Method for improving regeneration efficiency of cucumber cotyledonary node embryoid by using cucumber gene CsRBOHD

Abstract

The invention discloses a method for improving the regeneration efficiency of cucumber cotyledonary node embryoids by utilizing a cucumber gene CsRBOHD, a novel gene CsRBOHD for improving the regeneration efficiency of the cucumber cotyledonary node embryoids is identified, a homozygous mutant strain with the CsRBOHD gene knocked out is successfully obtained for the first time by utilizing a CRISPR / Cas9 gene editing technology, and the CsRBOHD gene knocked out homozygous mutant strain has the advantages that the CsRBOHD gene knocked out homozygous mutant strain is used for improving the regeneration efficiency of the cucumber cotyledonary node embryoids; and embryogenic callus culture and embryoid induction are carried out on the mutant seeds, and the result shows that the regeneration efficiency of the cucumber cotyledonary node embryoid is remarkably improved by the mutant strain. The method has important theoretical and practical application values for improving somatic embryogenesis efficiency and embryoid regeneration capacity of cucumbers.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to improving the regeneration efficiency of cucumber cotyledonary node embryoids by utilizing the cucumber gene CsRBOHD. Background Art

[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop. Currently, in vitro tissue regeneration systems for cucumber primarily rely on organogenesis, but these systems suffer from strong genotype dependence and low conversion efficiency, making them difficult to meet the needs of gene function verification and transgenic and gene-editing breeding.

[0003] Somatic embryogenesis is one of the important pathways of plant regeneration. Compared with organogenesis, its regeneration system is more suitable for research fields such as somatic mutant screening and protoplast induction. At the same time, somatic embryos are easier to obtain and mass-produced than fertilized eggs. Therefore, they have become an important system for studying the mechanism of embryonic development and are also the basis for artificial seed preparation. However, the somatic embryogenesis system of cucumber still has problems such as low callus induction rate, long culture cycle, and low embryo rate. Optimizing the somatic embryogenesis system and creating new germplasm with high-frequency embryoid regeneration ability are the key to breaking through the bottleneck of genetic transformation and tissue regeneration. At present, the main way to improve the regeneration efficiency of cucumber cotyledonary nodes is to change the hormone ratio or screen for cucumber varieties with high regeneration. No gene editing is involved in existing reports. Summary of the Invention

[0004] Purpose of the invention: In response to the deficiencies in the prior art, the present invention provides a gene CsRBOHD that improves the regeneration rate of embryoids in the cotyledonary nodes of cucumber. The present invention identifies a new gene CsRBOHD that improves the regeneration rate of embryoids in the cotyledonary nodes of cucumber. By utilizing CRISPR / Cas9 gene editing technology, a homozygous mutant strain with CsRBOHD gene knockout was successfully obtained for the first time, and embryonic callus culture and embryoid induction were performed on the mutant seeds. The results showed that the mutant strain significantly improved the regeneration efficiency of embryoids in the cotyledonary nodes of cucumber.

[0005] The present invention also provides application of the gene CsRBOHD for improving the regeneration rate of cucumber cotyledonary node embryoids.

[0006] Technical solution: In order to achieve the above purpose, the present invention provides a gene CsRBOHD for improving the regeneration rate of cucumber cotyledonary node embryoids. The nucleotide sequence of the gene CsRBOHD is shown in SEQ ID NO.1.

[0007] The present invention discloses a gene knockout vector CsRBOHD-CRISPR / Cas9 for the gene CsRBOHD for improving the regeneration rate of cucumber cotyledonary node embryoids.

[0008] The gene knockout vector CsRBOHD-CRISPR / Cas9 is constructed by designing the target gene sequences CsRBOHD-Target1 and CsRBOHD-Target2 of CsRBOHD, and designing amplification primers CsRBOHD-Primer-F and CsRBOHD-Primer-R according to the target sequences;

[0009] CsRBOHD-Target1:5'-GAGTCGTCACGGATATCAAGGG-3';

[0010] CsRBOHD-Target2:5'-CTGCCACCCATGCTCTCAAGGG-3';

[0011] CsRBOHD-Primer-F:

[0012] ATATATGGTCTCGATTGGAGTCGTCACGGATATCAAGTTTTAGAGCTAG AAATAGC;

[0013] CsRBOHD-Primer-R:

[0014] ATTATTGGTCTCTAAACTTGAGAGCATGGGTTGGCAGCAATCTCTTAGTC GACTCTAC;

[0015] Using CsRBOHD-Primer-F and CsRBOHD-Primer-R as primers and pCBC-DT1T2 as a template, the dual-target fragments were amplified. The target fragments were ligated to the pkSE402 vector using Golden Gate enzyme. After transformation and plasmid extraction, the gene knockout vector CsRBOHD-CRISPR / Cas9 was finally obtained.

[0016] The present invention provides a host bacterium containing the gene knockout vector CsRBOHD-CRISPR / Cas9.

[0017] Wherein, the host bacteria is Agrobacterium EH105 as the starting bacteria.

[0018] The gene CsRBOHD or the gene knockout vector CsRBOHD-CRISPR / Cas9 or the host bacteria described in the present invention are used to improve the regeneration rate of cucumber cotyledonary node embryoids.

[0019] Among them, the application of knocking out the gene CsRBOHD in cucumber to improve the regeneration rate of embryoids in cucumber cotyledonary nodes.

[0020] The CsRBOHD-CRISPR / Cas9 vector is transferred into EHA105 Agrobacterium; the Agrobacterium transferred with the vector is used to infect the cotyledonary nodes of cucumber, and tissue culture is performed to obtain a homozygous mutant strain with CsRBOHD gene knockout; and the seeds of the homozygous mutant strain are used to induce the formation of embryoids in the cotyledonary nodes.

[0021] The application of the gene CsRBOHD or the gene knockout vector CsRBOHD-CRISPR / Cas9 or the host bacteria of the present invention in cultivating cucumber cotyledonary node embryoid regeneration efficiency germplasm.

[0022] The present invention utilizes the cucumber CsRBOHD gene to construct a CsRBOHD gene knockout cucumber material, which can improve the embryoid regeneration rate of cucumber cotyledonary nodes. Furthermore, the CsRBOHD gene is knocked out using a CRISPR / Cas9 editing system to obtain a CsRBOHD gene knockout strain.

[0023] This study, using the leading cucumber variety "9930" as the material, utilized CRISPR / Cas9 gene editing technology to generate a homozygous mutant strain with the CsRBOHD gene knockout. This mutant strain demonstrated enhanced embryoid regeneration compared to the wild-type. This study is of great significance for improving the efficiency of somatic embryogenesis and embryoid regeneration in cucumber. The research findings of this study have important production and theoretical implications for cucumber breeding and germplasm resource development.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0025] This study identified a novel gene that increases the regeneration rate of cucumber embryoids from the cotyledonary nodes, providing a new genetic resource for improving the efficiency of somatic embryogenesis and embryoid regeneration in cucumber. The study generated CsRBOHD gene-edited mutants and overexpression mutants of cucumber through genetic transformation. Compared to the wild type, the gene-edited mutants significantly increased the regeneration efficiency of cucumber embryoids from the cotyledonary nodes.

[0026] The present invention applies the gene to crops with mature transgenic systems to obtain germplasm with high cucumber cotyledonary node embryoid regeneration efficiency, which has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Map of the vector for CRISPR / Cas9 editing of the CsRBOHD gene;

[0028] Figure 2 The nucleotide sequence of the gene-edited cucumber mutant for the CsRBOHD gene;

[0029] Figure 3The process of inducing embryogenic callus from cucumber cotyledonary nodes;

[0030] Figure 4 Callus induction of wild-type and transgenic cucumber cotyledonary nodes for 28 days;

[0031] Figure 5 The area of ​​adaxial embryogenic callus after 28 days of culture;

[0032] Figure 6 Cucumber embryoids at different developmental stages induced by embryonic callus and their derived plantlets, including a. globular embryo; b. heart-shaped embryo; c. torpedo-shaped embryo; d. cotyledon-shaped embryo; e. cotyledon-shaped embryo; f. plantlets induced by embryoids;

[0033] Figure 7 Embryoids induced from the cotyledonary nodes of wild-type and transgenic cucumbers and their derived plantlets;

[0034] Figure 8 The number of plantlets produced by embryoids induced from cotyledonary nodes of wild-type and transgenic cucumbers. DETAILED DESCRIPTION

[0035] The present invention will be further described below with reference to the accompanying drawings and examples.

[0036] The cucumber transformation recipient material is the cucumber inbred line "9930", provided by Yangzhou University. The article "Anear-complete cucumber reference genome assembly and Cucumber-DB, a multi-omics database" was published in the Molecular Plant journal in 2024. The above-mentioned germplasm resources are deposited in the germplasm bank of the applicant's laboratory.

[0037] Example 1

[0038] According to the gene ID (CsaV3_3G043480) on NCBI, the cucumber CsRBOHD gene of the present invention was constructed, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the protein translated from its exons is shown in SEQ ID NO.2.

[0039] Example 2

[0040] Acquisition of CsRBOHD gene knockout mutants:

[0041] 1. Construction of CsRBOHD gene knockout vector

[0042] CRISPR / Cas9 editing knockout targets were designed for the CsRBOHD gene. The selected targets were all located in the first exon of the CsRBOHD gene, conforming to the design principle that the knockout site must be located in the coding sequence (CDS) region and before the important functional domain. The specific target sequences are as follows:

[0043] Table 1

[0044]

[0045] Based on the target sequences in Table 1, a pair of primers, CsRBOHD-Primer-F and CsRBOHD-Primer-R, were designed. Each primer contained a portion of the target sequence. A high-fidelity DNA polymerase was used to amplify the target fragment using the intermediate vector pCBC-DT1T2 as a template. After agarose gel electrophoresis, the amplified product was excised and purified using a gel extraction kit for subsequent experiments. The specific primer sequences are shown in Table 2:

[0046] Table 2

[0047]

[0048] Using pCBC-DT1T2 as a template, PCR amplification of the target fragment was performed using PrimerSTAR High-Fidelity Enzyme. The reaction system (50 μL) contained 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture, 1 μL of CsRBOHD-Primer-F primer, 1 μL of CsRBOHD-Primer-R primer, 32.5 μL of ddH2O, 1 μL of pCBC-DT1T2 plasmid, and 0.5 μL of PrimerSTAR High-Fidelity Enzyme. The reaction procedure was 95°C for 5 min, followed by 35 cycles of 95°C for 15 sec, 55°C for 15 sec, and 72°C for 15 sec, and finally 72°C for 5 min.

[0049] The amplified target fragment product was ligated to the pkSE402 vector using the Golden Gate enzyme digestion and ligation method. The Golden Gate enzyme digestion and ligation reaction system was as follows: 3 μl of pkSE402 plasmid, 2 μl of purified target fragment, 1.5 μl of T4 DNA Ligase, 1.5 μl of 10×T4 Ligase Buffer, 1.5 μl of BsaI, and 5.5 μl of ddH2O; the Golden Gate reaction conditions were as follows: 37°C for 3 min, 16°C for 4 min, for a total of 40 cycles; and 80°C for 10 min. 15 μL of the ligation product was added to 50 μL of competent E. coli, and the two were mixed evenly and frozen on ice for 30 minutes, heat-shocked at 42°C for 30 seconds, and then allowed to stand on ice for 2 minutes. 500 μL of LB liquid medium was added, mixed evenly, and cultured in a 37°C constant temperature shaker for 1 hour. 100 μL of the bacteria was spread on Kan+LB solid medium, and the culture medium was cultured in a 37°C incubator for 12-16 hours. A single colony was picked for positive detection and sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing primer was SEQ ID NO.7 (Table 3). The correct single clone was selected for expansion and used Plasmid was extracted with Plasmid Mini Kit to obtain gene knockout vector CsRBOHD-CRISPR / Cas9. The recombinant vector map is as follows: Figure 1 The plasmid was transformed into competent Agrobacterium EHA105. The competent EHA105 was thawed on ice. 50 μL of competent medium and 2 μL of plasmid were aspirated and mixed. The cells were then placed on ice for 5 minutes, in liquid nitrogen for 5 minutes, at 37°C for 5 minutes, and on ice for 5 minutes. 700 μL of LB liquid medium was added and mixed. The cells were cultured in a shaker at 28°C for 2-3 hours. 100 μL of the cells were spread on Kan+Rif LB solid medium and cultured in a constant temperature incubator at 28°C for 2-3 days. Single clones were selected for detection and preservation to obtain Agrobacterium carrying the CsRBOHD-CRISPR / Cas9 vector for subsequent genetic modification.

[0050] Transformed Agrobacterium was inoculated onto solid LB plates containing 50 mg / L kanamycin and 25 mg / L rifampicin and cultured at 28°C for 2-3 days. A single colony was picked and inoculated into 5 mL of liquid LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. The culture was shaken overnight at 28°C and 220 rpm. One μL of the bacterial suspension was then used for PCR identification using primers SEQ ID NO. 8 and SEQ ID NO. 9 (Table 4). The colony identification PCR reaction system consisted of: 10 μL of 2× Rapid Taq Master Mix, 1 μL of U629-IDF, 1 μL of U629-IDR, 1 μL of bacterial suspension, and 7 μL of ddH2O. The reaction conditions were 95°C for 3 min, followed by 30 cycles of 95°C for 15 sec, 56°C for 15 sec, and 75°C for 60 sec, and 72°C for 5 min.

[0051] Table 3

[0052] Sequencing primers 5’-3’ U626-IDF TGTCCCAGGATTAGAATGATTAGGC SEQ ID NO.7

[0053] Table 4

[0054] Identification primers 5’-3 U629-IDF TTAATCCAAACTACTGCAGCCTGAC SEQ ID NO.8 U629-IDR AGCCCTCTTCTTTCGATCCATCAAC SEQ ID NO.9

[0055] 2. Agrobacterium Transformation of Cucumber

[0056] The identified bacterial suspension was transformed into the cotyledonary nodes of the cucumber inbred line "9930" via Agrobacterium tumefaciens EHA105-mediated infection to generate a CsRBOHD gene knockout mutant. The genetic transformation procedures are detailed in the article "Targeted creation of new mutants with compact plant architecture using CRISPR / Cas9 genome editing by an optimized genetic transformation procedure in cucurbit plants," published in Horticulture Research in 2022. Gene-edited lines Csrbohd#1 and Csrbohd#2 were generated through conventional genetic transformation.

[0057] Example 2

[0058] Verification and propagation of CsRBOHD gene knockout mutants:

[0059] The primer sequences for knockout mutant verification are shown in Table 5:

[0060] Table 5

[0061] name 5’-3’ Target-F1 GTCAGTAGCGTCAGAAGGG SEQ ID NO.10 Target-R1 AGGAGTCCGTTGGTAGAGG SEQ ID NO.11

[0062] DNA from wild-type and CsRBOHD gene knockout cucumber plants was used as template for PCR amplification, and the amplified products were sent to a sequencing company for sequencing analysis. Figure 2 As shown, WT represents the wild-type cucumber inbred line "9930," and Csrbohd#1 and Csrbohd#2 are two mutant lines generated through CRISPR / Cas9 editing. Target1 and Target2 are the gene editing target sequences designed by the CRISPR / Cas9 system. The red box marks the deletion of the CsRBOHD gene after editing, demonstrating the successful knockout of the CsRBOHD gene shown in SEQ ID NO. 1. The edited lines were self-pollinated and seed was purified through three generations for subsequent research.

[0063] Example 3

[0064] Embryogenic callus culture of CsRBOHD gene knockout seeds:

[0065] Select cucumber seeds with full grains and uniform size, including the wild-type cucumber inbred line "9930" (WT), Csrbohd#1 and Csrbohd#2, soak them in 55°C warm water for more than 30 minutes to remove the seed coat. In the clean bench, perform the following disinfection steps in sequence: wash with 75% (v / v) ethanol for 30 seconds, then soak in 0.3% (w / v) sodium hypochlorite solution for 15 minutes, gently shake during the process, and finally rinse with sterile distilled water 5 times. Transfer the disinfected seeds to the pre-prepared seed germination medium and sow about 40 seeds in each culture dish. Place the culture dish in a constant temperature incubator at 28°C for dark culture for 48 hours. After the seeds germinate, cut the explants in the clean bench. The specific operation is: cut off about 1 / 3 of the cotyledons at the distal end of the explant, retain about 1mm of the hypocotyl, and separate the two cotyledons (such as Figure 3 Prepared explants were placed in callus induction medium with the leaf side facing up and the base of the hypocotyl cut in contact with the culture medium surface. Culture conditions were 22°C, a 16-hour light / 8-hour dark photoperiod, a light intensity of 2000 lx, and a relative humidity of 80%. After 28 days of culture, the explants were transferred to embryoid induction medium and cultured under the same conditions for another 30 days to promote embryoid formation.

[0066] The culture medium is as follows:

[0067] Seed germination medium: MS, 30 g / L sucrose, 2.2 g / L phytagel;

[0068] Callus induction medium: MS, 1.5 mg / L 2,4-D, 30 g / L sucrose, 2.6 g / L phytagel.

[0069] After callus induction culture was completed, ImageJ software was used to calculate the area of ​​adaxial embryonic callus, such as Figure 4 、 Figure 5 As shown in the figure, there is no significant difference in callus area between the CsRBOHD gene knockout mutant and the wild type. The results indicate that CsRBOHD gene knockout does not affect the size of embryonic callus.

[0070] Example 4

[0071] CsRBOHD gene knockout seed embryoid induction culture:

[0072] The explants cultured for 28 days after callus induction were transferred to embryoid induction medium according to the method of Example 3. The culture conditions were 22°C, a photoperiod of 16 hours light / 8 hours dark, a light intensity of 2000 lx, and a relative humidity of 80%. The culture was carried out for 30 days to induce embryoid formation. Figure 6 shown.

[0073] Embryoid induction medium: MS, 30 g / L sucrose, 2.2 g / L phytagel.

[0074] After the embryoid induction culture was completed, the average number of embryoids on the explants in each culture box was counted and repeated 8 times. Figure 7 、 Figure 8 As shown in the figure, compared with the wild type, the number of induced embryoids in the CsRBOHD gene knockout mutant was significantly increased. The results showed that CsRBOHD gene knockout can increase the embryoid induction rate in cucumber cotyledonary nodes.

Claims

1. A gene CsRBOHD for improving the regeneration rate of cucumber cotyledonary node embryoids, characterized in that: The nucleotide sequence of the gene CsRBOHD is shown in SEQ ID NO.

1.

2. A gene knockout vector CsRBOHD-CRISPR / Cas9 based on the gene CsRBOHD for improving the regeneration rate of cucumber cotyledonary node embryoids according to claim 1.

3. The gene knockout vector CsRBOHD-CRISPR / Cas9 according to claim 3, characterized in that The gene knockout vector CsRBOHD-CRISPR / Cas9 is constructed by designing CsRBOHD target gene sequences CsRBOHD-Target1 and CsRBOHD-Target2; designing amplification primers CsRBOHD-Primer-F and CsRBOHD-Primer-R according to the target sequences; using CsRBOHD-Primer-F and CsRBOHD-Primer-R as primers and pCBC-DT1T2 as a template to amplify dual-target fragments, connecting the target fragments to the vector, performing transformation, and extracting the plasmid to ultimately obtain the gene knockout vector CsRBOHD-CRISPR / Cas9.

4. The gene knockout vector CsRBOHD-CRISPR / Cas9 according to claim 3, characterized in that The sequences of CsRBOHD-Target1, CsRBOHD-Target2, CsRBOHD-Primer-F, and CsRBOHD-Primer-R in the gene knockout vector CsRBOHD-CRISPR / Cas9 are preferably: CsRBOHD-Target1:5'-GAGTCGTCACGGATATCAAGGG-3'; CsRBOHD-Target2:5'-CTGCCACCCATGCTCTCAAGGG-3'; CsRBOHD-Primer-F: ATATATGGTCTCGATTGGAGTCGTCACGGATATCAAGTTTTAGAGCTAG AAATAGC; CsRBOHD-Primer-R: ATTATTGGTCTCTAAACTTGAGAGCATGGGTGGCAGCAATCTCTTAGTC GACTCTAC.

5. A host bacterium containing the gene knockout vector CsRBOHD-CRISPR / Cas9 according to claim 3.

6. The host bacteria according to claim 5, characterized in that The host bacteria is Agrobacterium EHA105.

7. Use of the gene CsRBOHD according to claim 1, the gene knockout vector CsRBOHD-CRISPR / Cas9 according to claim 3, or the host bacteria according to claim 5 in improving the regeneration rate of cucumber cotyledonary node embryoids.

8. The use according to claim 7, characterized in that The application of knocking out the gene CsRBOHD in cucumber to improve the regeneration rate of embryoids in cotyledonary nodes of cucumber.

9. The use according to claim 7, characterized in that The CsRBOHD-CRISPR / Cas9 vector is transferred into EHA105 Agrobacterium; the Agrobacterium transferred with the vector is used to infect the cotyledonary nodes of cucumber, and tissue culture is performed to obtain a homozygous mutant strain with CsRBOHD gene knockout; and seeds of the homozygous mutant strain are used to induce the formation of embryoids in the cotyledonary nodes.

10. Use of the gene CsRBOHD according to claim 1, the gene knockout vector CsRBOHD-CRISPR / Cas9 according to claim 3, or the host bacteria according to claim 5 in cultivating cucumber germplasm with high cotyledonary node embryoid regeneration efficiency.

Images