claims 1-2.

4. The recombinant expression vector according to claim 3, characterized in that The promoters and terminators for regulating the expression of the GalE, GS, and STS genes are: The promoter of the GalE gene is MCPI, and the terminator is hsp; The promoter of the STS gene is GBSS, and the terminator is rbcS-E9; The promoter of the GS gene is class I patatin and the terminator is NOS.

5. The recombinant expression vector according to claim 3, characterized in that The GalE, GS, and STS genes were inserted into the backbone vector and ligated using restriction endonuclease Eco31I and 2×Seamless Cloning Mix recombinase.

6. The recombinant expression vector according to claim 5, characterized in that The backbone vector is vector pNK2.

7. A method for constructing the recombinant expression vector according to any one of claims 3 to 6, characterized in that: The following steps are involved: S1. Use KOD One™ PCR Master Mix to amplify the GalE, GS, and STS genes, the MCPI, GBSS, and class Ipatatin promoters, and the hsp, rbcS-E9, and NOS terminators. S2. Use Eco31I to cut the backbone vector, connect the target gene and regulatory elements to the vector, and form the recombinant expression vector pNK2-GalE-STS-GS.

8. Use of the gene combination according to any one of claims 1 to 2, or the recombinant expression vector according to any one of claims 3 to 6, in increasing the stachyose content in potato tubers.

9. The use according to claim 8, characterized in that The method comprises the steps of transforming the recombinant expression vector into Agrobacterium GV3101 competent cells and then infecting potato explants.

Images