SV molecular marker remarkably related to drought tolerance and yield of corn and application of SV molecular marker
By developing SV variants of ZmMETTL gene related to corn drought tolerance and providing nucleotide sequences and primer pairs, the problem of inefficient corn breeding in the prior art is solved, synchronous improvement of corn drought tolerance and yield has been achieved, and breeding accuracy and efficiency have been improved.
Patent Information
- Application Number
- CN202510655477.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-08-22
AI Technical Summary
The prior art lacks structural variation (SV) molecular markers significantly associated with corn drought tolerance and yield, resulting in inefficient corn breeding and difficulty in achieving synchronous improvement of drought tolerance and yield.
Develop SV variants of the ZmMETTL gene related to corn drought tolerance, provide nucleotide sequences and primer pairs, and screen out homozygous deletion DD type, homozygous insertion type II and heterozygous ID type corn materials through PCR amplification and electrophoresis detection, and use kits to assist breeding.
Accurate identification of corn drought tolerance and yield has been achieved, and high-yield and drought-tolerant corn materials have been screened out, which has improved breeding efficiency and accuracy.
Smart Images

Figure CN120519608A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular marker-assisted breeding, and in particular to an SV molecular marker significantly correlated with corn drought resistance and yield and an application thereof. Background Art
[0002] Maize is an important food crop, and drought is the single largest abiotic stress factor contributing to maize yield reductions. Yield is the most important indicator of maize drought tolerance, while agronomic traits such as the anthesis silking interval (ASI) and plant height also play an important role in evaluating drought tolerance in maize materials. Improving drought tolerance and yield has long been a key research focus in maize breeding. Traditional breeding methods rely primarily on phenotypic selection, screening for drought-related traits through field observation and statistical analysis. However, this approach has significant limitations. The phenotype is easily affected by environmental factors, and the screening cycle is long and inefficient. In particular, when selecting for complex traits such as drought tolerance, relying solely on phenotypic data often makes it difficult to achieve precise selection, resulting in slow breeding progress and difficulty in consistently obtaining the desired trait.
[0003] With the development of molecular biology, molecular marker-assisted selection technology has provided a new direction for corn breeding. At present, some molecular markers related to drought tolerance have been reported, such as SSR markers and SNP markers. However, these markers are mostly based on single nucleotide variations or simple sequence repeats, and their correlation with drought tolerance is limited, and their prediction accuracy and stability are insufficient. Structural variation (SV) generally refers to sequence changes of more than 50bp in the genome of an organism. SV includes large-scale deletions, insertions, duplications, inversions, translocations and other types. Structural variations in coding regions may affect gene transcription to change translation products, and structural variations in non-coding regions may affect gene expression regulation through position effects.
[0004] SVs, as an important type of genomic variation, play a key role in regulating crop traits, but their application in maize drought tolerance and yield research has not been fully explored. Existing technologies lack SV molecular markers that are significantly associated with maize drought tolerance and yield, making it difficult to efficiently identify drought-tolerant germplasm resources and achieve simultaneous improvement of drought tolerance and yield. Therefore, developing an SV molecular marker closely associated with maize drought tolerance and yield is of great significance for improving the precision and efficiency of maize molecular breeding. Summary of the Invention
[0005] The present invention aims to provide an SV molecular marker significantly associated with maize drought tolerance and yield, and its application, to address the problems of the prior art described above. The present invention discovered an SV variant of the ZmMETTL gene associated with maize drought tolerance. This SV variant was significantly correlated with plant height, ear weight, and grain weight per ear of maize materials under both normal watering and drought conditions, providing a new direction for the identification of maize drought-tolerant germplasm resources and assisting molecular breeding for maize drought tolerance.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides an SV molecular marker significantly associated with drought tolerance and yield of corn, wherein the SV molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.4 and a nucleotide sequence as shown in SEQ ID NO.5;
[0008] The homozygous genotype containing the nucleotide sequence shown in SEQ ID NO. 4 is homozygous insertion type II;
[0009] The homozygous genotype containing the nucleotide sequence shown in SEQ ID NO.5 is the homozygous deletion DD type;
[0010] The heterozygous genotype containing both the nucleotide sequence shown in SEQ ID NO.4 and the nucleotide sequence shown in SEQ ID NO.5 is a heterozygous ID type;
[0011] The drought tolerance and yield of the homozygous deletion DD type corn were better than those of the homozygous insertion II type and heterozygous ID type corn.
[0012] The present invention also provides a primer pair for detecting the SV molecular marker, wherein the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.3.
[0013] The present invention also provides a detection reagent comprising the primer pair.
[0014] The present invention also provides a kit comprising the primer pair or the detection reagent.
[0015] The present invention also provides the use of the primer pair, the detection reagent or the kit in detecting drought resistance and yield of corn.
[0016] Optionally, the yield includes corn ear weight and corn kernel weight.
[0017] The present invention also provides a method for detecting drought tolerance and yield of corn, comprising the following steps:
[0018] Using the genomic DNA of the corn to be tested as a template, the primer pair is used to perform PCR amplification, and the amplified product is detected by electrophoresis;
[0019] The drought resistance and yield of corn with only one 968bp band in the amplified product were higher than those of corn with only one 146bp band in the amplified product and corn with both 968bp and 146bp bands in the amplified product.
[0020] Optionally, the PCR amplification reaction system is 10.0 μL 2×Rapid Taq Master Mix, 0.5 μL upstream primer, 0.5 μL downstream primer, 8.0 μL ddH 2 O and 1.0 μL template DNA.
[0021] Optionally, the reaction procedure of the PCR amplification is 95°C for 2 min; 95°C for 15 s; 52°C for 15 s; 72°C for 15 s, 40 cycles; and 72°C for 5 min.
[0022] The present invention also provides the use of the primer pair, the detection reagent or the kit in drought-resistant breeding or high-yield breeding of corn.
[0023] The present invention discloses the following technical effects:
[0024] The present invention discovered an SV variant in the ZmMETTL gene associated with drought tolerance in maize. This SV variant is an 822-bp deletion located at positions 174690388-174691209 on chromosome 3 of the maize B73 AGP_v5 version. This SV variant is significantly correlated with plant height, ear weight, and grain weight per ear in maize materials under both normal watering and drought conditions. Maize materials homozygous for the structural variant deletion exhibited higher plant height and yield under both normal watering and drought conditions. This structural variant can be used to screen materials with significant differences in plant height and yield under normal watering and drought conditions.
[0025] The present invention provides a new direction for the identification of drought-resistant corn germplasm resources and auxiliary molecular breeding of drought-resistant corn. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0027] Figure 1 Comparison of SV mutation sites downstream of the ZmMETTL gene and their sequencing results;
[0028] Figure 2The gel electrophoresis detection diagram of the amplified products of some corn materials, where M represents DNA Marker (DL2000), H2O represents the negative control with water as the template; the amplified band size is 146bp, which is confirmed to be the homozygous deletion type DD type; the amplified band size is 968bp, which is confirmed to be the homozygous insertion type II type; the amplified bands of 146bp and 968bp are confirmed to be the heterozygous ID type; the band not amplified is marked as N; each lane and its corresponding The names of crossbreeding materials and the types of structural variation are as follows: 1: D360, DD; 2: F121, DD; 3: N021, II; 4: N98, DD; 5: N98, DD; 6: P44, DD; 7: P44(F2)-311132321, DD; 8: P44(F2)-31133, DD; 9: P44(F2)-31133232, DD; 10: P44(F2)-415111, DD; 11: PH EG 9, ID; 12: BM001, ID; 13: BM005, II; 14: BM006, N; 15: BM008, N; 16: BM009, N; 17: BM010, ID; 18: BM012 , ID; 19: BM013, ID; 20: BM015, ID; 21: BM016, ID; 22: BM017, ID; 23: BM018, ID; 24: BM019, ID; 25: BM0 20, ID; 26: BM021, ID; 27: BM023, ID; 28: BM024, ID; 29: BM025, ID; 30: BM026, ID; 31: BM027, ID; 32: B M028, ID; 33: BM029, ID; 34: BM033, N; 35: BM034, ID; 36: BM037, ID; 37: BM040, DD; 38: BM042, DD; 39: B M043, DD; 40: BM044, DD; 41: BM046, ID; 42: BM047, N; 43: BM048, ID; 44: BM049, ID; 45: BM052, N; 46: B M053, DD; 47: BM054, DD; 48: BM057, II; 49: BM058, ID; 50: BM059, ID; 51: BM060, ID; 52: BM063, ID; 53 : BM064, ID; 54: BM065, ID; 55: BM066, DD; 56: BM067, DD; 57: BM069, ID; 58: BM070, ID; 59: BM071, ID; 60: BM072, ID; 61: BM073, ID; 62: BM074, ID; 63: BM075, ID; 64: BM076, DD; 65: BM077, ID; 66: BM080, N;67: BM081, ID; 68: BM082, ID; 69: BM083, ID; 70: BM084, DD; 71: BM085, DD; 72: BM086, DD; 73: BM087, ID; 74: BM08 8, ID; 75: BM089, ID; 76: BM090, ID; 77: BM091, ID; 78: BM092, ID; 79: BM094, ID; 80: BM095, ID; 81: BM096, ID; 82: BM097, ID; 83: BM099, ID; 84: BM100, ID; 85: BM101, ID; 86: BM104, ID; 87: BM106, II; 88: BM108, ID; 89: BM109, ID ;90: MP052, ID; 91: Zheng32, DD; 92: TY11, DD; 93: CML324, DD; 94: CIMBL122, DD; 95: Sy3073, DD; 96: GEMS18, DD;
[0029] Figure 3 Figure 3 is a phenotypic analysis of structural variation deletion type (SV-DD) and insertion type (SV-I) maize inbred lines; A is the Student's t-test results of single ear weight of deletion type and insertion type maize inbred lines under WW (normal watering) and WS (drought stress) conditions; B is the Student's t-test results of single ear grain weight of deletion type and insertion type maize inbred lines under WW (normal watering) and WS (drought stress) conditions; C is the Student's t-test results of plant height of deletion type and insertion type maize inbred lines under WW (normal watering) and WS (drought stress) conditions. DETAILED DESCRIPTION
[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0031] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0035] Example 1SV molecular marker development
[0036] 1. Experimental Materials
[0037] The present invention uses 549 collected corn germplasms (provided by CIMMYT, China Agricultural University, Sichuan Academy of Agricultural Sciences and Sichuan Agricultural University) as the detection object. The experiment set up one water stress area (WS) and one normal irrigation area (WW), and 549 corn germplasms were planted in the two areas respectively. A completely randomized block design was adopted. The plot was a single-row area with a row spacing of 80 cm×60 cm, double-plant cultivation, 14 plants planted per row, and protective rows set around. The experiment was carried out in a greenhouse, and the soil moisture content of the drought stress group was artificially controlled to be about 10%, and the soil moisture content of the normal control group was about 20%. When the corn grew to the jointing stage, watering was stopped in the drought treatment group, and normal water supply was resumed to the drought treatment group materials after most of the corn powder was shed. During the tasseling and pollen shedding period, five plants with uniform plant shapes were selected from the plot to record their tasseling, silking and pollen shedding times, and the anthesis interval (ASI) between male and female ears was calculated. During the maturity period, five plants with uniform plant shapes were selected to measure their plant heights. During the harvest, the number of harvested ears was recorded, and the weight of each ear and the weight of grains per ear were measured.
[0038] 2. DNA extraction from 549 maize samples
[0039] Leaves from 549 maize accessions were sampled and genomic DNA was extracted using the CTAB method. The specific steps are as follows:
[0040] (1) Preheat 2% CTAB buffer at 65°C;
[0041] (2) 100 mg of fresh leaf tissue from 549 maize materials were placed in separate tubes, quickly frozen in liquid nitrogen, and then fully ground using a grinder.
[0042] (3) Add 400 μL of 2% CTAB buffer and incubate at 65°C for 30 min (invert and mix every 10 min);
[0043] (4) Add an equal volume of chloroform / isoamyl alcohol (24:1, v / v), gently invert to mix, and centrifuge at 4000 rpm for 5 min at room temperature;
[0044] (5) Transfer 200 μL of the supernatant to a new centrifuge tube, add 200 μL of isopropanol, gently invert to mix, precipitate at -20°C for 20 min, and centrifuge at 4000 rpm for 5 min;
[0045] (6) Discard the supernatant and add 75% ethanol to wash the precipitate; discard the supernatant, centrifuge at 4000 rpm for 5 min, and remove the residual ethanol;
[0046] (7) After the precipitate is naturally dried, add 50 μL of ddH2O and gently pipette to mix to dissolve the DNA.
[0047] 3. Amplification of target sequence
[0048] By analyzing the sequences of several different drought-tolerant maize inbred lines, the present invention discovered an SV variation in the downstream reference sequence of the maize ZmMETTL gene (GRMZM2G080825) (maize B73 AGP_v5 version, chromosome 3, positions 174690388-174691209), the sequence diagram of which is shown in FIG. Figure 1 shown.
[0049] The SV variant sequence is shown in SEQ ID NO.1.
[0050] SEQ ID NO.1:
[0051] CGAACAGGGGCGGATCCACGTCCGGGGCTGCCCGGGCTGTAGCCCCGGTCGCGGCCCAGTAGTTCTAGCGAATAGGCCCACGAAGTCCAGGAAAAATAGGTCACGCTCAAGCGGCTTAGCTCCATCACGACATCACCTGCTCGCCGCTCCTAGCCTCTCCCAATCGCGGCCATGGTCTAGCCATCACTCGGACCCCTGCCCACTGCGACACCTCGACGACTAGCGCCGTCCATCGTCGGCAATGGCACCCGGCGGCTGGCGCGGCGACGCTCTATCACGAACACGCTATCGCGGCCTCGCTGGCGCGACACGTCTCTCCGCCTCTTCGTCGCGTGGTCGCGAGGCGCGACACGAGCCCACGGCAGCACGTCGGCACCGTTGCACCGGCCCGTGTTCGTCCTCCCGTCCGTCAGCAGCTCGCCCTCGGCCCCCCGCCAGACCCAGCTCCTGCTTGCTGCTCTAATCGGTGACTGAATCTGTTTTGCTTTTGCAGATTTGCTGGACGACTGAGCGCTAGATACACGATGCAGTTGGGCGGCTGGACGCTGCTGCCTGTTGCTAAACCTAACGCCAGCCAGACTCCCTGAACCAGTGAAGGTGATTTGGTGAAAACAACTGTGTGCTACTGCCTGCTCCTGTTTGTTTTGCTTTGAATCGTCAACCCTGTGCTAGCCTGTTAGGTATTTATAGTTTGATTTGATAAAATTATTTTGCTTCTTGTGTCATATTAAAAATCAATTAGATCTTTTTATTTGGTTTAAATTTTTTTATAACCTTAGCTTAGTAGCCCCTGTCTTATATCAATCCTGGATCCGCCACTGG。
[0052] Using the downstream sequence of the maize ZmMETTL gene published in the Ensembl database as the reference sequence, PCR amplification primers for the variant sequence were designed using Primer 5.0, and their sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0053] Upstream primer: 5′-CAACGATATAATCCCACTACATC-3′, SEQ ID NO. 2;
[0054] Downstream primer: 5'-TAGACCTTTATAAAAGTCCCTTC-3', SEQ ID NO. 3.
[0055] The extracted corn material DNA was used as a template and PCR amplification was performed using 2× Rapid Taq Master Mix of Novozymes. The PCR reaction system is shown in Table 1.
[0056] Table 1 PCR amplification reaction system
[0057]
[0058] The PCR amplification program is shown in Table 2.
[0059] Table 2 PCR amplification program
[0060]
[0061] The PCR products were tested by 1.5% agarose gel electrophoresis. The electrophoresis results showed three different band types: only one 968bp band appeared, and the corresponding material was recorded as homozygous insertion type II; only one 146bp band appeared, and the corresponding material was recorded as homozygous deletion type DD; and two bands of 968bp and 146bp appeared, and the corresponding material was recorded as heterozygous ID. Some of the test results are as follows Figure 2 shown.
[0062] The amplified product was sent to a sequencing company for sequencing. The sequencing results are as follows:
[0063] The sequence of the homozygous insertion type II amplification product is shown in SEQ ID NO.4.
[0064] SEQ ID NO.4 (968 bp):
[0065] CAACGATATAATCCCACTACATCATTTATAATAGACGCATGTAATAGTTTGAAGCGACGAACAGGGGCGGATCCACGTCCGGGGCTGCCCGGGCTGTAGCCCCGGTCGCGGCCCAGTAGTTCTAGCGAATAGGCCCACGAAGTCCAGGAAAAATAGGTCACGCTCAAGCGGCTTAGCTCCATCACGACATCACCTGCTCGCCGCTCCTAGCCTCTCCCAATCGCGGCCATGGTCTAGCCATCACTCGGACCCCTGCCCACTGCGACACCTCGACGACTAGCGCCGTCCATCGTCGGCAATGGCACCCGGCGGCTGGCGCGGCGACGCTCTATCACGAACACGCTATCGCGGCCTCGCTGGCGCGACACGTCTCTCCGCCTCTTCGTCGCGTGGTCGCGAGGCGCGACACGAGCCCACGGCAGCACGTCGGCACCGTTGCACCGGCCCGTGTTCGTCCTCCCGTCCGTCAGCAGCTCGCCCTCGGCCCCCCGCCAGACCCAGCTCCTGCTTGCTGCTCTAATCGGTGACTGAATCTGTTTTGCTTTTGCAGATTTGCTGGACGACTGAGCGCTAGATACACGATGCAGTTGGGCGGCTGGACGCTGCTGCCTGTTGCTAAACCTAACGCCAGCCAGACTCCCTGAACCAGTGAAGGTGATTTGGTGAAAACAACTGTGTGCTACTGCCTGCTCCTGTTTGTTTTGCTTTGAATCGTCAACCCTGTGCTAGCCTGTTAGGTATTTATAGTTTGATTTGATAAAATTATTTTGCTTCTTGTGTCATATTAAAAATCAATTAGATCTTTTTATTTGGTTTAAATTTTTTTATAACCTTAGCTTAGTAGCCCCTGTCTTATATCAATCCTGGATCCGCCACTGGCGACGAACGATAAAAACTATAAAATATATAATGAGATTATACTATGAATGAATATTTTAAATTTTAGAAGGGACTTTTATAAAGGTCTA。
[0066] The sequence of the homozygous deletion DD-type amplification product is shown in SEQ ID NO.5.
[0067] SEQ ID NO.5 (146 bp):
[0068] CAACGATATAATCCCACTACATCATTTATAATAGACGCATGTAATAGTTTGAAGCGAC GACGAACGATAAAAACTATAAAATATATAATGAGATTATACTATGAATGAATATTTTAAATTTTAGAAGGGACTTTTATAAAGGTCTA.
[0069] The sequences of the heterozygous ID-type amplification products are shown in SEQ ID NO. 4 and SEQ ID NO. 5.
[0070] Example 2SV molecular marker verification
[0071] The 549 maize inbred lines were screened using SV molecular markers based on the amplification results, and ultimately 408 homozygous deletion DD inbred lines, 8 homozygous insertion II inbred lines, and 100 heterozygous ID inbred lines were obtained. In addition, no bands were amplified in 33 inbred lines.
[0072] The homozygous deletion type of the structural variation was named SV-DD, and the homozygous insertion type and heterozygous insertion type were collectively referred to as the insertion type structural variation SV-I type. By performing Student's t-test analysis on the plant height and yield traits (single ear weight and single ear grain weight) of the above 108 SV-I insertion type inbred lines and 408 homozygous deletion type DD type inbred lines after drought, it was found that the single ear weight and single ear grain weight of the corn materials with the structural variation of the deletion type SV-DD type were significantly higher than those of the insertion type SV-I type corn materials ( Figure 3 The plant height of SV-DD type maize material under normal watering (WW) and drought treatment (WS) conditions was significantly higher than that of SV-I type maize material ( Figure 3 C).
[0073] The results of the association analysis of yield, plant height and structural variation showed that the yield and biomass of corn materials with deletion-type structural variation were significantly higher than those of insertion-type materials under normal watering and drought treatment conditions; the molecular markers of this structural variation can be used to screen high-yield and drought-resistant corn materials, further assisting corn drought-resistant breeding.
[0074] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. An SV molecular marker significantly associated with drought tolerance and yield in maize, characterized in that: The SV molecular marker includes the nucleotide sequence shown in SEQ ID NO.4 and the nucleotide sequence shown in SEQ ID NO.5; The homozygous genotype containing the nucleotide sequence shown in SEQ ID NO. 4 is homozygous insertion type II; The homozygous genotype containing the nucleotide sequence shown in SEQ ID NO.5 is the homozygous deletion DD type; The heterozygous genotype containing both the nucleotide sequence shown in SEQ ID NO.4 and the nucleotide sequence shown in SEQ ID NO.5 is a heterozygous ID type; The drought tolerance and yield of the homozygous deletion DD type corn were better than those of the homozygous insertion II type and heterozygous ID type corn.
2. A primer pair for detecting the SV molecular marker according to claim 1, characterized in that: The primer pair includes an upstream primer whose nucleotide sequence is shown as SEQ ID NO.2 and a downstream primer whose nucleotide sequence is shown as SEQ ID NO.
3.
3. A detection reagent, characterized in that Comprising the primer pair according to claim 2.
4. A kit, characterized in that The method comprises the primer pair according to claim 2 or the detection reagent according to claim 3.
5. Use of the primer pair according to claim 2, the detection reagent according to claim 3 or the kit according to claim 4 in detecting drought tolerance and yield of corn.
6. The use according to claim 5, characterized in that The yield includes corn ear weight and corn kernel weight.
7. A method for detecting drought tolerance and yield of corn, characterized in that: The following steps are involved: Using the genomic DNA of the corn to be tested as a template, PCR amplification is performed using the primer pair described in claim 2, and the amplified product is detected by electrophoresis; The drought resistance and yield of corn with only one 968bp band in the amplified product were higher than those of corn with only one 146bp band in the amplified product and corn with both 968bp and 146bp bands in the amplified product.
8. The method according to claim 7, characterized in that The PCR amplification reaction system consisted of 10.0 μL 2×Rapid Taq Master Mix, 0.5 μL upstream primer, 0.5 μL downstream primer, 8.0 μL ddH 2 O, and 1.0 μL template DNA.
9. The method according to claim 7, characterized in that The reaction procedure of the PCR amplification was 95° C. for 2 min; 95° C. for 15 s; 52° C. for 15 s; 72° C. for 15 s, 40 cycles; and 72° C. for 5 min.
10. Use of the primer pair according to claim 2, the detection reagent according to claim 3, or the kit according to claim 4 in drought-resistant corn breeding.
Citation Information
Cited By
SNP (Single Nucleotide Polymorphism) molecular marker related to drought resistance of corn and application of SNP molecular marker
CN121065393A