Schizochytrium limacinum engineering strain co-expressing PDC-ACC gene, construction method and application
By co-expressing PDC and ACC genes in Schizochytrium HX-308, the metabolic pathway was optimized, and the stability and efficiency of extracting DHA from deep-sea fish oil was solved, and the Schizochytrium engineering strain that efficiently produced DHA was achieved, which increased the yield and content of DHA.
Patent Information
- Application Number
- CN202511013153.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-23
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2045-07-23
AI Technical Summary
In the prior art, the extraction of DHA from deep-sea fish oil has problems such as unstable raw material supply, may cause allergic reactions, high risk of marine pollution, cumbersome separation steps between DHA and EPA and high energy consumption, and cannot meet market demand and product quality requirements.
The schizotritis engineered strain co-expressing the PDC-ACC gene was constructed, and the pyruvate decarboxylase complex gene expression Yarrowia lipolytica was introduced into the pyruvate decarboxylase complex gene PDC and acetyl-CoA carboxylase gene ACC in Schizotritis HX-308 were introduced through electrotransformation method to optimize the metabolic pathway and enhance DHA accumulation.
It significantly improves the yield and content of DHA, improves the oil and fat content, solves the problems of insufficient stability of DHA synthesis and low intracellular lipid accumulation efficiency in traditional methods, and provides a basis for industrial targeted synthesis of DHA.
Smart Images

Figure CN120519301A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering technology, and in particular relates to an engineering strain of Schizochytrium co-expressing a PDC-ACC gene, a construction method and an application thereof. Background Art
[0002] Polyunsaturated fatty acids (PUFAs) are a class of long-chain fatty acids with two or more double bonds. They are classified as ω-3 and ω-6 fatty acids based on the location and number of double bonds. As structural components of cell membranes and precursors of signaling molecules, PUFAs play a key role in regulating lipid metabolism, inflammatory responses, neurodevelopment, and cardiovascular function.
[0003] DHA (docosahexaenoic acid, C22:6, ω-3) is a long-chain ω-3 polyunsaturated fatty acid (LC-PUFA) with a hexaolefinic bond. It is a core structural component of the human nervous system and retina, and a key active molecule for maintaining physiological homeostasis. As an essential fatty acid, DHA cannot be efficiently synthesized endogenously in the human body and requires dietary or exogenous supplementation. The multiple cis double bonds in its molecular structure impart a high degree of flexibility, significantly enhancing cell membrane fluidity and participating in various metabolic regulation as a precursor of signaling molecules. Studies have confirmed that DHA plays a central role in synaptic plasticity, retinal light signaling, anti-inflammatory and anti-oxidative stress, lipid metabolism homeostasis regulation, and cardiovascular protection.
[0004] Schizochytrium is a unicellular, heterotrophic marine microorganism belonging to the Thraustochytrids, kingdom Trichophyta. It is widely distributed in coastal sediments, mangrove ecosystems, and waters rich in organic matter. As the most prominent oil-producing group within the Thraustochytrids, Schizochytrium has become a hot topic in industrial microbial research due to its efficient synthesis of polyunsaturated fatty acids (PUFAs).
[0005] Acetyl-CoA, a metabolic hub, plays a dual role in both glucose metabolism and lipid synthesis. This molecule not only serves as the activated form of pyruvate, a product of glycolysis, entering the tricarboxylic acid (TCA) cycle, but its production is also completed through oxidative decarboxylation mediated by the pyruvate dehydrogenase complex (PDC), channeling carbon flux from glycolysis into the TCA cycle. In the lipid synthesis pathway, acetyl-CoA, located in the cytoplasm, is converted to malonyl-CoA by acetyl-CoA carboxylase (ACC), initiating the fatty acid chain elongation mechanism. The type I fatty acid synthase (FAS) system uses acetyl-CoA as an initiator and sequentially incorporates C2 units provided by malonyl-CoA, employing a modular catalytic strategy to progressively elongate the carbon chain. This biosynthetic process proceeds in a precisely regulated manner until the synthesis of C16:0 or C18:0 acyl-CoA.
[0006] Currently, high-purity DHA on the market mainly comes from deep-sea fish oil, but extracting DHA from deep-sea fish oil has many disadvantages:
[0007] (1) Fish resources are affected by changes in breeding season, climate and marine environment, resulting in unstable supply of raw materials.
[0008] (2) Some fish oil extraction processes cannot completely remove fish protein, which may cause adverse reactions in people with allergies.
[0009] (3) Marine pollution causes the accumulation of harmful substances such as mercury, lead, polychlorinated biphenyls and dioxins in fish bodies, which require complex purification processes to remove, increasing safety risks and production costs.
[0010] (4) DHA often coexists with EPA in fish oil and needs to be separated through multiple processes, which is cumbersome and energy-intensive.
[0011] Therefore, whether in terms of market demand or product quality, obtaining DHA from marine fish cannot meet the requirements of the majority of consumers. Summary of the Invention
[0012] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a Schizochytrium genetic engineering strain expressing a pyruvate decarboxylase complex gene and an acetyl-CoA carboxylase gene, a construction method and an application.
[0013] The technical solution adopted by the present invention to solve its technical problem is:
[0014] A Schizochytrium engineered strain co-expressing the PDC-ACC gene, wherein the genetically engineered strain is obtained by using Schizochytrium as a starting strain and expressing the pyruvate decarboxylase complex gene PDC and the acetyl-CoA carboxylase gene ACC in Yarrowia lipolytica;
[0015] The gene sequence of the gene PDC is SEQ ID No. 1, and the gene sequence of the gene ACC is SEQ ID No. 2.
[0016] Furthermore, the Schizochytrium is Schizochytrium HX-308, and the Yarrowia lipolytica is Y. lipolyticaPo1f.
[0017] The method for constructing the genetically engineered strain as described above comprises the following steps:
[0018] S1. Construction of recombinant plasmid pzpk-BleoR-PDC
[0019] The plasmid pzpk-BleoR was used as a backbone, and the PDC expression cassette was inserted into the plasmid backbone to obtain the recombinant plasmid pzpk-BleoR-PDC;
[0020] S2. Construction of recombinant plasmid pzpk-NeoR-ACC
[0021] The plasmid pzpk-NeoR was used as the backbone, and the ACC expression cassette was inserted into the plasmid backbone to obtain the recombinant plasmid pzpk-NeoR-ACC;
[0022] S3. Construction of a genetically engineered Schizochytrium strain expressing PDC and ACC genes
[0023] The recombinant plasmids pzpk-BleoR-PDC and pzpk-NeoR-ACC were introduced into Schizochytrium HX-308 cells to obtain recombinant bacteria, and the obtained recombinant bacteria were genetically engineered Schizochytrium strains that efficiently produced DHA.
[0024] Furthermore, in steps S1 and S2, the promoters of the PDC expression cassette and the ACC expression cassette are the P2845 promoter and the P2520 promoter of Schizochytrium, and the terminators are the T2845 terminator and the CYC1t terminator of Schizochytrium;
[0025] The gene sequence of the P2845 promoter is shown in SEQ ID No. 8, the gene sequence of the T2845 terminator is shown in SEQ ID No. 11, the gene sequence of the P2520 promoter is shown in SEQ ID No. 16, and the gene sequence of the CYC1 terminator is shown in SEQ ID No. 19.
[0026] Furthermore, in step S3, the introduction is achieved by electroporation.
[0027] The use of the genetically engineered strain as described above in the fermentation production of DHA.
[0028] The method for producing DHA by fermentation using the genetically engineered strain described above is characterized by shaking culture at a temperature of 26-30°C for 80-120 hours at a rotation speed of 160-200 rpm, and a glucose concentration of 80-100 g / L in the fermentation medium.
[0029] Furthermore, the specific steps are as follows:
[0030] S1. Activation of recombinant bacteria
[0031] The genetically engineered strain was inoculated into a seed culture medium and cultured under shaking conditions of 28°C ± 0.5°C and 180 rpm for 24 hours to obtain a first-level seed solution; the first-level seed solution was transferred to a fresh seed culture medium at an inoculum rate of 2% and amplified under the same culture conditions for 24 hours to obtain a second-level seed solution; the second-level seed solution was transferred to a seed culture medium at an inoculum rate of 2% and cultured under the same parameters for 24 hours to obtain a fermentation seed solution;
[0032] S2. Recombinant Bacterial Fermentation
[0033] The fermentation seed liquid was inoculated into the fermentation medium at an inoculum rate of 10%, and cultured in a shaking incubator at 28°C and 180 rpm for 120 hours to obtain DHA.
[0034] Furthermore, the seed culture medium has a pH value of 6.0-6.5 and comprises: 40-60 g / L glucose, 4-6 g / L yeast extract, 5-8 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, 8-12 g / L sodium glutamate, 1-5 mg / L zinc sulfate heptahydrate, 0.01-0.1 mg / L cobalt chloride hexahydrate, 2-6 mg / L copper sulfate pentahydrate, 1-2 mg / L nickel sulfate hexahydrate, 8-15 mg / L iron sulfate heptahydrate, 2-4 mg / L calcium pantothenate, 3-5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.
[0035] The pH value of the fermentation medium is 6.0-6.5, and the fermentation medium comprises: 70-80 g / L glucose, 10-30 g / L glycerol, 5-15 g / L yeast extract, 5-12 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, and 10 g / L glutamic acid. Sodium mononitrate 15~20g / L, zinc sulfate heptahydrate 1~5mg / L, cobalt chloride hexahydrate 0.01~0.1mg / L, copper sulfate pentahydrate 2~6mg / L, nickel sulfate hexahydrate 1~2mg / L, ferric sulfate heptahydrate 8~15mg / L, calcium pantothenate 2~4mg / L, manganese chloride tetrahydrate 3~5mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 4~10mg / L.
[0036] The advantages and positive effects achieved by the present invention are:
[0037] 1. The Schizochytrium fungus used in the present invention has many significant advantages, including fast growth rate, high oil content and relatively simple oil composition.
[0038] 2. The PDC and ACC genes in the engineered Schizochytrium strain of the present invention were cloned from Yarrowia lipolytica and designated Po1f. Traditional fermentation yielded 43.90 g / L of oil. Overexpressing the PDC and ACC genes in this engineered strain increased the oil content by 53.13% to 67.22 g / L, and also increased the DHA content by 36.97%, from 40.71% to 55.76%.
[0039] 3. Transcriptome analysis of Schizochytrium revealed that the enhanced DHA accumulation in Schizochytrium stems from an upregulation of carbon flux in the tricarboxylic acid cycle. By regulating acetyl-CoA through metabolic engineering, the rate-limiting step in de novo fatty acid synthesis can be overcome, globally enhancing the lipid synthesis pathway and significantly improving lipid yield in Schizochytrium.
[0040] 4. The present invention obtains a genetically engineered Schizochytrium strain by overexpressing the PDC, ACC or PDC-ACC genes in Po1f of Yarrowia lipolytica in Schizochytrium HX-308, which can significantly improve DHA accumulation, providing a basis for the industrial-scale directional synthesis of DHA by the strain.
[0041] 5. The present invention is suitable for constructing a genetically engineered Schizochytrium strain expressing PDC and ACC genes. The constructed genetically engineered Schizochytrium strain expressing PDC and ACC genes is further used for producing DHA.
[0042] 6. This invention addresses the existing issues of DHA synthesis in Schizochytrium, including insufficient stability, low intracellular lipid accumulation efficiency, and environmental constraints on traditional algal DHA production. This invention proposes optimizing metabolic pathways by synergistically enhancing the expression of the pyruvate decarboxylase complex (PDC) and acetyl-CoA carboxylase (ACC) genes. The engineered strain is derived from Schizochytrium HX-308, overexpressing the PDC and ACC genes from Y. lipolytica. This invention significantly enhances the flux of central carbon metabolism toward lipid synthesis, while simultaneously improving the efficiency of acetyl-CoA precursor supply and the ability to regulate pyruvate node metabolic diversion. This significantly improves DHA accumulation, laying the foundation for industrial-scale targeted DHA synthesis using this strain. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] Figure 1 This is the skeleton diagram of the recombinant plasmid pzpk-BleoR in Example 1 of the present invention;
[0044] Figure 2 This is the skeleton diagram of the recombinant plasmid pzpk-BleoR-PDC in Example 1 of the present invention;
[0045] Figure 3 This is the skeleton diagram of the recombinant plasmid pzpk-NeoR in Example 2 of the present invention;
[0046] Figure 4 This is the skeleton diagram of the recombinant plasmid pzpk-NeoR-ACC in Example 2 of the present invention;
[0047] Figure 5This is a graph showing the oil content and DHA content of the fermented recombinant bacteria 1, 2, and 3 in Example 4 of the present invention;
[0048] Figure 6 This is a gel electrophoresis verification diagram of the resistant recombinant plasmid nucleic acid in Examples 1 and 2 of the present invention;
[0049] Figure 7 This is a gel electrophoresis verification diagram of the target gene and backbone nucleic acid in Examples 1 and 2 of the present invention;
[0050] Figure 8 This is a colony PCR verification result diagram of the recombinant plasmid pzpk-BleoR-PDC in Example 1 of the present invention. DETAILED DESCRIPTION
[0051] The present invention will be further described below with reference to the following examples. The following examples are descriptive rather than restrictive, and the scope of protection of the present invention cannot be limited by the following examples.
[0052] The various experimental operations involved in the specific embodiments are all routine techniques in the field. For parts not specifically annotated in this document, ordinary technicians in this field can refer to various commonly used reference books, scientific literature or related instructions, manuals, etc. before the filing date of this invention to implement them.
[0053] All numerical ranges mentioned in the present invention include all specific point values within the interval.
[0054] Unless otherwise commonly defined in the art or clearly stated, the "%" in the present invention refers to mass percentage, and the ratio is calculated by mass ratio; the mass unit may be gram, kilogram or ton, etc.
[0055] In the present invention, "room temperature" generally refers to conventional ambient temperature, specifically in the range of 10 to 30°C.
[0056] The Schizochytrium sp. HX-308 involved in the present invention is a Schizochytrium sp. HX-308 strain, which is a well-known strain in the prior art, as disclosed in Chinese patent publication CN101575584A. The strain has been deposited with the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC No: M209059.
[0057] A Schizochytrium engineered strain co-expressing the PDC-ACC gene, wherein the genetically engineered strain is obtained by using Schizochytrium as a starting strain and expressing the pyruvate decarboxylase complex gene PDC and the acetyl-CoA carboxylase gene ACC in Yarrowia lipolytica;
[0058] The gene sequence of the gene PDC is SEQ ID No. 1, and the gene sequence of the gene ACC is SEQ ID No. 2.
[0059] The gene sequence of the gene PDC is shown in SEQ ID No. 1, specifically:
[0060]
[0061] The gene sequence of the gene ACC is shown in SEQ ID No. 2, specifically:
[0062]
[0063] Preferably, the Schizochytrium is Schizochytrium HX-308, and the Yarrowia lipolytica is Y. lipolyticaPo1f.
[0064] The method for constructing the genetically engineered strain as described above comprises the following steps:
[0065] S1. Construction of recombinant plasmid pzpk-BleoR-PDC
[0066] The plasmid pzpk-BleoR was used as a backbone, and the PDC expression cassette was inserted into the plasmid backbone to obtain the recombinant plasmid pzpk-BleoR-PDC;
[0067] S2. Construction of recombinant plasmid pzpk-NeoR-ACC
[0068] The plasmid pzpk-NeoR was used as the backbone, and the ACC expression cassette was inserted into the plasmid backbone to obtain the recombinant plasmid pzpk-NeoR-ACC;
[0069] S3. Construction of a genetically engineered Schizochytrium strain expressing PDC and ACC genes
[0070] The recombinant plasmids pzpk-BleoR-PDC and pzpk-NeoR-ACC were introduced into Schizochytrium HX-308 cells to obtain recombinant bacteria, and the obtained recombinant bacteria were genetically engineered Schizochytrium strains that efficiently produced DHA.
[0071] Preferably, in steps S1 and S2, the promoters of the PDC expression cassette and the ACC expression cassette are the P2845 promoter and the P2520 promoter of Schizochytrium, and the terminators are the T2845 terminator and the CYC1t terminator of Schizochytrium;
[0072] The gene sequence of the P2845 promoter is shown in SEQ ID No. 8, the gene sequence of the T2845 terminator is shown in SEQ ID No. 11, the gene sequence of the P2520 promoter is shown in SEQ ID No. 16, and the gene sequence of the CYC1 terminator is shown in SEQ ID No. 19.
[0073] Preferably, in step S3, the introduction is achieved by electroporation.
[0074] The use of the genetically engineered strain as described above in the fermentation production of DHA.
[0075] The method for producing DHA by fermentation using the genetically engineered strain described above is characterized by shaking culture at a temperature of 26-30°C for 80-120 hours at a rotation speed of 160-200 rpm, and a glucose concentration of 80-100 g / L in the fermentation medium.
[0076] Preferably, the specific steps are as follows:
[0077] S1. Activation of recombinant bacteria
[0078] The genetically engineered strain was inoculated into a seed culture medium and cultured under shaking conditions of 28°C ± 0.5°C and 180 rpm for 24 hours to obtain a first-level seed solution; the first-level seed solution was transferred to a fresh seed culture medium at an inoculum rate of 2% and amplified under the same culture conditions for 24 hours to obtain a second-level seed solution; the second-level seed solution was transferred to a seed culture medium at an inoculum rate of 2% and cultured under the same parameters for 24 hours to obtain a fermentation seed solution;
[0079] S2. Recombinant Bacterial Fermentation
[0080] The fermentation seed liquid was inoculated into the fermentation medium at an inoculum rate of 10%, and cultured in a shaking incubator at 28°C and 180 rpm for 120 hours to obtain DHA.
[0081] Preferably, the seed culture medium has a pH value of 6.0-6.5 and comprises: 40-60 g / L glucose, 4-6 g / L yeast extract, 5-8 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, 8-12 g / L sodium glutamate, 1-5 mg / L zinc sulfate heptahydrate, 0.01-0.1 mg / L cobalt chloride hexahydrate, 2-6 mg / L copper sulfate pentahydrate, 1-2 mg / L nickel sulfate hexahydrate, 8-15 mg / L iron sulfate heptahydrate, 2-4 mg / L calcium pantothenate, 3-5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.
[0082] The fermentation medium has a pH value of 6.0-6.5 and comprises: 70-80 g / L of glucose, 10-30 g / L of glycerol, 5-15 g / L of yeast extract, 5-12 g / L of sodium sulfate, 2-4 g / L of magnesium sulfate, 4-8 g / L of ammonium sulfate, 1-2 g / L of potassium chloride, 0.1-0.2 g / L of calcium chloride, 0.5-1 g / L of potassium sulfate, 0.5-2 g / L of potassium dihydrogen phosphate, 15-20 g / L of sodium glutamate, 1-5 mg / L of zinc sulfate heptahydrate, 0.01-0.1 mg / L of cobalt chloride hexahydrate, 2-6 mg / L of copper sulfate pentahydrate, 1-2 mg / L of nickel sulfate hexahydrate, 8-15 mg / L of iron sulfate heptahydrate, 2-4 mg / L of calcium pantothenate, 3-5 mg / L of manganese chloride tetrahydrate, 0.04 mg / L of sodium molybdate dihydrate, and vitamin B6. 4~10mg / L.
[0083] Specifically, the relevant preparation and detection are as follows:
[0084] Example 1 Construction of recombinant plasmid pzpk-BleoR-PDC
[0085] This embodiment is a method for constructing the recombinant plasmid pzpk-BleoR-PDC, which includes the following steps performed in sequence:
[0086] S1. Construction of recombinant plasmid pzpk-BleoR
[0087] S1.1 Using plasmid pPICZαA as a template, PCR amplification was performed using primers BleoR-F (gene sequence shown in SEQ ID No. 3) and BleoR-R (gene sequence shown in SEQ ID No. 4) to obtain the BleoR gene (bleomycin gene). The nucleotide sequence of the BleoR gene is shown in SEQ ID No. 5.
[0088] The PCR procedure was as follows: denaturation at 98°C for 10 s, annealing at 57°C for 10 s, and extension at 72°C for 1 min, repeated 35 cycles;
[0089] S1.2 Using the genome of Schizochytrium sp. HX-308 as a template, PCR amplification was performed using primers P2845-F (gene sequence shown in SEQ ID No. 6) and P2845-R (gene sequence shown in SEQ ID No. 7) to obtain promoter P2845 (gene sequence shown in SEQ ID No. 8);
[0090] S1.3 Using the genome of Schizochytrium sp. HX-308 as a template, PCR amplification was performed using primers T2845-F (gene sequence shown in SEQ ID No. 9) and T2845-R (gene sequence shown in SEQ ID No. 10) to obtain the terminator T2845 (gene sequence shown in SEQ ID No. 11);
[0091] S1.4 The pZPK plasmid was digested with restriction endonuclease XbaI. The pZPK plasmid backbone and the three amplified genes were cloned in one step using the cloning kit 2× Ezmax Ultra Universal CloneMix (purchased from TOLOBIO) to construct the pzpk-BleoR plasmid. The nucleic acid gel electrophoresis verification is shown in Figure 1. Figure 6 .
[0092] S1.5 Each fragment was purified and recovered using the UE DNA gel recovery kit (purchased from Suzhou Uniland Biotechnology Co., Ltd.);
[0093] S1.6 Transform the circular recombinant vector into E. coli DH5a competent cells, screen the cells by adding 200 μg / mL bleomycin resistance plate, and verify by colony PCR and sequencing to obtain the positive recombinant plasmid pzpk-BleoR. Figure 1 shown.
[0094] Wherein ① the BleoR-F gene sequence is shown in SEQ ID No. 3, specifically:
[0095] gacaaggtgaggaactaaaccatggccaagttgaccagtgc
[0096] ② The BleoR-R gene sequence is shown in SEQ ID No. 4, specifically:
[0097] gtgggccgccgtcggacgtgtcagtcctgctcctcggccac
[0098] ③ The BleoR gene sequence is shown in SEQ ID No. 5, specifically:
[0099] atggccaagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggctcgggttctcccgg gacttcgtggaggacgacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccc tggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttccgggacgcctccgggccggccat gaccgagatcggcgagcagccgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactga
[0100] ④ The P2845-F gene sequence is shown in SEQ ID No. 6, specifically:
[0101] gatccaagctcaagctgccatttctcgacacttgtctccg
[0102] ⑤ The P2845-R gene sequence is shown in SEQ ID No. 7, specifically:
[0103] aatccatcttgttcaatcatcttttctctcgcctctcgct
[0104] ⑥ The promoter P2845 gene sequence is shown in SEQ ID No. 8, specifically:
[0105]
[0106] ⑦The gene sequence of T2845-F is shown in SEQ ID No. 9, specifically:
[0107] ggccaagcaaatgcaatagaaagtcgcacgcgagctttttac
[0108] ⑧T2845-R gene sequence is shown in SEQ ID No. 10, specifically:
[0109] gctctagggtagccttatcgaccgacggcttgacctgttg
[0110] ⑨ The terminator T2845 gene sequence is shown in SEQ ID No. 11, specifically:
[0111] aaagtcgcacgcgagctttttacttttcctattattattttttttcttcctccgatccctcttgttgcaccagaaaacaacgcagaaacacgggagcttgacagcgtgaccacaggaaagatactat ggatgagaacggaacgccaggtggaatacagaagtcgagggcatatctttgcgagcaacacatgttcgagccgcggaatcgaccccggacgccatggctggctggctggctgactggctgactgatccatg ctcatgaaagcatggcaactcttgctggcgccggggcctctgtcgctcttgccgcttccgtgccacgttttgcctggacttgctccctttgtttgtttctcgcttccaggtccttctcgcgttctgc ctcttcctcttccctttcccagtcctcttcttcaatatccatgtcgtcgtcttcgaatgcaaagtcacgcgaatcagagccaaattgtgctgcaaattcagcatactgctctagggtagccttatcg
[0112] The PCR enzyme used in the PCR reaction was PrimeSTAR Max DNA polymerase purchased from TAKARA. The PCR amplification system is shown in Table 1, the EcoRI enzyme digestion system is shown in Table 2, and the one-step cloning system is shown in Table 3.
[0113] Table 1 PCR amplification system
[0114]
[0115] Table 2 pzpk plasmid enzyme digestion system
[0116]
[0117] Table 3 One-step cloning system
[0118]
[0119] X = (0.02 × number of cloning vector base pairs) ng (0.03 pmol);
[0120] Y = (0.02 × number of base pairs per fragment) ng (0.03 pmol);
[0121] S2. Construction of recombinant plasmid pzpk-BleoR-PDC
[0122] S2.1 The PDC gene was amplified using the Yarrowia lipolytica Po1f genome as a template and primers PDC-F (shown in SEQ ID No. 12) and PDC-R (shown in SEQ ID No. 13);
[0123] S2.2 Using the genome of Schizochytrium sp. HX-308 as a template, PCR amplification was performed using primers P2520-F (gene sequence shown in SEQ ID No. 14) and P2520-R (gene sequence shown in SEQ ID No. 15) to obtain promoter P2520 (gene sequence shown in SEQ ID No. 16);
[0124] S2.3 Using Yarrowia lipolytica Po1f as a template and primers CYC1-F (gene sequence shown in SEQ ID No. 17) and CYC1-R (gene sequence shown in SEQ ID No. 18) as primers, PCR amplification was performed to obtain the terminator CYC1 (gene sequence shown in SEQ ID No. 19);
[0125] S2.4 The pzpk-BleoR plasmid was digested with restriction endonuclease PstI. The pzpk-BleoR plasmid backbone and the three amplified genes were cloned in one step using the ClonExpress MultiS One Step Cloning Kit. The constructed plasmid was named recombinant plasmid pzpk-BleoR-PDC (see the backbone diagram for details). Figure 2), the specific steps are the same as those for the construction of the recombinant plasmid pzpk-BleoR. The BamHI enzyme digestion system is shown in Table 4. Figure 7 The results of colony PCR verification are shown in Figure 8 .
[0126] Table 4 pzpk-BleoR plasmid enzyme digestion system
[0127] Components Recombination reaction Plasmid vector 2μL Restriction endonuclease PstI 2μL 10×QCut Buffer 5μL Ultrapure water To 50μL
[0128] Wherein, ① the PDC-F gene sequence is shown in SEQ ID No. 12, specifically:
[0129] gcaacgactcttgagaaaacatgtctgcccgatttcttgc
[0130] ②The PDC-R gene sequence is shown in SEQ ID No. 13, specifically:
[0131] ccattgagatgttgttgtaggatgattaatagattgtaattag
[0132] ③The P2520-F gene sequence is shown in SEQ ID No. 14, specifically:
[0133] gatccaagctcaagctgccagcaaccaaagcaaccagagc
[0134] ④ The P2520-R gene sequence is shown in SEQ ID No. 15, specifically:
[0135] gcaagaaatcgggcagacattgttcctgctgctgctgctg
[0136] ⑤ The promoter P2520 gene sequence is shown in SEQ ID No. 16, specifically:
[0137]
[0138] ⑥The CYC1-F gene sequence is shown in SEQ ID No. 17, specifically:
[0139] ccattgagatgttgttgtagtcatgtaattagttatgtcac
[0140] ⑦The CYC1-R gene sequence is shown in SEQ ID No. 18, specifically:
[0141] gagtcgacctgcagcatgcagcaaattaaagccttcgagc
[0142] ⑧Terminator CYC1 gene sequence is shown in SEQ ID No.19, specifically:
[0143] Tcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagt attaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgc
[0144] Example 2 Construction of recombinant plasmid pzpk-NeoR-ACC
[0145] S1. Construction of recombinant plasmid pzpk-NeoR
[0146] S1.1 Using plasmid pbacNeoR as a template, PCR amplification was performed using primers NeoR-F (gene sequence shown in SEQ ID No. 20) and NeoR-R (gene sequence shown in SEQ ID No. 21) to obtain the NeoR gene (neomycin resistance gene). The nucleotide sequence of the NeoR gene is shown in SEQ ID No. 22.
[0147] The PCR procedure was as follows: denaturation at 98°C for 10 s, annealing at 57°C for 10 s, and extension at 72°C for 1 min, repeated 35 cycles. The enzymes and systems used for PCR amplification were the same as those in Table 1.
[0148] S1.2 The pZPK plasmid was digested with restriction endonuclease XbaI. The pZPK plasmid backbone, promoter P2845, terminator T2845, and NeoR gene were cloned using the ClonExpress MultiS One Step Cloning Kit to construct the pzpk-NeoR plasmid. The one-step cloning system is the same as in Table 3. See the nucleic acid gel electrophoresis verification diagram for details. Figure 6 .
[0149] S1.3 Each fragment was purified and recovered using the AxyPrep™ DNA Gel Extraction Kit (purchased from Corning Life Sciences, Inc.);
[0150] S1.4 Transform the circular recombinant vector into E. coli DH5a competent cells, screen the cells by adding 500 μg / mL G418 resistance plate, and verify by colony PCR and sequencing to obtain the positive recombinant plasmid pzpk-NeoR. Figure 3 shown.
[0151] Wherein ①NeoR-F gene sequence is shown in SEQ ID No. 20, specifically:
[0152] caataatattgaaaaaggaagagtatgattgaacaagatggattgc
[0153] ②The NeoR-R gene sequence is shown in SEQ ID No. 21, specifically:
[0154] gagtaaacttggtctgacagtcagaagaactcgtcaagaag
[0155] ③The NeoR gene sequence is shown in SEQ ID No. 22, specifically:
[0156] atgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga
[0157] S2. Construction of recombinant plasmid pzpk-NeoR-ACC
[0158] S2.1 Using the Y. lipolytica Po1f genome as a template, the ACC gene was amplified with ACC-F (shown in SEQ ID No. 23) and ACC-R (shown in SEQ ID No. 24) as primers;
[0159] S2.2 The pzpk-NeoR plasmid was digested with restriction endonuclease PmeI. The pzpk-NeoR plasmid backbone, promoter P2520, terminator CYC1, and ACC gene were cloned using the ClonExpress MultiS One Step Cloning Kit. The constructed plasmid was named recombinant plasmid pzpk-NeoR-ACC (see the backbone diagram for details). Figure 4 ), the specific steps are the same as those for the construction of the recombinant plasmid pzpk-NeoR. The PmeI enzyme digestion system is shown in Table 5. Figure 7 .
[0160] Table 5 pzpk-NeoR plasmid enzyme digestion system
[0161]
[0162] Wherein, ① the ACC-F gene sequence is shown in SEQ ID No. 23, specifically:
[0163] gatataatttaatcgtctgctcctgaatgcgactgcaattgaggac
[0164] ② The ACC-R gene sequence is shown in SEQ ID No. 24, specifically:
[0165] cttcacttttttccttatcatctcacaaccccttgagcagctc
[0166] Example 3 Construction of a Schizochytrium Genetically Engineered Strain Expressing the Pyruvate Decarboxylase Complex Gene and the Acetyl-CoA Carboxylase Gene
[0167] This example is a method for constructing a genetically engineered strain of Schizochytrium that expresses the PDC and ACC genes, comprising the following steps performed in sequence:
[0168] S1. Preparation of Schizochytrium Competent Cells
[0169] S1.1 Inoculate a single colony of Schizochytrium sp. HX-308 activated on a plate into 50 mL of sterile seed culture medium and culture at 28°C ± 0.5°C with shaking at 170 rpm for 24 h ± 0.5 h.
[0170] S1.2 Transfer the primary seed solution to 50 mL of fresh seed culture medium at a 5% volume percentage inoculum and perform secondary expansion culture while maintaining the same culture parameters.
[0171] S1.3 Repeat the secondary expansion process described in step S1.2 twice to establish a stable cell culture system.
[0172] S1.4 Take 25 mL of the bacterial suspension in the logarithmic growth phase and centrifuge it at 4000 rpm for 2 min at room temperature. Remove the supernatant after centrifugation.
[0173] S1.5 Use 25 mL of pretreatment solution (Tris-HCl buffer system with pH 6.5 containing 20 mM dithiothreitol and 0.1 M calcium chloride) to intermittently vortex the bacteria to promote cell wall structure relaxation.
[0174] S1.6 Perform two low-temperature centrifugation washes using pre-cooled sterile water. The centrifugation parameters are set to: 4000 rpm, 4°C, 2 min. After each wash, completely remove the supernatant.
[0175] S1.7 Resuspend and wash the cells in 1 M sterile, pre-cooled sorbitol containing 0.1 M calcium chloride. Centrifuge at 4000 rpm, 4°C, for 2 min. Remove the supernatant completely after each wash.
[0176] S1.8 After the final bacterial pellet is resuspended in 200 μL of the above sorbitol protection solution, 100 μL / tube is dispensed into pre-cooled 1.5 mL sterile centrifuge tubes and temporarily stored in an ice water bath until use.
[0177] S2. Electrotransformation of Schizochytrium
[0178] S2.1 Take 100 μL of the pre-prepared Schizochytrium competent cell suspension and mix it with 10 μL of the linearized recombinant plasmid vector (pzpk-BleoR-PDC single plasmid, pzpk-NeoR-ACC single plasmid, and pzpk-BleoR-PDC and pzpk-NeoR-ACC double plasmid) at low temperature, transfer it to a pre-cooled electric rotation cup, and let it stand in an ice water bath for 30 min ± 2 min.
[0179] S2.2 Plasmids were introduced into cells by electroporation, with the electroporation parameters set to 2.0 kV constant voltage, 5 ms single pulse duration, and 2 mm electrode spacing.
[0180] S2.3 Immediately after the electroporation, add 1 mL of pre-chilled recovery medium (i.e., seed medium supplemented with 1 M sorbitol), mix gently, and transfer to 5 mL of the same type seed medium for osmotic pressure repair.
[0181] S2.4 Place the recovery system in a constant temperature shaker, control the temperature at 28℃±0.5℃, the shaking frequency at 180rpm±5rpm, and implement adaptive cultivation for 2.5h±0.5h.
[0182] S2.5 Quantitatively pipette 200 μL of the revived bacterial suspension and spread it on GPY medium containing bleomycin at a final concentration of 1‰, neomycin at a final concentration of 1‰, and bleomycin-neomycin dual-resistance at a final concentration of 1‰. Selectively culture at a constant temperature of 28℃±0.5℃ for 48h±12h to obtain pzpk-BleoR-PDC single-plasmid recombinant bacteria 1, pzpk-NeoR-ACC single-plasmid recombinant bacteria 2, and pzpk-BleoR-PDC / pzpk-NeoR-ACC double-plasmid recombinant bacteria 3.
[0183] S3. Screening of recombinant strains and verification of genetic stability
[0184] S3.1 Select monoclonal colonies with a diameter ≥ 2 mm and inoculate them into seed culture medium containing 50 mg / L bleomycin (recombinant strain 1), 50 mg / L neomycin (recombinant strain 2), and 50 mg / L bleomycin- and neomycin-resistant strains (recombinant strain 3). Carry out primary screening culture at 28°C ± 0.5°C and 180 rpm ± 5 rpm for 24 h ± 0.5 h.
[0185] S3.2 Perform five consecutive subcultures, with each generation being rejuvenated in a selective seed medium containing 50 mg / L bleomycin and 50 mg / L neomycin, using the same culture parameters as those used for the primary screening.
[0186] S3.3 Verify the integration of the exogenous gene by PCR amplification and restriction enzyme digestion. After confirming the genetic stability, store it in an ultra-low temperature refrigerator at -80℃±2℃ for long-term storage.
[0187] The seed culture medium has a pH value of 6.0-6.5 and comprises: 40-60 g / L glucose, 4-6 g / L yeast extract, 5-8 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, 8-12 g / L sodium glutamate, 1-5 mg / L zinc sulfate heptahydrate, 0.01-0.1 mg / L cobalt chloride hexahydrate, 2-6 mg / L copper sulfate pentahydrate, 1-2 mg / L nickel sulfate hexahydrate, 8-15 mg / L iron sulfate heptahydrate, 2-4 mg / L calcium pantothenate, 3-5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.
[0188] Example 4 Application of a genetically engineered Schizochytrium strain expressing PDC and ACC genes in DHA synthesis
[0189] In this example, the recombinant bacteria 1, 2, and 3 constructed in Example 3 are applied to produce DHA. The method includes the following steps performed in sequence:
[0190] S1. Activation of recombinant bacteria
[0191] Recombinant strains 1, 2, and 3 were inoculated into a 250 mL conical flask containing 50 mL of seed culture medium and cultured at 28°C ± 0.5°C and 180 rpm for 24 hours to obtain a primary seed solution. One mL of the primary seed solution was transferred to an equal volume of fresh culture medium and cultured under the same conditions for 24 hours to obtain a secondary seed solution. One mL of the secondary seed solution was transferred to the same system culture medium and cultured under the same parameters for 24 hours to obtain a fermentation seed solution.
[0192] The seed culture medium has a pH value of 6.0-6.5 and comprises: 40-60 g / L glucose, 4-6 g / L yeast extract, 5-8 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, 8-12 g / L sodium glutamate, 1-5 mg / L zinc sulfate heptahydrate, 0.01-0.1 mg / L cobalt chloride hexahydrate, 2-6 mg / L copper sulfate pentahydrate, 1-2 mg / L nickel sulfate hexahydrate, 8-15 mg / L iron sulfate heptahydrate, 2-4 mg / L calcium pantothenate, 3-5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.
[0193] S2. Recombinant bacterial fermentation
[0194] 10 mL of the third-grade seed culture solution was inoculated into a 500 mL conical flask (containing 100 mL of fermentation medium), and cultured in a shaking incubator at 28°C and 180 r / min for 120 h. Samples were taken every 24 h to measure the fatty acid composition.
[0195] The fermentation medium has a pH value of 6.0-6.5 and comprises: 70-80 g / L glucose, 10-30 g / L glycerol, 5-15 g / L yeast extract, 5-12 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, and 0.5-2 g / L potassium dihydrogen phosphate. Monosodium glutamate 15~20g / L, zinc sulfate heptahydrate 1~5mg / L, cobalt chloride hexahydrate 0.01~0.1mg / L, copper sulfate pentahydrate 2~6mg / L, nickel sulfate hexahydrate 1~2mg / L, ferric sulfate heptahydrate 8~15mg / L, calcium pantothenate 2~4mg / L, manganese chloride tetrahydrate 3~5mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 4~10mg / L.
[0196] S3. Analysis of fermentation products
[0197] After the fermentation is completed, the pH of the fermentation broth is adjusted to 11-13 with 1 mol / L NaOH. A cell wall-breaking enzyme is added at 0.5% (v / v) of the total volume of the fermentation broth. After enzymatic hydrolysis at 55°C for 1 hour, the cell wall-breaking enzyme is cooled to room temperature and an equal volume of anhydrous ethanol is added to inactivate the cell wall-breaking enzyme. Extraction is then performed with n-hexane, which is the same volume as the cell wall-breaking broth. The mixture is allowed to stand for separation and the upper yellow organic phase is collected.
[0198] 20 μL of oil was added to an EP tube containing 1 mL of 1 M potassium hydroxide-methanol solution. The mixture was shaken at 20°C and 1000 rpm for 6 h. The reaction was terminated by the addition of 50 μL of concentrated sulfuric acid. Lipids were extracted by the addition of 1 mL of n-hexane and shaken at 20°C and 1000 rpm for 0.5 h. The extract was transferred to a liquid chromatography vial for gas chromatography-mass spectrometry analysis. Analysis was performed using a GC-2010 (Shimadzu, Japan) gas chromatography system, using nitrogen as the carrier gas. The injection volume was 1 μL, and the injection temperature was 250°C. The column temperature was increased from 100°C to 200°C at a rate of 25°C / min, then to 230°C at a rate of 4°C / min and held for 9 min. The FID detector temperature was 280°C. Different fatty acid compositions were identified by comparison with Sigma standards. The content of individual fatty acids was estimated by peak area using a non-endogenous fatty acid (C11:0) as an internal standard. DHA methyl ester standard was used for qualitative and quantitative analysis. The results of the determination of the oil content and DHA content of the fermentation recombinant bacteria 1, 2, and 3 are shown in the figure below. Figure 5 As shown;
[0199] Depend on Figure 5 As shown, the oil content of recombinant strain 3 reached 67.18 g / L, an increase of 16.89%, 12.23%, and 43.13% compared to recombinant strain 1, recombinant strain 2, and the wild-type strain, respectively. The DHA content reached 55.76% of the total fatty acids, an increase of 27.03%, 33.23%, and 53.28% compared to recombinant strain 1, recombinant strain 2, and the wild-type strain, respectively. The genetically engineered Schizochytrium strain expressing the PDC and ACC genes constructed using the construction method of the present invention can successfully and efficiently produce DHA, which helps reduce the production cost of DHA.
[0200] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.
Claims
1. An engineered Schizochytrium strain co-expressing the PDC-ACC gene, characterized in that: The engineered strain is obtained by using Schizochytrium as the starting strain and expressing the pyruvate decarboxylase complex gene PDC and the acetyl-CoA carboxylase gene ACC in Yarrowia lipolytica; The gene sequence of the gene PDC is SEQ ID No. 1, and the gene sequence of the gene ACC is SEQ ID No.
2.
2. The engineered strain according to claim 1, characterized in that: The Schizochytrium is Schizochytrium HX-308, and the Yarrowia lipolytica is Y. lipolytica Po1f.
3. The method for constructing an engineered strain according to claim 1 or 2, wherein: The steps include: S1. Construction of recombinant plasmid pzpk-BleoR-PDC The plasmid pzpk-BleoR was used as a backbone, and the PDC expression cassette was inserted into the plasmid backbone to obtain the recombinant plasmid pzpk-BleoR-PDC; S2. Construction of recombinant plasmid pzpk-NeoR-ACC The plasmid pzpk-NeoR was used as the backbone, and the ACC expression cassette was inserted into the plasmid backbone to obtain the recombinant plasmid pzpk-NeoR-ACC; S3. Construction of engineered Schizochytrium strains expressing PDC and ACC genes The recombinant plasmids pzpk-BleoR-PDC and pzpk-NeoR-ACC were introduced into Schizochytrium HX-308 cells to obtain recombinant bacteria, and the obtained recombinant bacteria were Schizochytrium engineered strains that efficiently produced DHA.
4. The method for constructing an engineered strain according to claim 3, wherein: In steps S1 and S2, the promoters of the PDC expression cassette and the ACC expression cassette are the P2845 promoter and the P2520 promoter of Schizochytrium, and the terminators are the T2845 terminator and the CYC1t terminator of Schizochytrium; The gene sequence of the P2845 promoter is shown in SEQ ID No. 8, the gene sequence of the T2845 terminator is shown in SEQ ID No. 11, the gene sequence of the P2520 promoter is shown in SEQ ID No. 16, and the gene sequence of the CYC1 terminator is shown in SEQ ID No.
19.
5. The method for constructing an engineered strain according to claim 3, wherein: In step S3, the introduction is achieved by electroporation.
6. Use of the engineered strain according to claim 1 or 2 in fermentation production of DHA.
7. A method for producing DHA by fermentation using the engineered strain according to claim 1 or 2, characterized in that: The fermentation is carried out in a shaking table at a temperature of 26-30° C., a time of 80-120 hours, a rotation speed of 160-200 rpm, and a glucose concentration of 80-100 g / L in the fermentation medium.
8. The method according to claim 7, wherein: The specific steps are as follows: S1. Activation of recombinant bacteria The engineered strain was inoculated into a seed culture medium and cultured under shaking conditions of 28°C ± 0.5°C and 180 rpm for 24 hours to obtain a first-level seed solution; the first-level seed solution was transferred to a fresh seed culture medium at an inoculum rate of 2% and amplified under the same culture conditions for 24 hours to obtain a second-level seed solution; the second-level seed solution was transferred to a seed culture medium at an inoculum rate of 2% and cultured under the same parameters for 24 hours to obtain a fermentation seed solution; S2. Recombinant Bacterial Fermentation The fermentation seed liquid was inoculated into the fermentation medium at an inoculum rate of 10%, and cultured in a shaking incubator at 28°C and 180 rpm for 120 hours to obtain DHA.
9. The method according to claim 8, characterized in that: The seed culture medium has a pH value of 6.0-6.5 and comprises: 40-60 g / L glucose, 4-6 g / L yeast extract, 5-8 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, 8-12 g / L sodium glutamate, 1-5 mg / L zinc sulfate heptahydrate, 0.01-0.1 mg / L cobalt chloride hexahydrate, 2-6 mg / L copper sulfate pentahydrate, 1-2 mg / L nickel sulfate hexahydrate, 8-15 mg / L iron sulfate heptahydrate, 2-4 mg / L calcium pantothenate, 3-5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate. The pH value of the fermentation medium is 6.0-6.5, and the fermentation medium comprises: 70-80 g / L glucose, 10-30 g / L glycerol, 5-15 g / L yeast extract, 5-12 g / L sodium sulfate, 2-4 g / L magnesium sulfate, 4-8 g / L ammonium sulfate, 1-2 g / L potassium chloride, 0.1-0.2 g / L calcium chloride, 0.5-1 g / L potassium sulfate, 0.5-2 g / L potassium dihydrogen phosphate, and 10 g / L glutamic acid. Sodium mononitrate 15~20g / L, zinc sulfate heptahydrate 1~5mg / L, cobalt chloride hexahydrate 0.01~0.1mg / L, copper sulfate pentahydrate 2~6mg / L, nickel sulfate hexahydrate 1~2mg / L, ferric sulfate heptahydrate 8~15mg / L, calcium pantothenate 2~4mg / L, manganese chloride tetrahydrate 3~5mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 4~10mg / L.
Citation Information
Patent Citations
Schizochytrium sp. and method for producing DHA lipa by using same
CN101575584A
Increasing lipid production and optimizing lipid composition
CN108064268A
Recombinant schizochytrium limacinum with high yield of DHA (docosahexaenoic acid) and construction method and application thereof
CN116555054A
Schizochytrium limacinum genetic engineering strain for overexpressing DHA synthase gene as well as construction method and application of schizochytrium limacinum genetic engineering strain
CN116814447A
Schizochytrium limacinum engineering strain for producing EPA (Eicosapentaenoic Acid) by prolonging desaturation path, construction method and application
CN119307531A
Cited By
DHA (docosahexaenoic acid)-producing heterologous expression lipolytic yeast engineering bacterium as well as construction method and application thereof
CN121736921A